Loading...
The URL can be used to link to this page
Your browser does not support the video tag.
Home
My WebLink
About
2021-04-20 City Council Meeting Packet
Agenda City Council Meeting City of Edina, Minnesota VIRTUAL MEETING Tuesday, April 20, 2021 7:00 PM Watch the meeting on cable TV or at EdinaMN.gov/LiveMeetings or Facebook.com/EdinaMN. To participate in Community Comment: Call 800-374-0221. Enter Conference ID 4677685. Give the operator your name, street address and telephone number. Press *1 on your telephone keypad when you would like to get in the queue to speak. A City sta8 member will introduce you when it is your turn. I.Call To Order II.Roll Call III.Pledge of Allegiance IV.Approval Of Meeting Agenda V.Community Comment During "Community Comment," the Mayor will invite residents to share issues or concerns that are not scheduled for a future public hearing. Items that are on tonight's agenda may not be addressed during Community Comment. Individuals must limit their comments to three minutes. The Mayor may limit the number of speakers on the same issue in the interest of time and topic. Individuals should not expect the Mayor or Council to respond to their comments tonight. The City Manager will respond to questions raised during Community Comments at the next meeting. A.City Manager's Response to Community Comments VI.Adoption Of Consent Agenda All agenda items listed on the Consent Agenda will be approved by one motion. There will be no separate discussion of items unless requested to be removed by a Council Member. If removed the item will be considered immediately following the adoption of the Consent Agenda. (Favorable rollcall vote of majority of Council Members present to approve, unless otherwise noted in consent item.) A.Approve Minutes: Joint Special Meeting, Mar. 24; Work Session and Regular, Apr. 6, 2021 B.Approve Payment of Claims C.Resolution No. 2021-35: Amending 2020 Budgeted Liquor Transfers D.Approve Agreement for the Dissolution of the Edina Fire=ghters Relief Association E.Request for Purchase: Engineering Services for Lift Station No. 3 Replacement F.Request for Purchase: Braemar Arena Dehumidi=cation System Replacement G.Ordinance No. 2021-02: Amending Chapter 2 of the City Code Boards, Committees and Commissions H.Request for Purchase: 2021 Commodities I.Request for Purchase: Fiber Optic Installation to Water Treatment Plant No. 3 J.Resolution No. 2021-36: Accepting Donations VII.Special Recognitions And Presentations A.Proclamation: Building Safety Month B.Proclamation: Arbor Day C.Racial Restrictive Covenants Update VIII.Reports/Recommendations: (Favorable vote of majority of Council Members present to approve except where noted) A.Approve Travel Demand Management Policy B.Resolution No. 2021-34: Melody Lake A&B, Grandview A, Birchcrest C Neighborhood Roadway Reconstruction, Improvement No. BA-457 C.Request for Purchase: Melody Lake A & B, Grandview A, Birchcrest C Neighborhood Roadway Reconstruction Project D.Request for Purchase: Construction Observation Assistance E.Request for Purchase: Engineering Services for Morningside Flood Infrastructure Project F.Sketch Plan Review for 4630 France Avenue G.Sketch Plan Review for 5146 Eden Avenue (former Public Works Site) IX.Commission Correspondence (Minutes and Advisory Communication) A.Minutes: Community Health Commission: Nov. 9 and Dec. 14, 2020; and Jan. 11, 2021 B.Minutes: Arts & Culture Commission Feb. 25, 2021 C.Minutes: Parks & Recreation Commission Mar. 9, 2021 X.Aviation Noise Update XI.Mayor And Council Comments XII.Manager's Comments A.Public Engagement Plan for American Rescue Plan Funds B.Project Introduction: Bristol & Mavelle Park/Lynmar Basin Stormwater Improvements XIII.Calendar of City Council Meetings and Events XIV.Adjournment The City of Edina wants all residents to be comfortable being part of the public process. If you need assistance in the way of hearing ampli=cation, an interpreter, large-print documents or something else, please call 952-927-8861 72 hours in advance of the meeting. Date: April 20, 2021 Agenda Item #: V.A. To:Mayor and City Council Item Type: Other From:Sharon Allison, City Clerk Item Activity: Subject:City Manager's Response to Community Comments Information CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: None. INTRODUCTION: City Manager Neal will respond to questions asked at the previous council meeting. Date: April 20, 2021 Agenda Item #: VI.A. To:Mayor and City Council Item Type: Minutes From:Sharon Allison, City Clerk Item Activity: Subject:Approve Minutes: Joint Special Meeting, Mar. 24; Work Session and Regular, Apr. 6, 2021 Action CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: Approve Minutes as presented. INTRODUCTION: ATTACHMENTS: Description Minutes: Draft Joint Special Meeting, Mar. 24 Minutes: Draft Work Session, Apr. 6 Minutes: Draft Regular, Apr. 6 Draft Minutes☒ Approved Minutes☐ Approved Date: ___, 2021 Page 1 of 2 Minutes Of The Edina City Council and Planning Commission Joint Virtual Meeting March 24, 2021 Call To Order Mayor Jim Hovland called the City Council and Planning Commission joint meeting to order at 7:03 PM. Roll Call Answering the roll call were: City Council Members Jackson, Pierce, Staunton, Mayor Hovland. Commissioners Miranda, Olsen, Berube, Strauss, Cullen, Bennett, Bartling, Agnew, Alkire and Chair Nemerov. Staff Present: MJ Lamon, Community Engagement Coordinator; Cary Teague, Community Development Director, Kris Aaker, Assistant Planner Emily Bodeker, Assistant Planner, Ryan Browning, I.T. Director; and Liz Olson, Administrative Support Specialist. Also present: Risi Karim and Dan Reisig. Absent from the roll call: Council Member Anderson. Community Planning and Zoning Training – City Council and Planning Commission Mayor Hovland introduced Mr. John Shardlow, FAICP, Stantec Consulting, who presented the City of Edina Community Planning and Zoning Training for Planning Commissioners and City Council Members. Mr. Shardlow shared the historical overview, the zoning ordinance, and legal issues along with the Planning Commission, City Council, and staff roles. He also presented the Open Meeting Law, conflict of interest with items and how to run effective meetings. The Planning Commission introduced themselves. Director Teague offered questions from the Council and Commission to Mr. Shardlow. Mr. Shardlow answered questions on setting a precedent with an explanation on what constitutes a precedent with a focus on treating people consistently as well as being consistent on code interpretation. He also discussed how the Commission can work with neighborhood issues and how to establish order at the beginning of the meetings. He noted it is harder to gain control of a meeting once lost so there needs to be order at the beginning with rules. Mayor Hovland asked Mr. Shardlow to speak about a PUD and interlaying code. Mr. Shardlow explained the process that needs to be taken when a PUD is proposed by an applicant. Mayor Hovland thought this was something that needed to be explained at the beginning of a Planning Commission meeting as well. Draft Minutes☒ Approved Minutes☐ Approved Date: ___, 2021 Page 2 of 2 Mr. Shardlow reviewed Comprehensive Plan changes moving forward with high density residential, office devaluation and the future of offices. He noted the City should anticipate change to the extent possible when putting the land use plan in place and try to identify trends. He also explained how the Planning Commission should think of their role as different from the City Council. Mr. Shardlow gave his opinion on virtual meetings and where he saw City meetings heading in the future. Mayor Hovland thanked Mr. Shardlow for the presentation. Adjournment The meeting adjourned at 8:56 p.m. MINUTES OF THE EDINA CITY COUNCIL WORK SESSION VIRTUAL MEETING TUESDAY, APRIL 6, 2021 5:30 P.M. CALL TO ORDER Mayor Hovland called the meeting to order at 5:33 p.m. ROLL CALL Answering roll call were Members Jackson, Pierce, Staunton, and Mayor Hovland. Member Anderson was absent. Staff in attendance: Scott Neal, City Manager; Cary Teague, Community Development Director; Emily Bodeker, Assistant City Planner; Ryan Browning, IT Director; Jennifer Bennerotte, Communications Director; Risi Karim, City Management Fellow; Jennifer Garske, Executive Assistant; and Sharon Allison, City Clerk. JOINT MEETING: PLANNING COMMISSION Staff Liaison Teague provided an update on several initiatives, starting with Initiative 1) Review of Land Use applications and stated that they have reviewed approximately 10 applications to date to be presented to Council starting in May; Initiative 2) Planning Study for the Edina Business Park was expected to begin in June. Chair Nemerov presented Initiative 3) Parking Ordinance Amendment and spoke about balancing parking needs, and recommendations they were considering such as regular review of the parking ordinance, parking reduction if located near transit or provided bicycle parking, and maximum parking. Paid parking was discussed but Manager Neal said in the past, business owners at 50th & France were not in favor because customers would patronize businesses where they did not have to pay for parking. Nemerov said parking is challenging because of winter, inadequate transit, and multimodal systems. He said the next step is for the Planning Commission to hold a public hearing on April 28. Teague spoke about Initiative 4) Review and recommend zoning ordinance changes for basement requirements and said they were working on eliminating the requirement to have a basement and allowing more flexibility because of the high-water table. In attendance for the commission were Chair Ian Nemerov; Louis Miranda, Joann Olsen, Gerard Strauss, Rachel Bartling, Sheila Berube, David Alkire, and Sophie Cullen. JOINT MEETING: HERITAGE PRESERVATION COMMISSION Chair Schilling reviewed their work plan, starting with Initiative 1) Review and decide on Certificates of Appropriateness (COA) applications for changes to heritage landmark designated properties and said they’ve processed four to date and three are pending; Initiative 2) Create a virtual walk/tour of the City’s Historic Landmark properties to celebrate Preservation Month in May and said that they were working on a schools’ tour map that could be extended as a bike tour to be completed by May; Initiative 3) Award the 2021 Heritage Preservation Award in May during Preservation Month and that two applications were received by yesterday’s due date; Initiative 4) Educate owners and designate properties as Edina Heritage Landmarks - that they’ve researched historical bungalows in Morningside, and developed outreach materials; and Initiative 5) Add properties to the Heritage Preservation eligible landmark list - that they continue to identify historical properties and are finding important history marker in later eras. Regarding COAs, Schilling shared a concern that the commission have noticed within the past year of requests for leniency for teardowns which goes against the plan of treatment. She noted a property in the Country Club area where there appeared to be an active ‘demolition by neglect’ and she wanted the Council to be aware of this so that they can be proactive. She said the commission and staff agreed the plan of treatment works but she is concerned that developers could find a loophole in it. The Council shared concerns from a developer that elements of the plan of treatment may be outdated and could cause a project to be cost prohibitive. Schilling agreed that the Edina City Council Work Session Meeting, April 6, 2021 plan of treatment needs to be reviewed and updated; however, she believed it was flexible and that existing historical property owners were able to implement it. Council recommended developing a ‘demolition by neglect’ ordinance and Manager Neal said staff would work on the ordinance. In attendance for the commission were Chair Annie Schilling; Vice Chair Sarah Nymo; Robert Cundy; Thomas Everson; Rachel Pollock; and Michael Birdman. ADJOURNMENT Mayor Hovland adjourned the meeting at 6:40 p.m. Respectfully submitted, ____________________________________________ Sharon Allison, City Clerk Minutes approved by the Edina City Council, April 20, 2021. ___________________________________________ James B. Hovland, Mayor Page 1 MINUTES OF THE REGULAR MEETING OF THE EDINA CITY COUNCIL VIRTUAL MEETING APRIL 6, 2021 7:00 P.M. I. CALL TO ORDER Mayor Hovland called the meeting to order at 7:05 p.m. and stated the meeting was being held remotely in compliance with Governor Walz’ Stay at Home Order then shared the procedure for public hearing and community comment. II. ROLLCALL Answering rollcall were Members Jackson, Pierce, Staunton, Hovland. Absent: Anderson. III. PLEDGE OF ALLEGIANCE IV. MEETING AGENDA APPROVED AS PRESENTED Member Staunton made a motion, seconded by Member Pierce, to approve the meeting agenda as presented. Rollcall: Ayes: Jackson, Pierce, Staunton, Hovland Motion carried. V. COMMUNITY COMMENT No one appeared. V.A. CITY MANAGER’S RESPONSE TO COMMUNITY COMMENTS Manager Neal said there were no Community Comments at the last meeting. VI. CONSENT AGENDA ADOPTED AS AMENDED Mr. Neal requested that Item VI.G. be removed until more information was made available. Member Jackson made a motion, seconded by Member Pierce, approving the consent agenda as amended, removing Item VI.G., Request for Purchase Fiber Optic Installation to Water Treatment Plant No. 3, as follows: VI.A. Approve minutes of the Work Session and Regular Meetings of March 16, 2021 VI.B. Approve payment claims Check Register Claims Pre-List dated March 19, 2021, totaling $1,290,249.84, Check Register Claims Pre-List dated March 26, 2021, totaling $1,717,331.12, and Check Register Claims Pre-List dated April 2, 2021, totaling $551,057.02. VI.C. Request for Purchase; awarding the bid to the recommended low bidder, ENG 21-4NB Vegetated Stormwater Best Management Practices (BMPs) Program Services, Sandstorm Land Management for $34,500 over 3 years VI.D. Request for Purchase; awarding the bid to the recommended low bidder, Repair/Rehab Services for Edina Aquatic Center Zipline Structure, Metro Manufacturing/Metro Erectors Inc. for repair/rehab services for Edina Aquatic Center zipline structure for $33,983. VI.E. Request for Purchase; awarding the bid to the recommended low bidder, Server Replacements, LOGIS/Insight for $58,622.04. Minutes/Edina City Council/April 6, 2021 Page 2 VI.F. Request for Purchase; awarding the bid to the recommended low bidder, Recreation Software and Services Agreement, CivicPlus for $53,743.20 VI.G. Request for Purchase; Fiber Optic Installation to Water Treatment Plant No. 3, Castrejon VI.H. Adopt Ordinance No. 2021-02; Amending Chapter 2 of the City Code Boards, Committee, and Commissions VI.I. Adopt Resolution No. 2021-26; Supporting Local Control for Local Elections VI.J. Adopt Resolution No. 2021-30; Authorizing Removal of a Levied Special Assessment VI.K. Adopt Resolution No. 2021-31; Supporting Cooperative Agreement with MnDOT for Landscape Partnership Program VI.L. Approve Amendment to New Multi-Family Affordable Housing Policy. VI.M. Arts and Culture Commission Appointment VI.N. Adopt Resolution No. 2021-32; Accepting Minnesota PGA Section and PGA REACH Minnesota Grant VI.O. Approve Tyler Contract Timeline Amendment VI.P. Adopt Resolution No. 2021-33; Accepting Donations Rollcall: Ayes: Jackson, Pierce, Staunton, Hovland Motion carried. VII. SPECIAL RECOGNITIONS AND PRESENTATIONS VII.A. NATIONAL PUBLIC HEALTH WEEK – PROCLAIMED Mayor Hovland read in full a proclamation to declare the week of April 5-11, 2021, National Public Health Week in the City of Edina. Member Jackson made a motion, seconded by Member Pierce, to approve a proclamation recognizing National Public Health Week. Rollcall: Ayes: Jackson, Pierce, Staunton, Hovland Motion carried. Community Health Administrator Brown thanked the Council for the recognition then shared how public health officials have been front and center this past year and how collaboration with Bloomington and Richfield had been emphasized since the pandemic. He spoke about efforts to help those who have been working so hard for so long then commented about the work of the new mental health professional. The Council thanked everyone for their work during this difficult time and commented on the importance of public health as well as mental health services for health officials. VII.B. NATIONAL PUBLIC SAFETY TELECOMMUNICATOR WEEK – PROCLAIMED Mayor Hovland read in full a proclamation declaring the week of April 11 - 17, 2021, National Telecommunications Week in the City of Edina. Dispatch Supervisor Harris thanked the Council for the proclamation that recognized the work of the Edina 911 Communications Center then shared that dispatchers received 113,000 calls for service in 2020 and described how they worked in a highly technical environment that made staff skilled change agents. She spoke of the daily physical and emotional stressors, especially during the current pandemic and civil unrest and how proud she was of these essential employees. She thanked leadership for the recognition. Police Chief Nelson and Mr. Neal thanked the Council for the proclamation that recognized the hard work of dispatchers whose hard work was on the very front line of first response. The Council noted the dispatch center served the Richfield community as well as Edina and thanked the entire staff. Member Pierce made a motion, seconded by Member Staunton, to approve a proclamation recognizing National Public Safety Telecommunicator Week. Minutes/Edina City Council/April 6, 2021 Page 3 Rollcall: Ayes: Jackson, Pierce, Staunton, Hovland Motion carried. VII.C. HENNEPIN COUNTY COMMISSIONER CHRIS LATONDRESSE UPDATE - RECEIVED District 6 Hennepin County Commissioner Chris LaTondresse spoke about how local government was built on strong partnerships and painful events of the past year had tested us. He said leading in local government had been challenging but residents had stepped up to meet these challenges then spoke about COVID-19 response that included emergency rental assistance and small business grants, Elevate Business Hennepin County program, and the County’s Climate Action Plan. He outlined his top priorities included housing, public safety, and economic development, and said he looked forward to partnering with Edina on these goals. The Council thanked Commissioner LaTondresse for his work. VIII. PUBLIC HEARINGS VIII.A. NEW ON-SALE INTOXICATING AND SUNDAY SALE LIQUOR LICENSES FOR YUMI SOUTHDALE LLC DBA YUMI SOUTHDALE LLC – APPROVED Clerk Allison shared Yumi Southdale LLC had applied for liquor licenses for the new restaurant at 200 Southdale Center #2C. She said staff had reviewed the application and found it complied with code requirements and a background investigation was completed by the police department with no concerns raised. She said staff recommended approval of the liquor licenses and approve the license instead of carrying the item over for approval on April 20. Clerk Allison noted the public hearing was posted on Better Together Edina with no public comments to date. Mayor Hovland opened the public hearing at 7:51 p.m. Public Testimony No one appeared. Member Staunton made a motion, Pierce moved to close the public hearing. Rollcall: Ayes: Jackson, Pierce, Staunton, Hovland Motion carried. Member Jackson made a motion, seconded by Member Staunton, to approve a new On-Sale Intoxicating and Sunday Sale Liquor Licenses for Yumi Southdale LLC dba Yumi Southdale LLC, a restaurant located at 200 Southdale Center #2C, Edina. Rollcall: Ayes: Jackson, Pierce, Staunton, Hovland Motion carried. VIII.B. RESOLUTION NO. 2021-34, MELODY LAKE A&B, GRANDVIEW A, BIRCHCREST C NEIGHBORHOOD ROADWAY RECONSTRUCTION, IMPROVEMENT NO. BA-457 – CONTINUED TO APRIL 12, 2021 Director of Engineering Millner stated this public hearing was for residents of 5100 - 5113 Grove Street as their addresses were missed on the list of properties to be assessed on the initial public hearing notice. He said staff initiated this project and proposed to reconstruct Bernard Place, Code Avenue, Dale Avenue, Eastview Drive, Grove Street, Hansen Road, Josephine Avenue, Melody Lane, Melody Lake Drive, Tingdale Avenue, Windsor Avenue, West 56th Street, West 57th Street, West 58th Street and West 59th Street. He said the overall project cost was estimated at $16,361,168 and funding would be a combination of special assessments, City Utility and Pedestrian and Cyclists Safety (PACS) funds. He noted this action would recall the final decision on assessments delayed for up to 6-months from the original public hearing for staff to bring back more information on the entire project which will occur on April 20. Mayor Hovland opened the public hearing at 7:57 p.m. Minutes/Edina City Council/April 6, 2021 Page 4 Public Testimony No one appeared. Member Jackson moved to extend public hearing to noon on April 12, 2021 and take final action on Resolution No. 2021-34, Melody Lake A&B, Grandview A, Birchcrest C Neighborhood Roadway Reconstruction, Improvement No. BA-457 at the April 20, 2021 City Council meeting. Member Pierce seconded the motion. The Council requested that staff verify any new comments were reviewed on Better Together Edina prior to April 20. Rollcall: Ayes: Brindle, Fischer, Staunton, Hovland Motion carried. IX. REPORTS/RECOMMENDATIONS IX.A. REVISIONS TO ASSESSMENT POLICY – APPROVED Mr. Millner shared proposed policy revisions to the Assessment Policy to remove subcuts and public retaining walls from special assessments for the Melody Lake and Creek Knoll street projects. He noted the assessments and contract award would occur at the April 20 meeting and that while funding discussions were continuing this amendment was recommended by the Task Force for projects effective 2021 projects. He said the Council would revisit final street funding decisions for the 2022/2023 budget at a worksession in June and reasons for this approval that could delay award. Member Staunton moved, seconded by Member Jackson, to approve Revisions to Assessment Policy removing subcuts and public retaining walls from special assessments for 2021 Street Reconstruction Projects, Melody Lake and Creek Knoll. Rollcall: Ayes: Brindle, Fischer, Staunton, Hovland Motion carried. IX.B. REQUEST FOR PURCHASE: ORGANICS RECYCLING PROGRAM SUPPLIES – APPROVED Organic Recycling Coordinator Singh shared the request for purchase for compost and organics recycling supplies for residents from the Shakopee Mdewakanton Sioux Community for $107,000 and the proposal to use SCORE grant funds to purchase these supplies to increase participation and help defray program costs to residents. She noted Edina was one of the first cities to be fully online with a curbside program, before the requirement of program offering by 2022, and how approval would allow purchase of compost for garden use at home and in the community gardens as well as help a locally owned green industries business. She said the remaining funds from the grant would be used for fee reductions. The Council shared their excitement for this proposal as a way to address resident concerns then suggested the farmer’s market as another opportunity for education. The Council stressed the importance of public education to help residents see the value of the program and keep operating costs down. Member Pierce moved, seconded by Member Jackson, to approve request for purchase of compost and organics recycling supplies for residents from Shakopee Mdewakanton Sioux Community for $107,000. Rollcall: Ayes: Brindle, Fischer, Staunton, Hovland Motion carried. X. CORRESPONDENCE AND PETITIONS - Received X.A. COMMISSION CORRESPONDENCE (MINUTES AND ADVISORY COMMUNICATION) 1. MINUTES: ENERGY AND ENVIRONMENT COMMISSION, JANUARY 14, 2021 2. MINUTES: ENERGY AND ENVIRONMENT COMMISSION, FEBRUARY 11, 2021 Minutes/Edina City Council/April 6, 2021 Page 5 3. MINUTES: TRANSPORTATION COMMISSION, FEBRUARY 18, 2021 4. MINUTES: HUMAN RIGHTS AND RELATIONS COMMISSION, FEBRUARY 23, 2021 XI. AVIATION NOISE UPDATE – No update XII. MAYOR AND COUNCIL COMMENTS – Received XIII. MANAGER’S COMMENTS – Received XIII.A. Q4 QUARTERLY BUSINESS REPORTS – Received XIII.B. INTERVIEW PROCESS AND TIMELINE FOR STUDENT COMMISSIONERS – Received XIII.C. PREP MEMO FOR APRIL 6, 2021, CITY COUNCIL WORK SESSION AND MEETING – Received XIV. CALENDAR OF CITY COUNCIL MEETINGS AND EVENTS – Received XV. ADJOURNMENT Member Staunton made a motion, seconded by Member Jackson, to adjourn the meeting at 8:50 p.m. Rollcall: Ayes: Jackson, Pierce, Staunton, Hovland Motion carried. Respectfully submitted, Sharon Allison, City Clerk Minutes approved by Edina City Council, April 20, 2021. James B. Hovland, Mayor Video Copy of the April 6, 2021, meeting available. Date: April 20, 2021 Agenda Item #: VI.B. To:Mayor and City Council Item Type: Claims From:Don Uram, Finance Director Item Activity: Subject:Approve Payment of Claims Action CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: Approve claims for payment: Check Register Claims Pre-List Dated 04.09.21 TOTAL $885,103.62 Check Register Claims Pre-List Dated 04.16.21 TOTAL $693,395.23 INTRODUCTION: Claims information for approval is attached. ATTACHMENTS: Description Check Register Claims Pre-List Dated 04.09.21 TOTAL $885,103.62 Check Register Claims Pre-List Dated 04.16.21 TOTAL $693,395.23 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/08/2021 14:28User: LJeffersonProgram ID: apcshdsb Page 30 JOURNAL ENTRIES TO BE CREATED FUND SUB FUND DUE TO DUE FR 1000 General 57,803.672600 Housing & Redvlpmt Authority 397.502600 Housing & Redvlpmt Authority 54.024000 Capital Projects 26,780.024400 PIR Capital Projects 700.005200 Braemar Golf Course 34,636.635200 Braemar Golf Course 126.565400 Edinborough Park 13,804.995500 Braemar Arena 972.985600 Braemar Field 2,032.235700 Centennial Lakes 48.955800 Liquor 178,767.675900 Utility Fund 17,147.805900 Utility Fund 6,502.635900 Utility Fund 2,693.405900 Utility Fund 245.006000 Risk Management 30,792.156100 Equipment Operations 5,548.306200 Information Technology 123.856300 Facilities Management 5,631.387100 PS Training Facility 5,839.117200 MN Task Force 1 45,889.289000 Payroll 418,565.509999 Pooled Cash Fund 855,103.62 TOTAL 855,103.62 855,103.62 ** END OF REPORT - Generated by Lonnia Jefferson ** City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/08/2021 14:28User: LJeffersonProgram ID: apcshdsb Page 1 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET 458082 04/09/2021 PRTD 143143 ACT CLEANING SERVICE 1616 03/18/2021 20210904 1,333.31 CHECK 458082 TOTAL: 1,333.31 458083 04/09/2021 PRTD 140318 ADVANCED ELEMENTS, INC 73331 03/09/2021 20210904 13,969.90 ADVANCED ELEMENTS, INC 73247 03/09/2021 20210904 4,584.98 ADVANCED ELEMENTS, INC 73138 03/09/2021 20210904 14,981.05 ADVANCED ELEMENTS, INC 73139 03/09/2021 20210904 581.00 CHECK 458083 TOTAL: 34,116.93 458084 04/09/2021 PRTD 141960 AMAZON CAPITAL SERVICES 1TND-C7VL-JPQP 03/09/2021 20210904 14.89 AMAZON CAPITAL SERVICES 16CV-DR9J-RRH9 03/09/2021 20210904 359.99 AMAZON CAPITAL SERVICES 1VVN-QXJT-4XF1 03/09/2021 20210904 55.39 AMAZON CAPITAL SERVICES 1TND-C7VL-VYPP 03/09/2021 20210904 367.96 AMAZON CAPITAL SERVICES 1L7J-R3CM-4CR3 03/09/2021 20210904 127.95 AMAZON CAPITAL SERVICES 1VHT-91VW-993V 03/09/2021 20210904 5.99 AMAZON CAPITAL SERVICES 1711-6LMW-9JX9 03/10/2021 20210904 67.89 AMAZON CAPITAL SERVICES 1HLN-HDJX-C3M6 03/10/2021 20210904 48.95 AMAZON CAPITAL SERVICES 1L7J-R3CM-PTRD 03/10/2021 20210904 10.70 AMAZON CAPITAL SERVICES 1VP6-NP4X-FPKC 03/10/2021 20210904 29.98 AMAZON CAPITAL SERVICES 1Y94-FHN1-R93F 03/11/2021 20210904 340.44 AMAZON CAPITAL SERVICES 1HX3-L6VP-WYHJ 03/12/2021 20210904 43.00 AMAZON CAPITAL SERVICES 14D1-L3GT-D76N 03/12/2021 20210904 249.00 AMAZON CAPITAL SERVICES 17DH-KFTJ-DPL1 03/13/2021 20210904 114.06 AMAZON CAPITAL SERVICES 1M7G-PCY9-KRHD 03/14/2021 20210904 104.24 AMAZON CAPITAL SERVICES 16WL-XT7T-CN3L 03/27/2021 20210904 277.84 AMAZON CAPITAL SERVICES 1MHD-1HKD-KMW6 04/01/2021 20210904 392.94 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/08/2021 14:28User: LJeffersonProgram ID: apcshdsb Page 2 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET CHECK 458084 TOTAL: 2,611.21 458085 04/09/2021 PRTD 151441 ARAMARK UNIFORM AND CAREER APPEAL 1005001283 03/09/2021 20210904 204.61 ARAMARK UNIFORM AND CAREER APPEAL 1005003115 03/09/2021 20210904 262.95 ARAMARK UNIFORM AND CAREER APPEAL 1005002465 03/10/2021 20210904 426.54 CHECK 458085 TOTAL: 894.10 458086 04/09/2021 PRTD 106304 ASPEN MILLS INC 270645 03/11/2021 20210904 218.85 CHECK 458086 TOTAL: 218.85 458087 04/09/2021 PRTD 102113 AUDRANN INC 1299565 02/11/2021 20210904 78.11 CHECK 458087 TOTAL: 78.11 458088 04/09/2021 PRTD 101718 AUTO PLUS - FORMERLY PARTS PLUS 380044696 03/12/2021 20210904 10.77 CHECK 458088 TOTAL: 10.77 458089 04/09/2021 PRTD 100637 AUTOMOBILE SERVICE COMPANY 6430 03/09/2021 20210904 172.74 CHECK 458089 TOTAL: 172.74 458090 04/09/2021 PRTD 104416 BERNARD J MULCAHY COMPANY INC PS-INV123849 03/10/2021 20210904 740.00 BERNARD J MULCAHY COMPANY INC PS-INV123878 03/11/2021 20210904 1,564.32 CHECK 458090 TOTAL: 2,304.32 458091 04/09/2021 PRTD 143097 BERRY DUNN MCNEIL & PARKER LLC 400350 03/10/2021 20210904 2,040.00 CHECK 458091 TOTAL: 2,040.00 458092 04/09/2021 PRTD 100648 BERTELSON BROTHERS INC WO-1116567-1 03/09/2021 20210904 31.78 BERTELSON BROTHERS INC CP-WO-1115420-1-1 03/10/2021 20210904 -21.49 BERTELSON BROTHERS INC WO-1117159-1 03/11/2021 20210904 16.98 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/08/2021 14:28User: LJeffersonProgram ID: apcshdsb Page 3 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET CHECK 458092 TOTAL: 27.27 458093 04/09/2021 PRTD 105693 BGH INVESTMENTS INC 44963 06/30/2020 20210904 54.02 CHECK 458093 TOTAL: 54.02 458094 04/09/2021 PRTD 151149 BOARMAN KROOS VOGEL GROUP INC 56308 03/10/2021 20210904 2,571.57 CHECK 458094 TOTAL: 2,571.57 458095 04/09/2021 PRTD 119351 BOURGET IMPORTS 176367 03/23/2021 20210904 1,736.05 BOURGET IMPORTS 176368 03/23/2021 20210904 968.25 BOURGET IMPORTS 176366 03/24/2021 20210904 1,835.25 CHECK 458095 TOTAL: 4,539.55 458096 04/09/2021 PRTD 142566 BRASS FOUNDRY BREWING CO E-6169 03/23/2021 20210904 128.00 CHECK 458096 TOTAL: 128.00 458097 04/09/2021 PRTD 100664 BRAUN INTERTEC CORPORATION B247304 04/02/2021 20210904 700.00 CHECK 458097 TOTAL: 700.00 458098 04/09/2021 PRTD 124291 BREAKTHRU BEVERAGE MINNESOTA WINE 338795229 03/19/2021 20210904 566.74 BREAKTHRU BEVERAGE MINNESOTA WINE 338795238 03/19/2021 20210904 500.75 BREAKTHRU BEVERAGE MINNESOTA WINE 338837359 03/24/2021 20210904 634.60 BREAKTHRU BEVERAGE MINNESOTA WINE 338837333 03/24/2021 20210904 1,028.65 BREAKTHRU BEVERAGE MINNESOTA WINE 338837360 03/24/2021 20210904 1,020.65 BREAKTHRU BEVERAGE MINNESOTA WINE 338837334 03/24/2021 20210904 2,112.71 BREAKTHRU BEVERAGE MINNESOTA WINE 338837361 03/24/2021 20210904 1,704.65 BREAKTHRU BEVERAGE MINNESOTA WINE 338837335 03/24/2021 20210904 1,886.46 BREAKTHRU BEVERAGE MINNESOTA WINE 338837362 03/24/2021 20210904 2,561.44 BREAKTHRU BEVERAGE MINNESOTA WINE 338837358 03/24/2021 20210904 212.18 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/08/2021 14:28User: LJeffersonProgram ID: apcshdsb Page 4 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET BREAKTHRU BEVERAGE MINNESOTA WINE 338837355 03/24/2021 20210904 3,347.60 BREAKTHRU BEVERAGE MINNESOTA WINE 338837354 03/24/2021 20210904 45.15 BREAKTHRU BEVERAGE MINNESOTA WINE 338837352 03/24/2021 20210904 1,648.10 BREAKTHRU BEVERAGE MINNESOTA WINE 338837357 03/24/2021 20210904 3,630.00 BREAKTHRU BEVERAGE MINNESOTA WINE 338837356 03/24/2021 20210904 1,656.65 BREAKTHRU BEVERAGE MINNESOTA WINE 338879213 03/22/2021 20210904 181.34 CHECK 458098 TOTAL: 22,737.67 458099 04/09/2021 PRTD 124529 BREAKTHRU BEVERAGE MINNESOTA BEER 359690147 03/19/2021 20210904 -238.01 BREAKTHRU BEVERAGE MINNESOTA BEER 338816099 03/23/2021 20210904 1,288.00 BREAKTHRU BEVERAGE MINNESOTA BEER 338816087 03/23/2021 20210904 148.00 BREAKTHRU BEVERAGE MINNESOTA BEER 338816088 03/23/2021 20210904 3,573.30 CHECK 458099 TOTAL: 4,771.29 458100 04/09/2021 PRTD 124529 BREAKTHRU BEVERAGE MINNESOTA BEER 338816097 03/23/2021 20210904 148.00 BREAKTHRU BEVERAGE MINNESOTA BEER 338816098 03/23/2021 20210904 3,323.25 CHECK 458100 TOTAL: 3,471.25 458101 04/09/2021 PRTD 102149 CALLAWAY GOLF 932723746 03/09/2021 20210904 2,078.75 CALLAWAY GOLF 932723760 03/09/2021 20210904 185.84 CALLAWAY GOLF 932730178 03/09/2021 20210904 259.32 CALLAWAY GOLF 932730189 03/09/2021 20210904 225.00 CALLAWAY GOLF 932752115 03/12/2021 20210904 2,037.17 CALLAWAY GOLF 932752117 03/12/2021 20210904 487.42 CALLAWAY GOLF 932746189 03/11/2021 20210904 78.36 CALLAWAY GOLF 932752114 03/12/2021 20210904 2,078.75 CALLAWAY GOLF 932733437 03/10/2021 20210904 567.00 CALLAWAY GOLF 932733436 03/10/2021 20210904 225.48 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/08/2021 14:28User: LJeffersonProgram ID: apcshdsb Page 5 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET CALLAWAY GOLF 932733438 03/10/2021 20210904 880.75 CHECK 458101 TOTAL: 9,103.84 458102 04/09/2021 PRTD 119455 CAPITOL BEVERAGE SALES LP 2527242 03/23/2021 20210904 3,875.65 CAPITOL BEVERAGE SALES LP 2527244 03/23/2021 20210904 207.00 CAPITOL BEVERAGE SALES LP 2527241 03/23/2021 20210904 94.74 CAPITOL BEVERAGE SALES LP 2527250 03/23/2021 20210904 2,445.50 CAPITOL BEVERAGE SALES LP 2527248 03/23/2021 20210904 234.00 CAPITOL BEVERAGE SALES LP 2527249 03/23/2021 20210904 46.24 CAPITOL BEVERAGE SALES LP 2527238 03/23/2021 20210904 175.50 CAPITOL BEVERAGE SALES LP 2527239 03/23/2021 20210904 775.50 CAPITOL BEVERAGE SALES LP 6251013 03/23/2021 20210904 -56.40 CHECK 458102 TOTAL: 7,797.73 458103 04/09/2021 PRTD 144099 CELLEBRITE INC INVUS227655 03/12/2021 20210904 3,700.00 CHECK 458103 TOTAL: 3,700.00 458104 04/09/2021 PRTD 142028 CINTAS CORPORATION 4078416401 03/12/2021 20210904 63.28 CINTAS CORPORATION 4079197978 03/22/2021 20210904 51.69 CINTAS CORPORATION 4079083217 03/19/2021 20210904 63.28 CHECK 458104 TOTAL: 178.25 458105 04/09/2021 PRTD 122317 CITY OF EDINA - COMMUNICATIONS COM-2390 03/12/2021 20210904 100.00 CHECK 458105 TOTAL: 100.00 458106 04/09/2021 PRTD 139927 CITY OF ROCHESTER MN 6755 02/24/2021 20210904 22,075.00 CHECK 458106 TOTAL: 22,075.00 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/08/2021 14:28User: LJeffersonProgram ID: apcshdsb Page 6 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET 458107 04/09/2021 PRTD 139927 CITY OF ROCHESTER MN 5890 03/14/2021 20210904 486.11 CHECK 458107 TOTAL: 486.11 458108 04/09/2021 PRTD 139927 CITY OF ROCHESTER MN 5891 03/14/2021 20210904 101.61 CHECK 458108 TOTAL: 101.61 458109 04/09/2021 PRTD 139927 CITY OF ROCHESTER MN 5895 03/14/2021 20210904 482.32 CHECK 458109 TOTAL: 482.32 458110 04/09/2021 PRTD 139927 CITY OF ROCHESTER MN 5897 03/14/2021 20210904 446.26 CHECK 458110 TOTAL: 446.26 458111 04/09/2021 PRTD 139927 CITY OF ROCHESTER MN 5898 03/14/2021 20210904 39.16 CHECK 458111 TOTAL: 39.16 458112 04/09/2021 PRTD 139927 CITY OF ROCHESTER MN 5900 03/14/2021 20210904 933.35 CHECK 458112 TOTAL: 933.35 458113 04/09/2021 PRTD 139927 CITY OF ROCHESTER MN 5901 03/14/2021 20210904 2,659.25 CHECK 458113 TOTAL: 2,659.25 458114 04/09/2021 PRTD 139927 CITY OF ROCHESTER MN 5903 03/14/2021 20210904 263.21 CHECK 458114 TOTAL: 263.21 458115 04/09/2021 PRTD 139927 CITY OF ROCHESTER MN 5908 03/14/2021 20210904 5,189.65 CHECK 458115 TOTAL: 5,189.65 458116 04/09/2021 PRTD 139927 CITY OF ROCHESTER MN 5909 03/14/2021 20210904 4,455.03 CHECK 458116 TOTAL: 4,455.03 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/08/2021 14:28User: LJeffersonProgram ID: apcshdsb Page 7 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET 458117 04/09/2021 PRTD 139927 CITY OF ROCHESTER MN 6682 03/14/2021 20210904 5,164.42 CHECK 458117 TOTAL: 5,164.42 458118 04/09/2021 PRTD 146213 CITY OF ST LOUIS PARK 30042 03/09/2021 20210904 850.32 CHECK 458118 TOTAL: 850.32 458119 04/09/2021 PRTD 102571 COMPASS GROUP USA, INC. 1120876 03/01/2021 20210904 160.00 CHECK 458119 TOTAL: 160.00 458120 04/09/2021 PRTD 101403 CRYSTEEL MANUFACTURING INC LC00069896 03/09/2021 20210904 516.69 CRYSTEEL MANUFACTURING INC LC00069899 03/09/2021 20210904 143.84 CHECK 458120 TOTAL: 660.53 458121 04/09/2021 PRTD 101418 CUMMINS NPOWER LLC E4-64681 03/11/2021 20210904 647.08 CHECK 458121 TOTAL: 647.08 458122 04/09/2021 PRTD 100130 DAKOTA COUNTY 5888 03/12/2021 20210904 2,458.75 DAKOTA COUNTY 5889 03/12/2021 20210904 284.84 CHECK 458122 TOTAL: 2,743.59 458123 04/09/2021 PRTD 151126 DANIEL Q MCDOWELL JR AND JENNIFER FEBRUARY 2021 03/12/2021 20210904 315.00 CHECK 458123 TOTAL: 315.00 458124 04/09/2021 PRTD 118190 DAVIS EQUIPMENT CORPORATION JI56998A 03/10/2021 20210904 59.10 CHECK 458124 TOTAL: 59.10 458125 04/09/2021 PRTD 160059 DOALL COMPANY 59161513 03/10/2021 20210904 179.81 CHECK 458125 TOTAL: 179.81 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/08/2021 14:28User: LJeffersonProgram ID: apcshdsb Page 8 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET 458126 04/09/2021 PRTD 121103 DIRECTV GROUP INC 016523692X210313 03/13/2021 20210904 105.23 CHECK 458126 TOTAL: 105.23 458127 04/09/2021 PRTD 100730 DORSEY & WHITNEY LLP 3647881 03/09/2021 20210904 397.50 CHECK 458127 TOTAL: 397.50 458128 04/09/2021 PRTD 145811 EASTLAKE CRAFT BREWERY LLC 1254 03/23/2021 20210904 187.20 EASTLAKE CRAFT BREWERY LLC 1255 03/23/2021 20210904 186.60 CHECK 458128 TOTAL: 373.80 458129 04/09/2021 PRTD 100146 ELLIOTT AUTO SUPPLY CO, INC 1-6796210 03/10/2021 20210904 153.84 ELLIOTT AUTO SUPPLY CO, INC 69-410261 03/10/2021 20210904 232.07 ELLIOTT AUTO SUPPLY CO, INC 1-6795302 03/10/2021 20210904 74.06 ELLIOTT AUTO SUPPLY CO, INC 69-410374 03/11/2021 20210904 32.98 ELLIOTT AUTO SUPPLY CO, INC 1-6797300 03/11/2021 20210904 52.56 ELLIOTT AUTO SUPPLY CO, INC 69-410270 03/10/2021 20210904 76.92 ELLIOTT AUTO SUPPLY CO, INC 5-3760187 03/09/2021 20210904 28.41 CHECK 458129 TOTAL: 650.84 458130 04/09/2021 PRTD 147181 FALLING BREWERY - BERGMAN LEDGE L E-3003 03/23/2021 20210904 210.00 FALLING BREWERY - BERGMAN LEDGE L E-3005 03/23/2021 20210904 330.00 FALLING BREWERY - BERGMAN LEDGE L E-3004 03/23/2021 20210904 210.00 CHECK 458130 TOTAL: 750.00 458131 04/09/2021 PRTD 103600 FERGUSON US HOLDINGS INC 0469826-1 03/10/2021 20210904 124.68 FERGUSON US HOLDINGS INC 0470103 03/10/2021 20210904 36.60 FERGUSON US HOLDINGS INC 0469833 03/11/2021 20210904 4,597.40 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/08/2021 14:28User: LJeffersonProgram ID: apcshdsb Page 9 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET CHECK 458131 TOTAL: 4,758.68 458132 04/09/2021 PRTD 116492 FINANCE AND COMMERCE INC 744993742 03/11/2021 20210904 219.56 CHECK 458132 TOTAL: 219.56 458133 04/09/2021 PRTD 102727 FORCE AMERICA DISTRIBUTING LLC 001-1523272 03/12/2021 20210904 125.00 CHECK 458133 TOTAL: 125.00 458134 04/09/2021 PRTD 102456 GALLS PARENT HOLDINGS LLC BC1310295 03/10/2021 20210904 2,713.75 GALLS PARENT HOLDINGS LLC BC1310940 03/09/2021 20210904 99.95 CHECK 458134 TOTAL: 2,813.70 458135 04/09/2021 PRTD 101931 HANESBRANDS INC 41809738 03/12/2021 20210904 1,114.65 HANESBRANDS INC 41810169 03/12/2021 20210904 1,792.16 CHECK 458135 TOTAL: 2,906.81 458136 04/09/2021 PRTD 144412 WINEBOW MN00091829 03/23/2021 20210904 730.50 WINEBOW MN00091807 03/23/2021 20210904 2,756.50 WINEBOW MN00091852 03/23/2021 20210904 405.25 CHECK 458136 TOTAL: 3,892.25 458137 04/09/2021 PRTD 122093 GROUP HEALTHPLAN INC 103545551 03/09/2021 20210904 23,114.39 GROUP HEALTHPLAN INC 103551258 03/09/2021 20210904 418,565.50 CHECK 458137 TOTAL: 441,679.89 458138 04/09/2021 PRTD 100790 HACH COMPANY 12362485 03/11/2021 20210904 491.00 CHECK 458138 TOTAL: 491.00 458139 04/09/2021 PRTD 103884 HANCO CORP 563106 03/11/2021 20210904 673.75 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/08/2021 14:28User: LJeffersonProgram ID: apcshdsb Page 10 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET CHECK 458139 TOTAL: 673.75 458140 04/09/2021 PRTD 143585 HENNEPIN COUNTY MEDICAL CENTER 68469 03/01/2021 20210904 3,136.14 HENNEPIN COUNTY MEDICAL CENTER 68762 03/29/2021 20210904 2,550.00 CHECK 458140 TOTAL: 5,686.14 458141 04/09/2021 PRTD 104375 HOHENSTEINS INC 396770 03/23/2021 20210904 1,602.50 HOHENSTEINS INC 396771 03/23/2021 20210904 119.20 HOHENSTEINS INC 396760 03/23/2021 20210904 2,200.50 HOHENSTEINS INC 396865 03/23/2021 20210904 1,792.50 HOHENSTEINS INC 396763 03/23/2021 20210904 75.60 CHECK 458141 TOTAL: 5,790.30 458142 04/09/2021 PRTD 131544 INDEED BREWING COMPANY MN LLC 98817 03/24/2021 20210904 1,234.60 INDEED BREWING COMPANY MN LLC 98855 03/23/2021 20210904 280.50 INDEED BREWING COMPANY MN LLC 98818 03/24/2021 20210904 200.50 CHECK 458142 TOTAL: 1,715.60 458143 04/09/2021 PRTD 100814 INDELCO PLASTICS CORPORATION INV243399 03/10/2021 20210904 321.60 INDELCO PLASTICS CORPORATION INV243586 03/10/2021 20210904 46.35 INDELCO PLASTICS CORPORATION INV243605 03/10/2021 20210904 43.48 INDELCO PLASTICS CORPORATION INV244198 03/12/2021 20210904 12.63 CHECK 458143 TOTAL: 424.06 458144 04/09/2021 PRTD 150898 INVICTUS BREWING INC 2656 03/23/2021 20210904 78.00 INVICTUS BREWING INC 2657 03/22/2021 20210904 93.00 CHECK 458144 TOTAL: 171.00 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/08/2021 14:28User: LJeffersonProgram ID: apcshdsb Page 11 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET 458145 04/09/2021 PRTD 121075 JIMMY'S JOHNNYS INC 178991 03/10/2021 20210904 60.00 JIMMY'S JOHNNYS INC 178992 03/10/2021 20210904 68.00 JIMMY'S JOHNNYS INC 178993 03/10/2021 20210904 53.43 JIMMY'S JOHNNYS INC 178994 03/10/2021 20210904 53.43 CHECK 458145 TOTAL: 234.86 458146 04/09/2021 PRTD 160041 JINX TEA, LLC 551202 03/24/2021 20210904 64.40 CHECK 458146 TOTAL: 64.40 458147 04/09/2021 PRTD 100741 JJ TAYLOR DISTRIBUTING CO OF MINN 3168879 03/24/2021 20210904 83.10 JJ TAYLOR DISTRIBUTING CO OF MINN 3168878 03/24/2021 20210904 3,331.10 JJ TAYLOR DISTRIBUTING CO OF MINN 3168880 03/24/2021 20210904 4,947.05 JJ TAYLOR DISTRIBUTING CO OF MINN 3168881 03/24/2021 20210904 2,589.60 CHECK 458147 TOTAL: 10,950.85 458148 04/09/2021 PRTD 100835 ARTISAN BEER COMPANY 3465671 03/22/2021 20210904 254.00 CHECK 458148 TOTAL: 254.00 458149 04/09/2021 PRTD 100835 JOHNSON BROTHERS LIQUOR CO 1764067 03/19/2021 20210904 11,172.22 JOHNSON BROTHERS LIQUOR CO 1764069 03/19/2021 20210904 22,938.00 JOHNSON BROTHERS LIQUOR CO 1764063 03/19/2021 20210904 4,849.95 JOHNSON BROTHERS LIQUOR CO 1764061 03/19/2021 20210904 6,317.60 JOHNSON BROTHERS LIQUOR CO 1764058 03/19/2021 20210904 763.14 JOHNSON BROTHERS LIQUOR CO 1764055 03/19/2021 20210904 1,331.90 JOHNSON BROTHERS LIQUOR CO 139918 03/19/2021 20210904 -19.66 JOHNSON BROTHERS LIQUOR CO 139917 03/19/2021 20210904 -14.33 JOHNSON BROTHERS LIQUOR CO 1764367 03/19/2021 20210904 1,046.28 JOHNSON BROTHERS LIQUOR CO 1762993 03/23/2021 20210904 1,334.70 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/08/2021 14:28User: LJeffersonProgram ID: apcshdsb Page 12 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET JOHNSON BROTHERS LIQUOR CO 1762991 03/23/2021 20210904 3,951.28 JOHNSON BROTHERS LIQUOR CO 1764366 03/19/2021 20210904 784.71 JOHNSON BROTHERS LIQUOR CO 1764068 03/19/2021 20210904 6,638.33 JOHNSON BROTHERS LIQUOR CO 1764059 03/19/2021 20210904 535.57 JOHNSON BROTHERS LIQUOR CO 1764054 03/19/2021 20210904 18,321.99 JOHNSON BROTHERS LIQUOR CO 1764070 03/19/2021 20210904 376.29 JOHNSON BROTHERS LIQUOR CO 1764065 03/19/2021 20210904 4,203.28 JOHNSON BROTHERS LIQUOR CO 1764062 03/19/2021 20210904 7,529.50 JOHNSON BROTHERS LIQUOR CO 1764056 03/19/2021 20210904 1,331.90 JOHNSON BROTHERS LIQUOR CO 1764071 03/19/2021 20210904 108.19 JOHNSON BROTHERS LIQUOR CO 140849 03/22/2021 20210904 -28.35 CHECK 458149 TOTAL: 93,472.49 458150 04/09/2021 PRTD 126304 KEARNEY NATIONAL INC IN0000076683 03/10/2021 20210904 13,715.00 CHECK 458150 TOTAL: 13,715.00 458151 04/09/2021 PRTD 113212 KENDELL DOORS & HARDWARE LLC IN030782 03/09/2021 20210904 340.00 CHECK 458151 TOTAL: 340.00 458152 04/09/2021 PRTD 138279 KFT FIRE TRAINER LLC 160.00003670 03/09/2021 20210904 3,986.00 CHECK 458152 TOTAL: 3,986.00 458153 04/09/2021 PRTD 100944 KIWI KAI IMPORTS INC 21276 03/24/2021 20210904 1,377.45 KIWI KAI IMPORTS INC 121279 03/23/2021 20210904 1,115.50 KIWI KAI IMPORTS INC 121284 03/24/2021 20210904 89.25 KIWI KAI IMPORTS INC 121272 03/23/2021 20210904 1,565.45 CHECK 458153 TOTAL: 4,147.65 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/08/2021 14:28User: LJeffersonProgram ID: apcshdsb Page 13 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET 458154 04/09/2021 PRTD 151024 LA DONA SBC 4606 03/24/2021 20210904 112.00 LA DONA SBC 4607 03/24/2021 20210904 110.00 CHECK 458154 TOTAL: 222.00 458155 04/09/2021 PRTD 100852 LAWSON PRODUCTS INC 9308283252 03/10/2021 20210904 40.08 LAWSON PRODUCTS INC 9308292732 03/14/2021 20210904 431.03 CHECK 458155 TOTAL: 471.11 458156 04/09/2021 PRTD 101552 LEAGUE OF MINNESOTA CITIES 6969 03/01/2021 20210904 3,518.07 CHECK 458156 TOTAL: 3,518.07 458157 04/09/2021 PRTD 101552 LEAGUE OF MINNESOTA CITIES 6970 03/01/2021 20210904 4,159.69 CHECK 458157 TOTAL: 4,159.69 458158 04/09/2021 PRTD 140403 LITE-ON TECHNOLOGY USA, INC 4112293783 03/12/2021 20210904 5,965.00 CHECK 458158 TOTAL: 5,965.00 458159 04/09/2021 PRTD 135867 LIBATION PROJECT 34334 03/23/2021 20210904 259.00 LIBATION PROJECT 34335 03/23/2021 20210904 129.50 CHECK 458159 TOTAL: 388.50 458160 04/09/2021 PRTD 146427 LUCID BREWING LLC 9963 03/23/2021 20210904 146.00 CHECK 458160 TOTAL: 146.00 458161 04/09/2021 PRTD 101555 DECISION INSIGHT INFORMATION GROU 5795 03/11/2021 20210904 656.20 CHECK 458161 TOTAL: 656.20 458162 04/09/2021 PRTD 141215 MAVERICK WINE LLC INV558200 03/23/2021 20210904 133.50 MAVERICK WINE LLC INV558202 03/23/2021 20210904 696.42 MAVERICK WINE LLC INV558203 03/23/2021 20210904 133.50 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/08/2021 14:28User: LJeffersonProgram ID: apcshdsb Page 14 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET CHECK 458162 TOTAL: 963.42 458163 04/09/2021 PRTD 130477 MCDONALD DISTRIBUTING COMPANY 573423 03/24/2021 20210904 94.00 MCDONALD DISTRIBUTING COMPANY 573529 03/24/2021 20210904 1,276.00 MCDONALD DISTRIBUTING COMPANY 573422 03/24/2021 20210904 178.00 MCDONALD DISTRIBUTING COMPANY 573421 03/24/2021 20210904 94.00 MCDONALD DISTRIBUTING COMPANY 573519 03/24/2021 20210904 54.00 MCDONALD DISTRIBUTING COMPANY 573525 03/24/2021 20210904 392.00 CHECK 458163 TOTAL: 2,088.00 458164 04/09/2021 PRTD 146757 MEDPRO WASTE DISPOSAL LLC 441676 01/03/2021 20210904 250.00 CHECK 458164 TOTAL: 250.00 458165 04/09/2021 PRTD 101483 MENARDS INC 35573 03/12/2021 20210904 224.60 MENARDS INC 35543 03/12/2021 20210904 199.81 MENARDS INC 35545 03/12/2021 20210904 155.13 MENARDS INC 35549 03/12/2021 20210904 163.65 MENARDS INC 35570 03/12/2021 20210904 -163.65 MENARDS INC 35430 03/10/2021 20210904 103.37 MENARDS INC 35437 03/10/2021 20210904 20.59 MENARDS INC 35374 03/09/2021 20210904 16.92 MENARDS INC 35362 03/09/2021 20210904 141.39 MENARDS INC 35432 03/10/2021 20210904 19.92 MENARDS INC 35456 03/10/2021 20210904 62.94 CHECK 458165 TOTAL: 944.67 458166 04/09/2021 PRTD 100886 METROPOLITAN COUNCIL MARCH 2021 SAC REPOR04/07/2021 20210904 7,380.45 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/08/2021 14:28User: LJeffersonProgram ID: apcshdsb Page 15 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET CHECK 458166 TOTAL: 7,380.45 458167 04/09/2021 PRTD 104650 MICRO CENTER 8595857 03/10/2021 20210904 55.96 CHECK 458167 TOTAL: 55.96 458168 04/09/2021 PRTD 144364 MINNESOTA DRIVERS & VEHICLE SERVI 7502 04/02/2021 20210904 16.00 CHECK 458168 TOTAL: 16.00 458169 04/09/2021 PRTD 136248 MINNESOTA EQUIPMENT INC P40965 03/12/2021 20210904 89.99 CHECK 458169 TOTAL: 89.99 458170 04/09/2021 PRTD 150705 MOBILE MINI INC 9009166501 09/25/2020 20210904 195.82 CHECK 458170 TOTAL: 195.82 458171 04/09/2021 PRTD 140955 MODIST BREWING LLC E-20453 03/23/2021 20210904 616.00 MODIST BREWING LLC E-20450 03/23/2021 20210904 420.50 CHECK 458171 TOTAL: 1,036.50 458172 04/09/2021 PRTD 110522 MUNICIPAL BUILDERS INC ENG 20-17 FINAL 03/10/2021 20210904 6,319.40 CHECK 458172 TOTAL: 6,319.40 458173 04/09/2021 PRTD 100920 GENUINE PARTS COMPANY 2122-691165 03/09/2021 20210904 44.90 GENUINE PARTS COMPANY 2122-692059 03/11/2021 20210904 593.98 GENUINE PARTS COMPANY 2122-692177 03/11/2021 20210904 -593.98 CHECK 458173 TOTAL: 44.90 458174 04/09/2021 PRTD 100076 NEW FRANCE WINE CO 171774 03/24/2021 20210904 862.00 NEW FRANCE WINE CO 171773 03/24/2021 20210904 672.00 NEW FRANCE WINE CO 171775 03/24/2021 20210904 634.00 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/08/2021 14:28User: LJeffersonProgram ID: apcshdsb Page 16 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET CHECK 458174 TOTAL: 2,168.00 458175 04/09/2021 PRTD 101620 NORTH SECOND STREET STEEL SUPPLY 481774 03/11/2021 20210904 324.00 CHECK 458175 TOTAL: 324.00 458176 04/09/2021 PRTD 102557 NTOA 6037 03/29/2021 20210904 294.00 CHECK 458176 TOTAL: 294.00 458177 04/09/2021 PRTD 141965 OMNI BREWING COMPANY LLC E-9330 03/23/2021 20210904 84.00 CHECK 458177 TOTAL: 84.00 458178 04/09/2021 PRTD 999998 ALICE REDDER TRUST 7729 04/06/2021 20210904 100.00 CHECK 458178 TOTAL: 100.00 458179 04/09/2021 PRTD 999998 LANDA RADEMACHER 7725 04/06/2021 20210904 234.77 CHECK 458179 TOTAL: 234.77 458180 04/09/2021 PRTD 999998 SUSAN WINDHAM 7728 04/06/2021 20210904 265.00 CHECK 458180 TOTAL: 265.00 458181 04/09/2021 PRTD 999998 VINU ELANJICKAL 7724 04/06/2021 20210904 51.48 CHECK 458181 TOTAL: 51.48 458182 04/09/2021 PRTD 999994 BRETT JONES 7434 04/01/2021 20210904 300.00 CHECK 458182 TOTAL: 300.00 458183 04/09/2021 PRTD 999994 GEETHA MANDAYAM 7214 03/30/2021 20210904 180.00 CHECK 458183 TOTAL: 180.00 458184 04/09/2021 PRTD 999996 AZTECA SPORTS MN BRAEMAR MAIN 03/23/2020 20210904 2,032.23 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/08/2021 14:28User: LJeffersonProgram ID: apcshdsb Page 17 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET CHECK 458184 TOTAL: 2,032.23 458185 04/09/2021 PRTD 102722 PEAVEY CORPORATION 377828 03/08/2021 20210904 272.00 CHECK 458185 TOTAL: 272.00 458186 04/09/2021 PRTD 138081 PETERSON SALT & WATER TREATMENT 185956 03/10/2021 20210904 29.40 CHECK 458186 TOTAL: 29.40 458187 04/09/2021 PRTD 135849 PETSMART #2412 5781 01/19/2021 20210904 184.46 CHECK 458187 TOTAL: 184.46 458188 04/09/2021 PRTD 146765 PILLSBURY UNITED COMMUNITIES 091014 03/12/2021 20210904 1,517.14 CHECK 458188 TOTAL: 1,517.14 458189 04/09/2021 PRTD 100119 PING INC 15586357 03/11/2021 20210904 136.53 CHECK 458189 TOTAL: 136.53 458190 04/09/2021 PRTD 100958 PLUNKETT'S PEST CONTROL 6984710 03/11/2021 20210904 48.55 CHECK 458190 TOTAL: 48.55 458191 04/09/2021 PRTD 105690 PRO-TEC DESIGN INC 100158 02/28/2021 20210904 1,000.00 PRO-TEC DESIGN INC 100246 03/12/2021 20210904 12,863.50 CHECK 458191 TOTAL: 13,863.50 458192 04/09/2021 PRTD 143618 PRYES BREWING COMPANY LLC W-19861 03/23/2021 20210904 220.00 PRYES BREWING COMPANY LLC W-19860 03/23/2021 20210904 220.00 CHECK 458192 TOTAL: 440.00 458193 04/09/2021 PRTD 135833 QUALITY FORKLIFT SALES AND SERVIC 156813 03/09/2021 20210904 178.83 CHECK 458193 TOTAL: 178.83 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/08/2021 14:28User: LJeffersonProgram ID: apcshdsb Page 18 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET 458194 04/09/2021 PRTD 142588 QUALITY RESOURCE GROUP INC 2016852 03/10/2021 20210904 173.42 CHECK 458194 TOTAL: 173.42 458195 04/09/2021 PRTD 100972 R & R SPECIALTIES INC 0072428-IN 03/09/2021 20210904 380.00 CHECK 458195 TOTAL: 380.00 458196 04/09/2021 PRTD 100975 MULTI SERVICE TECHNOLOGY SOLUTION 268-1-93998 03/10/2021 20210904 165.74 MULTI SERVICE TECHNOLOGY SOLUTION 268-1-94547 03/10/2021 20210904 195.49 CHECK 458196 TOTAL: 361.23 458197 04/09/2021 PRTD 100977 RICHFIELD PLUMBING COMPANY 81744 03/09/2021 20210904 3,213.00 CHECK 458197 TOTAL: 3,213.00 458198 04/09/2021 PRTD 101902 RINK SYSTEMS INC FC 246 03/11/2021 20210904 1.47 CHECK 458198 TOTAL: 1.47 458199 04/09/2021 PRTD 101659 ORKIN 208314806 03/09/2021 20210904 63.00 CHECK 458199 TOTAL: 63.00 458200 04/09/2021 PRTD 160058 ROOM & BOARD, INC. 20493806 03/23/2021 20210904 19,581.37 CHECK 458200 TOTAL: 19,581.37 458201 04/09/2021 PRTD 100998 SHERWIN WILLIAMS CO 0982-2 03/11/2021 20210904 191.06 CHECK 458201 TOTAL: 191.06 458202 04/09/2021 PRTD 100995 SHORT-ELLIOT-HENDRICKSON INCORPOR 402283 03/11/2021 20210904 994.69 CHECK 458202 TOTAL: 994.69 458203 04/09/2021 PRTD 100430 SNAP-ON INDUSTRIAL ARV/47265563 03/10/2021 20210904 213.07 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/08/2021 14:28User: LJeffersonProgram ID: apcshdsb Page 19 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET CHECK 458203 TOTAL: 213.07 458204 04/09/2021 PRTD 101004 SPS COMPANIES INC S4100394.001 01/21/2021 20210904 1,088.51 CHECK 458204 TOTAL: 1,088.51 458205 04/09/2021 PRTD 139006 BCA TRAINING AND DEVELOPMENT SECT 17474 03/25/2021 20210904 75.00 CHECK 458205 TOTAL: 75.00 458206 04/09/2021 PRTD 133068 STEEL TOE BREWING LLC 39096 03/24/2021 20210904 225.00 STEEL TOE BREWING LLC 39097 03/24/2021 20210904 174.00 STEEL TOE BREWING LLC 39095 03/24/2021 20210904 207.00 CHECK 458206 TOTAL: 606.00 458207 04/09/2021 PRTD 146040 STRAYER, JUSTIN 6767 03/24/2021 20210904 302.00 CHECK 458207 TOTAL: 302.00 458208 04/09/2021 PRTD 101015 STREICHERS INC I1474652 01/04/2021 20210904 3,990.00 STREICHERS INC I1489670 03/10/2021 20210904 35.98 STREICHERS INC I1492938 03/26/2021 20210904 2,477.70 CHECK 458208 TOTAL: 6,503.68 458209 04/09/2021 PRTD 101017 SUBURBAN CHEVROLET 127738 03/11/2021 20210904 74.67 CHECK 458209 TOTAL: 74.67 458210 04/09/2021 PRTD 105874 SUBURBAN TIRE WHOLESALE INC 10177268 03/11/2021 20210904 613.60 CHECK 458210 TOTAL: 613.60 458211 04/09/2021 PRTD 151143 TALKING WATERS BREWING CO LLC 2053 03/23/2021 20210904 295.00 CHECK 458211 TOTAL: 295.00 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/08/2021 14:28User: LJeffersonProgram ID: apcshdsb Page 20 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET 458212 04/09/2021 PRTD 123129 TIMESAVER OFF SITE SECRETARIAL IN #M26291 03/12/2021 20210904 590.00 CHECK 458212 TOTAL: 590.00 458213 04/09/2021 PRTD 101046 TWIN CITY FILTER SERVICE INC 0697373-IN 03/12/2021 20210904 293.46 CHECK 458213 TOTAL: 293.46 458214 04/09/2021 PRTD 146436 TYLER TECHNOLOGIES INC 045-333047 03/11/2021 20210904 700.00 CHECK 458214 TOTAL: 700.00 458215 04/09/2021 PRTD 103973 ULINE INC 131096795 03/09/2021 20210904 294.41 CHECK 458215 TOTAL: 294.41 458216 04/09/2021 PRTD 130874 UNITED RENTALS (NORTH AMERICA) IN 191155428-001 03/12/2021 20210904 310.00 CHECK 458216 TOTAL: 310.00 458217 04/09/2021 PRTD 140009 US KIDS GOLF LLC IN2004032 03/09/2021 20210904 121.53 US KIDS GOLF LLC IN2004229 03/11/2021 20210904 262.50 CHECK 458217 TOTAL: 384.03 458218 04/09/2021 PRTD 100050 USPS 7375 03/31/2021 20210904 500.00 CHECK 458218 TOTAL: 500.00 458219 04/09/2021 PRTD 100050 USPS 7576 04/06/2021 20210904 245.00 USPS 7653 04/06/2021 20210904 500.00 CHECK 458219 TOTAL: 745.00 458220 04/09/2021 PRTD 143763 VALLEY APPLE FORD INC A1CB574900 03/12/2021 20210904 750.00 CHECK 458220 TOTAL: 750.00 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/08/2021 14:28User: LJeffersonProgram ID: apcshdsb Page 21 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET 458221 04/09/2021 PRTD 144209 VENN BREWING COMPANY LLC 2411 03/24/2021 20210904 171.00 CHECK 458221 TOTAL: 171.00 458222 04/09/2021 PRTD 143468 VONDENKAMP, MARK 000560 03/24/2021 20210904 156.00 CHECK 458222 TOTAL: 156.00 458223 04/09/2021 PRTD 120784 WALSH GRAPHICS INC 15877 01/28/2021 20210904 25.00 WALSH GRAPHICS INC 15876 02/12/2021 20210904 266.12 CHECK 458223 TOTAL: 291.12 458224 04/09/2021 PRTD 101033 WINE COMPANY 167293 03/24/2021 20210904 1,118.15 WINE COMPANY 167294 03/24/2021 20210904 155.00 WINE COMPANY 167289 03/24/2021 20210904 1,419.45 CHECK 458224 TOTAL: 2,692.60 458225 04/09/2021 PRTD 124503 WINSUPPLY EDEN PRAIRIE MN CO 207439 01 03/10/2021 20210904 4.40 CHECK 458225 TOTAL: 4.40 458226 04/09/2021 PRTD 142162 WOODEN HILL BREWING COMPANY LLC 2631 03/11/2021 20210904 597.60 WOODEN HILL BREWING COMPANY LLC 2638 03/11/2021 20210904 334.80 CHECK 458226 TOTAL: 932.40 458227 04/09/2021 PRTD 127774 WORLDWIDE CELLARS INC R21-50917 03/23/2021 20210904 72.04 WORLDWIDE CELLARS INC R21-50915 03/23/2021 20210904 72.04 WORLDWIDE CELLARS INC R21-50916 03/23/2021 20210904 383.08 CHECK 458227 TOTAL: 527.16 458228 04/09/2021 PRTD 101103 WW GRAINGER 9830481025 03/09/2021 20210904 379.29 WW GRAINGER 9831383451 03/10/2021 20210904 82.50 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/08/2021 14:28User: LJeffersonProgram ID: apcshdsb Page 22 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET WW GRAINGER 9833748677 03/11/2021 20210904 13.97 WW GRAINGER 9833684104 03/11/2021 20210904 276.21 WW GRAINGER 9832598479 03/11/2021 20210904 -276.21 CHECK 458228 TOTAL: 475.76 458229 04/09/2021 PRTD 101572 ZARNOTH BRUSH WORKS INC 0183758-IN 03/11/2021 20210904 578.00 CHECK 458229 TOTAL: 578.00 NUMBER OF CHECKS 148 *** CASH ACCOUNT TOTAL *** 855,103.62 COUNT AMOUNT TOTAL PRINTED CHECKS 148 855,103.62 *** GRAND TOTAL *** 855,103.62 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 41 JOURNAL ENTRIES TO BE CREATED FUND SUB FUND DUE TO DUE FR 1000 General 57,650.702100 Police Special Revenue 4,173.632100 Police Special Revenue 124.202300 Pedestrian and Cyclist Safety 1,245.002600 Housing & Redvlpmt Authority 31,250.002600 Housing & Redvlpmt Authority 100,000.002600 Housing & Redvlpmt Authority 17,433.004000 Capital Projects 26,642.475100 Art Center 57.485200 Braemar Golf Course 16,584.905200 Braemar Golf Course 9,029.535300 Aquatic Center 850.005400 Edinborough Park 3,290.975500 Braemar Arena 43,451.715600 Braemar Field 1,607.155700 Centennial Lakes 1,370.025800 Liquor 231,496.175900 Utility Fund 14,509.015900 Utility Fund 471.455900 Utility Fund 33,750.505900 Utility Fund 1,674.006000 Risk Management 17,624.496100 Equipment Operations 29,525.376200 Information Technology 5,344.416300 Facilities Management 3,949.717100 PS Training Facility 12,228.197200 MN Task Force 1 9,490.509000 Payroll 18,570.679999 Pooled Cash Fund 693,395.23 TOTAL 693,395.23 693,395.23 ** END OF REPORT - Generated by Lonnia Jefferson ** City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 1 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET 458230 04/16/2021 PRTD 151171 7TH STREET BEER COMPANY 1609 03/25/2021 20210416 648.00 CHECK 458230 TOTAL: 648.00 458231 04/16/2021 PRTD 143143 ACT CLEANING SERVICE 1617 03/18/2021 20210416 4,406.00 CHECK 458231 TOTAL: 4,406.00 458232 04/16/2021 PRTD 135922 ACUSHNET COMPANY 910495326 03/16/2021 20210416 50.26 ACUSHNET COMPANY 910506212 03/17/2021 20210416 100.53 ACUSHNET COMPANY 910573114 03/24/2021 20210416 602.92 ACUSHNET COMPANY 910585923 03/25/2021 20210416 122.66 ACUSHNET COMPANY 910585314 03/25/2021 20210416 1,071.81 ACUSHNET COMPANY 910607244 03/28/2021 20210416 186.05 CHECK 458232 TOTAL: 2,134.23 458233 04/16/2021 PRTD 144986 ADSPEC MARKETING INC 40295 03/17/2021 20210416 1,024.68 CHECK 458233 TOTAL: 1,024.68 458234 04/16/2021 PRTD 122055 ADVANCED GRAPHIX INC 206311 03/15/2021 20210416 1,512.00 CHECK 458234 TOTAL: 1,512.00 458235 04/16/2021 PRTD 100620 AIM ELECTRONICS INC 42799 03/17/2021 20210416 556.36 CHECK 458235 TOTAL: 556.36 458236 04/16/2021 PRTD 141768 ALTEC INDUSTRIES INC 11605568 03/19/2021 20210416 448.80 CHECK 458236 TOTAL: 448.80 458237 04/16/2021 PRTD 141960 AMAZON CAPITAL SERVICES 1FMG-G7CY-JTTG 03/15/2021 20210416 16.66 AMAZON CAPITAL SERVICES 11HH-M79P-M3LX 03/16/2021 20210416 20.92 AMAZON CAPITAL SERVICES 1FRD-CXX9-M7X4 03/16/2021 20210416 15.62 AMAZON CAPITAL SERVICES 1N7F-4DV3-6FDF 03/16/2021 20210416 239.98 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 2 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET AMAZON CAPITAL SERVICES 1CWP-WN6C-KLMM 03/17/2021 20210416 35.88 AMAZON CAPITAL SERVICES 1F94-JQTR-PMK7 03/17/2021 20210416 12.97 AMAZON CAPITAL SERVICES 1CWP-WN6C-W3LH 03/17/2021 20210416 37.98 AMAZON CAPITAL SERVICES 1N7F-4DV3-TLDR 03/17/2021 20210416 30.54 AMAZON CAPITAL SERVICES 16VM-R491-6YVN 03/18/2021 20210416 599.30 AMAZON CAPITAL SERVICES 117G-KLYQ-14QK 03/18/2021 20210416 55.20 AMAZON CAPITAL SERVICES 16VM-R491-91DL 03/18/2021 20210416 361.99 AMAZON CAPITAL SERVICES 1LC9-VDHT-MYNP 03/17/2021 20210416 61.80 AMAZON CAPITAL SERVICES 1QJN-DLFF-3XGW 03/19/2021 20210416 98.62 AMAZON CAPITAL SERVICES 19JN-CXFL-9GJX 03/19/2021 20210416 142.30 AMAZON CAPITAL SERVICES 1CVT-G7LT-MNHR 03/20/2021 20210416 -387.48 AMAZON CAPITAL SERVICES 1VXC-3GYX-RNHQ 03/20/2021 20210416 329.99 AMAZON CAPITAL SERVICES 1TVQ-JLGD-7G6F 03/20/2021 20210416 210.69 AMAZON CAPITAL SERVICES 1QN1-VMPM-71CX 03/21/2021 20210416 139.99 AMAZON CAPITAL SERVICES 1D3V-TDQT-9DH4 03/21/2021 20210416 58.00 AMAZON CAPITAL SERVICES 1D3V-TDQT-DVWH 03/21/2021 20210416 74.98 AMAZON CAPITAL SERVICES 1TFF-6DVM-DXTC 03/21/2021 20210416 9.99 AMAZON CAPITAL SERVICES 1KWH-4K4D-HYM7 03/21/2021 20210416 19.99 AMAZON CAPITAL SERVICES 1KWH-4K4D-LTQT 03/21/2021 20210416 19.68 AMAZON CAPITAL SERVICES 1QN1-VMPM-L1FY 03/21/2021 20210416 105.75 AMAZON CAPITAL SERVICES 1KWH-4K4D-N9GX 03/21/2021 20210416 99.61 AMAZON CAPITAL SERVICES 1TFF-6DVM-MTYH 03/21/2021 20210416 357.97 AMAZON CAPITAL SERVICES 1KWH-4K4D-P3V3 03/21/2021 20210416 58.97 AMAZON CAPITAL SERVICES 1FVP-4CNH-R4XP 03/21/2021 20210416 63.69 AMAZON CAPITAL SERVICES 1KWH-4K4D-XC13 03/22/2021 20210416 78.88 AMAZON CAPITAL SERVICES 1MFL-QYW6-3HM7 04/03/2021 20210416 -360.99 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 3 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET AMAZON CAPITAL SERVICES 1RQV-RRKF-M39N 04/03/2021 20210416 -277.84 CHECK 458237 TOTAL: 2,331.63 458238 04/16/2021 PRTD 151441 ARAMARK UNIFORM AND CAREER APPEAL 1005007737 03/17/2021 20210416 505.80 ARAMARK UNIFORM AND CAREER APPEAL 1005010653 03/22/2021 20210416 204.18 CHECK 458238 TOTAL: 709.98 458239 04/16/2021 PRTD 151756 ARBEITER BREWING COMPANY LLC 198 03/25/2021 20210416 141.00 ARBEITER BREWING COMPANY LLC 197 03/25/2021 20210416 141.00 ARBEITER BREWING COMPANY LLC 199 03/25/2021 20210416 141.00 ARBEITER BREWING COMPANY LLC 218 04/01/2021 20210416 144.00 CHECK 458239 TOTAL: 567.00 458240 04/16/2021 PRTD 106304 ASPEN MILLS INC 271152 03/19/2021 20210416 491.35 CHECK 458240 TOTAL: 491.35 458241 04/16/2021 PRTD 100636 ASTLEFORD EQUIPMENT COMPANY INC 01P27364 02/08/2021 20210416 113.52 CHECK 458241 TOTAL: 113.52 458242 04/16/2021 PRTD 101718 AUTO PLUS - FORMERLY PARTS PLUS 380044832 03/15/2021 20210416 73.72 AUTO PLUS - FORMERLY PARTS PLUS 380045788 03/22/2021 20210416 5.55 CHECK 458242 TOTAL: 79.27 458243 04/16/2021 PRTD 100643 BARR ENGINEERING CO 23271728.00-17 03/18/2021 20210416 945.00 BARR ENGINEERING CO 23270354.00-268 03/19/2021 20210416 12,027.50 BARR ENGINEERING CO 23271799.00-7 03/21/2021 20210416 16,240.00 BARR ENGINEERING CO 23271827.01-2 03/21/2021 20210416 17,433.00 CHECK 458243 TOTAL: 46,645.50 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 4 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET 458244 04/16/2021 PRTD 100646 BECKER ARENA PRODUCTS INC 600658 03/22/2021 20210416 11.40 CHECK 458244 TOTAL: 11.40 458245 04/16/2021 PRTD 101355 BELLBOY CORPORATION 0088553200 03/25/2021 20210416 3,273.90 BELLBOY CORPORATION 0088568400 03/25/2021 20210416 661.55 BELLBOY CORPORATION 0088537800 03/25/2021 20210416 209.10 BELLBOY CORPORATION 0102936000 03/25/2021 20210416 187.50 BELLBOY CORPORATION 0102935900 03/25/2021 20210416 55.75 BELLBOY CORPORATION 0088552600 03/25/2021 20210416 3,070.00 BELLBOY CORPORATION 0088568300 03/25/2021 20210416 661.55 BELLBOY CORPORATION 0102959300 03/25/2021 20210416 191.82 BELLBOY CORPORATION 0088553600 03/25/2021 20210416 2,619.10 BELLBOY CORPORATION 0088568200 03/25/2021 20210416 661.55 BELLBOY CORPORATION 0088636200 04/01/2021 20210416 89.55 BELLBOY CORPORATION 0088636300 04/01/2021 20210416 171.10 BELLBOY CORPORATION 0088658200 04/01/2021 20210416 4,909.39 BELLBOY CORPORATION 0088658300 04/01/2021 20210416 4,038.75 BELLBOY CORPORATION 0088636100 04/01/2021 20210416 123.55 CHECK 458245 TOTAL: 20,924.16 458246 04/16/2021 PRTD 100648 BERTELSON BROTHERS INC WO-1118299-1 03/18/2021 20210416 114.01 BERTELSON BROTHERS INC IN-46784 03/19/2021 20210416 29.00 CHECK 458246 TOTAL: 143.01 458247 04/16/2021 PRTD 128914 BJKK DEVELOPMENT 30953 03/19/2021 20210416 50.25 BJKK DEVELOPMENT 30952 03/19/2021 20210416 47.24 BJKK DEVELOPMENT 30954 03/19/2021 20210416 48.59 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 5 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET BJKK DEVELOPMENT 30939 03/16/2021 20210416 23.00 BJKK DEVELOPMENT 30969 03/22/2021 20210416 29.00 CHECK 458247 TOTAL: 198.08 458248 04/16/2021 PRTD 142153 BLACK STACK BREWING INC 12008 03/25/2021 20210416 198.00 CHECK 458248 TOTAL: 198.00 458249 04/16/2021 PRTD 142153 BLACK STACK BREWING INC 12006 03/25/2021 20210416 198.00 BLACK STACK BREWING INC 12007 03/25/2021 20210416 198.00 CHECK 458249 TOTAL: 396.00 458250 04/16/2021 PRTD 160051 BLUE TEES ENTERPRISES, LLC INV-0539 03/15/2021 20210416 1,146.50 CHECK 458250 TOTAL: 1,146.50 458251 04/16/2021 PRTD 132444 BOLTON & MENK INC 0265911 03/15/2021 20210416 730.00 CHECK 458251 TOTAL: 730.00 458252 04/16/2021 PRTD 105367 BOUND TREE MEDICAL LLC 83987818 03/15/2021 20210416 2,210.47 BOUND TREE MEDICAL LLC 83989582 03/16/2021 20210416 355.77 CHECK 458252 TOTAL: 2,566.24 458253 04/16/2021 PRTD 119351 BOURGET IMPORTS 176521 03/30/2021 20210416 688.75 BOURGET IMPORTS 176519 03/30/2021 20210416 410.40 BOURGET IMPORTS 176520 03/30/2021 20210416 840.25 CHECK 458253 TOTAL: 1,939.40 458254 04/16/2021 PRTD 117040 BOYER FORD TRUCKS INC 944449 03/15/2021 20210416 773.73 BOYER FORD TRUCKS INC 944597X1 03/15/2021 20210416 33.01 CHECK 458254 TOTAL: 806.74 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 6 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET 458255 04/16/2021 PRTD 100664 BRAUN INTERTEC CORPORATION B245546 03/15/2021 20210416 9,975.00 CHECK 458255 TOTAL: 9,975.00 458256 04/16/2021 PRTD 124291 BREAKTHRU BEVERAGE MINNESOTA WINE 338960096 04/01/2021 20210416 1,164.09 BREAKTHRU BEVERAGE MINNESOTA WINE 338960095 04/01/2021 20210416 334.62 BREAKTHRU BEVERAGE MINNESOTA WINE 338960082 04/01/2021 20210416 3,375.94 BREAKTHRU BEVERAGE MINNESOTA WINE 338960097 04/01/2021 20210416 1,587.66 CHECK 458256 TOTAL: 6,462.31 458257 04/16/2021 PRTD 124529 BREAKTHRU BEVERAGE MINNESOTA BEER 338905060 03/30/2021 20210416 2,221.50 CHECK 458257 TOTAL: 2,221.50 458258 04/16/2021 PRTD 124529 BREAKTHRU BEVERAGE MINNESOTA BEER 338905058 04/01/2021 20210416 83.10 BREAKTHRU BEVERAGE MINNESOTA BEER 338905059 04/01/2021 20210416 3,358.80 CHECK 458258 TOTAL: 3,441.90 458259 04/16/2021 PRTD 145809 BRIAN LIEB COMMUNICATIONS 127 03/15/2021 20210416 600.00 CHECK 458259 TOTAL: 600.00 458260 04/16/2021 PRTD 102149 CALLAWAY GOLF 932762622 03/15/2021 20210416 882.96 CALLAWAY GOLF 932776985 03/17/2021 20210416 450.96 CALLAWAY GOLF 932765527 03/16/2021 20210416 509.40 CALLAWAY GOLF 932765528 03/16/2021 20210416 318.18 CALLAWAY GOLF 932795535 03/19/2021 20210416 269.73 CALLAWAY GOLF 932799235 03/20/2021 20210416 838.36 CALLAWAY GOLF 932806184 03/22/2021 20210416 165.62 CHECK 458260 TOTAL: 3,435.21 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 7 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET 458261 04/16/2021 PRTD 119455 CAPITOL BEVERAGE SALES LP 2529858 03/30/2021 20210416 93.97 CAPITOL BEVERAGE SALES LP 2529857 03/30/2021 20210416 234.00 CAPITOL BEVERAGE SALES LP 2529497 03/30/2021 20210416 4,553.20 CAPITOL BEVERAGE SALES LP 2529498 03/30/2021 20210416 2,652.50 CAPITOL BEVERAGE SALES LP 2529862 03/30/2021 20210416 117.00 CAPITOL BEVERAGE SALES LP 2529863 03/30/2021 20210416 24.25 CAPITOL BEVERAGE SALES LP 2529854 03/30/2021 20210416 21.99 CAPITOL BEVERAGE SALES LP 2529852 03/30/2021 20210416 58.50 CAPITOL BEVERAGE SALES LP 2529856 03/30/2021 20210416 1,215.50 CHECK 458261 TOTAL: 8,970.91 458262 04/16/2021 PRTD 130618 CHANHASSEN AUTO CENTERS LLC 21584 03/16/2021 20210416 3,516.50 CHECK 458262 TOTAL: 3,516.50 458263 04/16/2021 PRTD 117187 CHEM SYSTEMS LTD 519692 03/15/2021 20210416 422.00 CHECK 458263 TOTAL: 422.00 458264 04/16/2021 PRTD 142028 CINTAS CORPORATION 4078521614 03/15/2021 20210416 9.86 CINTAS CORPORATION 4078521595 03/15/2021 20210416 28.62 CINTAS CORPORATION 4078521674 03/15/2021 20210416 39.62 CINTAS CORPORATION 4078521634 03/15/2021 20210416 36.88 CINTAS CORPORATION 4078521139 03/15/2021 20210416 3.69 CINTAS CORPORATION 4078521668 03/15/2021 20210416 30.25 CINTAS CORPORATION 4079198102 03/22/2021 20210416 25.20 CINTAS CORPORATION 4079198516 03/22/2021 20210416 39.01 CINTAS CORPORATION 4079198401 03/22/2021 20210416 28.62 CINTAS CORPORATION 4079198380 03/22/2021 20210416 36.88 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 8 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET CINTAS CORPORATION 4079198539 03/22/2021 20210416 30.25 CINTAS CORPORATION 4079197939 03/22/2021 20210416 37.20 CINTAS CORPORATION 4079198400 03/22/2021 20210416 9.86 CHECK 458264 TOTAL: 355.94 458265 04/16/2021 PRTD 122317 CITY OF EDINA - COMMUNICATIONS COM-2410 03/17/2021 20210416 111.52 CHECK 458265 TOTAL: 111.52 458266 04/16/2021 PRTD 139927 CITY OF ROCHESTER MN 5906 03/15/2021 20210416 3,635.02 CHECK 458266 TOTAL: 3,635.02 458267 04/16/2021 PRTD 120433 COMCAST HOLDINGS CORPORATION 5212 02/26/2021 20210416 216.82 CHECK 458267 TOTAL: 216.82 458268 04/16/2021 PRTD 120433 COMCAST HOLDINGS CORPORATION 0740105 3/21 03/18/2021 20210416 98.02 CHECK 458268 TOTAL: 98.02 458269 04/16/2021 PRTD 120433 COMCAST HOLDINGS CORPORATION 0373022-3/21 03/17/2021 20210416 33.79 CHECK 458269 TOTAL: 33.79 458270 04/16/2021 PRTD 160002 COMMERCIAL INFRASTRUCTURE CABLING I10069 03/19/2021 20210416 2,490.53 CHECK 458270 TOTAL: 2,490.53 458271 04/16/2021 PRTD 101403 CRYSTEEL MANUFACTURING INC LC00070118 03/22/2021 20210416 876.85 CRYSTEEL MANUFACTURING INC LC00070124 03/22/2021 20210416 36.70 CHECK 458271 TOTAL: 913.55 458272 04/16/2021 PRTD 103799 CURBSIDE LANDSCAPE & IRRIGATION 226646 03/16/2021 20210416 460.00 CHECK 458272 TOTAL: 460.00 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 9 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET 458273 04/16/2021 PRTD 141837 DAIOHS USA INC INV541485 03/17/2021 20210416 295.95 DAIOHS USA INC 541492 03/17/2021 20210416 619.95 CHECK 458273 TOTAL: 915.90 458274 04/16/2021 PRTD 104020 DALCO ENTERPRISES INC 3757269 03/22/2021 20210416 911.88 CHECK 458274 TOTAL: 911.88 458275 04/16/2021 PRTD 146781 DEED 00000645720 02/22/2021 20210416 31,250.00 CHECK 458275 TOTAL: 31,250.00 458276 04/16/2021 PRTD 100718 DELEGARD TOOL COMPANY 52675 03/16/2021 20210416 20.82 DELEGARD TOOL COMPANY 53106 03/18/2021 20210416 328.01 CHECK 458276 TOTAL: 348.83 458277 04/16/2021 PRTD 160059 DOALL COMPANY 59161679 03/15/2021 20210416 154.24 CHECK 458277 TOTAL: 154.24 458278 04/16/2021 PRTD 144440 DOCUSIGN INC INV24419189 03/19/2021 20210416 4,270.00 CHECK 458278 TOTAL: 4,270.00 458279 04/16/2021 PRTD 132810 ECM PUBLISHERS INC 825345 03/18/2021 20210416 53.55 ECM PUBLISHERS INC 825346 03/18/2021 20210416 172.55 CHECK 458279 TOTAL: 226.10 458280 04/16/2021 PRTD 144410 ECSI 312233 01/31/2021 20210416 390.00 ECSI 312234 01/31/2021 20210416 390.00 ECSI 312235 01/31/2021 20210416 390.00 CHECK 458280 TOTAL: 1,170.00 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 10 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET 458281 04/16/2021 PRTD 103594 EDINALARM INC 62683 04/01/2021 20210416 216.13 CHECK 458281 TOTAL: 216.13 458282 04/16/2021 PRTD 104733 EMERGENCY MEDICAL PRODUCTS INC 2240090 03/09/2021 20210416 113.70 CHECK 458282 TOTAL: 113.70 458283 04/16/2021 PRTD 100146 ELLIOTT AUTO SUPPLY CO, INC 1-6803002 03/15/2021 20210416 9.22 ELLIOTT AUTO SUPPLY CO, INC 69-410689 03/15/2021 20210416 204.24 ELLIOTT AUTO SUPPLY CO, INC 69-410761 03/16/2021 20210416 97.48 ELLIOTT AUTO SUPPLY CO, INC 1-6809658 03/17/2021 20210416 9.10 ELLIOTT AUTO SUPPLY CO, INC 69-410952 03/18/2021 20210416 272.44 ELLIOTT AUTO SUPPLY CO, INC 69-410838 03/17/2021 20210416 20.21 ELLIOTT AUTO SUPPLY CO, INC 69-412447 04/01/2021 20210416 -15.24 ELLIOTT AUTO SUPPLY CO, INC 69-412676 04/05/2021 20210416 -49.22 CHECK 458283 TOTAL: 548.23 458284 04/16/2021 PRTD 106035 FASTENAL COMPANY MNTC2164889 03/18/2021 20210416 61.21 CHECK 458284 TOTAL: 61.21 458285 04/16/2021 PRTD 103600 FERGUSON US HOLDINGS INC 0470275 03/22/2021 20210416 421.76 FERGUSON US HOLDINGS INC 0469581-1 03/22/2021 20210416 818.25 CHECK 458285 TOTAL: 1,240.01 458286 04/16/2021 PRTD 104716 GALE-TEC ENGINEERING INC 3056 04/06/2021 20210416 1,245.00 CHECK 458286 TOTAL: 1,245.00 458287 04/16/2021 PRTD 102456 GALLS PARENT HOLDINGS LLC BC1316128 03/18/2021 20210416 164.50 GALLS PARENT HOLDINGS LLC BC1319896 03/22/2021 20210416 33.60 GALLS PARENT HOLDINGS LLC 018087388 04/07/2021 20210416 -21.00 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 11 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET CHECK 458287 TOTAL: 177.10 458288 04/16/2021 PRTD 100768 GARTNER REFRIGERATION INC W12596 03/16/2021 20210416 496.00 CHECK 458288 TOTAL: 496.00 458289 04/16/2021 PRTD 105508 GEMPLER'S INC INV0004464033 03/18/2021 20210416 240.08 CHECK 458289 TOTAL: 240.08 458290 04/16/2021 PRTD 144412 WINEBOW MN00092130 03/30/2021 20210416 264.50 WINEBOW MN00092129 03/30/2021 20210416 163.75 WINEBOW MN00092111 03/30/2021 20210416 449.25 WINEBOW MN00092211 04/01/2021 20210416 774.25 WINEBOW MN00092112 04/01/2021 20210416 330.50 CHECK 458290 TOTAL: 1,982.25 458291 04/16/2021 PRTD 100790 HACH COMPANY 12368845 03/16/2021 20210416 550.93 CHECK 458291 TOTAL: 550.93 458292 04/16/2021 PRTD 102426 HALE, WILLIAM EP Performance 4821 02/03/2021 20210416 250.00 CHECK 458292 TOTAL: 250.00 458293 04/16/2021 PRTD 103085 HENNEPIN COUNTY ACCOUNTING SERVIC 1000163335 03/15/2021 20210416 522.00 CHECK 458293 TOTAL: 522.00 458294 04/16/2021 PRTD 104375 HOHENSTEINS INC 398480 03/30/2021 20210416 1,095.00 HOHENSTEINS INC 398481 03/30/2021 20210416 75.60 HOHENSTEINS INC 398485 03/30/2021 20210416 849.00 HOHENSTEINS INC 398486 03/30/2021 20210416 50.40 HOHENSTEINS INC 398472 03/30/2021 20210416 435.00 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 12 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET HOHENSTEINS INC 398487 03/30/2021 20210416 -7.88 HOHENSTEINS INC 398534 03/31/2021 20210416 171.00 CHECK 458294 TOTAL: 2,668.12 458295 04/16/2021 PRTD 120085 IDEAL SERVICE 11019 03/19/2021 20210416 525.00 CHECK 458295 TOTAL: 525.00 458296 04/16/2021 PRTD 131544 INDEED BREWING COMPANY MN LLC 99077 03/31/2021 20210416 307.20 INDEED BREWING COMPANY MN LLC 99078 04/01/2021 20210416 656.10 INDEED BREWING COMPANY MN LLC 98978 03/29/2021 20210416 210.00 CHECK 458296 TOTAL: 1,173.30 458297 04/16/2021 PRTD 100814 INDELCO PLASTICS CORPORATION INV244427 03/15/2021 20210416 375.81 CHECK 458297 TOTAL: 375.81 458298 04/16/2021 PRTD 146407 INGCO INTERNATIONAL 600091-EDINA 02/12/2021 20210416 70.00 CHECK 458298 TOTAL: 70.00 458299 04/16/2021 PRTD 103193 INTOXIMETERS INC 676604 03/17/2021 20210416 124.20 CHECK 458299 TOTAL: 124.20 458300 04/16/2021 PRTD 150898 INVICTUS BREWING INC 2711 04/01/2021 20210416 124.00 CHECK 458300 TOTAL: 124.00 458301 04/16/2021 PRTD 102157 JEFF ELLIS AND ASSOCIATES INC 20101035 03/19/2021 20210416 850.00 CHECK 458301 TOTAL: 850.00 458302 04/16/2021 PRTD 100828 JERRY'S ENTERPRISES INC 87098 03/12/2021 20210416 205.00 CHECK 458302 TOTAL: 205.00 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 13 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET 458303 04/16/2021 PRTD 160041 JINX TEA, LLC 551214 03/31/2021 20210416 94.10 CHECK 458303 TOTAL: 94.10 458304 04/16/2021 PRTD 100741 JJ TAYLOR DISTRIBUTING CO OF MINN 3168926 03/31/2021 20210416 2,531.00 JJ TAYLOR DISTRIBUTING CO OF MINN 3168927 03/31/2021 20210416 83.10 JJ TAYLOR DISTRIBUTING CO OF MINN 3168929 04/01/2021 20210416 3,490.30 CHECK 458304 TOTAL: 6,104.40 458305 04/16/2021 PRTD 100835 ARTISAN BEER COMPANY 3465257 03/25/2021 20210416 1,164.00 ARTISAN BEER COMPANY 3465258 03/25/2021 20210416 2,168.75 ARTISAN BEER COMPANY 3465259 03/25/2021 20210416 120.00 ARTISAN BEER COMPANY 304183 03/30/2021 20210416 -297.60 ARTISAN BEER COMPANY 3466411 04/01/2021 20210416 2,796.85 ARTISAN BEER COMPANY 3466409 04/01/2021 20210416 2,332.35 ARTISAN BEER COMPANY 3465260 03/25/2021 20210416 1,110.70 ARTISAN BEER COMPANY 301199 01/22/2021 20210416 -160.48 CHECK 458305 TOTAL: 9,234.57 458306 04/16/2021 PRTD 100835 PHILLIPS WINE & SPIRITS 6179002 03/25/2021 20210416 382.46 PHILLIPS WINE & SPIRITS 6178994 03/25/2021 20210416 885.59 PHILLIPS WINE & SPIRITS 6179003 03/25/2021 20210416 1,358.28 PHILLIPS WINE & SPIRITS 6178999 03/25/2021 20210416 3,315.71 PHILLIPS WINE & SPIRITS 6178998 03/25/2021 20210416 354.47 PHILLIPS WINE & SPIRITS 6178997 03/25/2021 20210416 203.57 PHILLIPS WINE & SPIRITS 6178996 03/25/2021 20210416 554.70 PHILLIPS WINE & SPIRITS 6178995 03/25/2021 20210416 1,112.67 PHILLIPS WINE & SPIRITS 6179011 03/25/2021 20210416 365.35 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 14 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET PHILLIPS WINE & SPIRITS 6179010 03/25/2021 20210416 779.69 PHILLIPS WINE & SPIRITS 6179012 03/25/2021 20210416 4,971.17 PHILLIPS WINE & SPIRITS 6179001 03/25/2021 20210416 812.88 PHILLIPS WINE & SPIRITS 6179009 03/25/2021 20210416 1,600.42 PHILLIPS WINE & SPIRITS 6178993 03/25/2021 20210416 885.59 PHILLIPS WINE & SPIRITS 6179000 03/25/2021 20210416 2,054.74 PHILLIPS WINE & SPIRITS 6179005 03/25/2021 20210416 3,309.54 PHILLIPS WINE & SPIRITS 6179004 03/25/2021 20210416 708.93 PHILLIPS WINE & SPIRITS 6182695 04/01/2021 20210416 96.69 PHILLIPS WINE & SPIRITS 6182694 04/01/2021 20210416 908.69 PHILLIPS WINE & SPIRITS 6182701 04/01/2021 20210416 51.34 PHILLIPS WINE & SPIRITS 6182700 04/01/2021 20210416 1,688.35 PHILLIPS WINE & SPIRITS 6182702 04/01/2021 20210416 354.47 PHILLIPS WINE & SPIRITS 6182696 04/01/2021 20210416 650.06 PHILLIPS WINE & SPIRITS 6182693 04/01/2021 20210416 1,664.76 PHILLIPS WINE & SPIRITS 6161585Credit 04/01/2021 20210416 -1,421.44 PHILLIPS WINE & SPIRITS 6182689 04/01/2021 20210416 1,307.85 PHILLIPS WINE & SPIRITS 6182692 04/01/2021 20210416 1,534.28 PHILLIPS WINE & SPIRITS 6182691 04/01/2021 20210416 73.19 PHILLIPS WINE & SPIRITS 6182690 04/01/2021 20210416 982.15 CHECK 458306 TOTAL: 31,546.15 458307 04/16/2021 PRTD 100835 WINE MERCHANTS 7322923 03/25/2021 20210416 3,649.52 WINE MERCHANTS 7322920 03/25/2021 20210416 24.19 WINE MERCHANTS 7322919 03/25/2021 20210416 2,415.47 WINE MERCHANTS 7322921 03/25/2021 20210416 2,415.47 WINE MERCHANTS 7322925 03/25/2021 20210416 24.19 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 15 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET WINE MERCHANTS 7322924 03/25/2021 20210416 3,201.31 WINE MERCHANTS 7322927 03/25/2021 20210416 24.19 WINE MERCHANTS 7322922 03/25/2021 20210416 2,415.47 WINE MERCHANTS 7322926 03/25/2021 20210416 2,272.82 WINE MERCHANTS 7323888 04/01/2021 20210416 1,117.52 WINE MERCHANTS 7323887 04/01/2021 20210416 1,093.52 WINE MERCHANTS 7323886 04/01/2021 20210416 72.57 WINE MERCHANTS 7323889 04/01/2021 20210416 1,797.09 WINE MERCHANTS 7323885 04/01/2021 20210416 693.95 CHECK 458307 TOTAL: 21,217.28 458308 04/16/2021 PRTD 100835 JOHNSON BROTHERS LIQUOR CO 1767599 03/25/2021 20210416 4,332.96 JOHNSON BROTHERS LIQUOR CO 1767592 03/25/2021 20210416 1,319.76 JOHNSON BROTHERS LIQUOR CO 1767593 03/25/2021 20210416 100.19 JOHNSON BROTHERS LIQUOR CO 1767598 03/25/2021 20210416 1,783.80 JOHNSON BROTHERS LIQUOR CO 1767600 03/25/2021 20210416 245.78 JOHNSON BROTHERS LIQUOR CO 1767591 03/25/2021 20210416 611.57 JOHNSON BROTHERS LIQUOR CO 1767590 03/25/2021 20210416 1,783.81 JOHNSON BROTHERS LIQUOR CO 1767589 03/25/2021 20210416 29.19 JOHNSON BROTHERS LIQUOR CO 1767588 03/25/2021 20210416 618.06 JOHNSON BROTHERS LIQUOR CO 1767611 03/25/2021 20210416 2,600.08 JOHNSON BROTHERS LIQUOR CO 1767587 03/25/2021 20210416 173.28 JOHNSON BROTHERS LIQUOR CO 1767608 03/25/2021 20210416 124.57 JOHNSON BROTHERS LIQUOR CO 1767610 03/25/2021 20210416 1,262.94 JOHNSON BROTHERS LIQUOR CO 1767584 03/25/2021 20210416 333.36 JOHNSON BROTHERS LIQUOR CO 1767609 03/25/2021 20210416 1,483.80 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 16 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET JOHNSON BROTHERS LIQUOR CO 1767594 03/25/2021 20210416 1,747.53 JOHNSON BROTHERS LIQUOR CO 1767586 03/25/2021 20210416 153.07 JOHNSON BROTHERS LIQUOR CO 1767607 03/25/2021 20210416 1,414.47 JOHNSON BROTHERS LIQUOR CO 1767585 03/25/2021 20210416 418.12 JOHNSON BROTHERS LIQUOR CO 1767606 03/25/2021 20210416 992.40 JOHNSON BROTHERS LIQUOR CO 1767605 03/25/2021 20210416 1,078.59 JOHNSON BROTHERS LIQUOR CO 1767604 03/25/2021 20210416 1,123.85 JOHNSON BROTHERS LIQUOR CO 1767603 03/25/2021 20210416 1,887.73 JOHNSON BROTHERS LIQUOR CO 1767597 03/25/2021 20210416 1,046.91 JOHNSON BROTHERS LIQUOR CO 1767595 03/25/2021 20210416 1,143.57 JOHNSON BROTHERS LIQUOR CO 140846 03/25/2021 20210416 -324.76 JOHNSON BROTHERS LIQUOR CO 1768738 03/26/2021 20210416 81.19 JOHNSON BROTHERS LIQUOR CO 1767596 03/26/2021 20210416 1,414.74 JOHNSON BROTHERS LIQUOR CO 1772607 04/01/2021 20210416 4,458.93 JOHNSON BROTHERS LIQUOR CO 1772612 04/01/2021 20210416 29.19 JOHNSON BROTHERS LIQUOR CO 1772613 04/01/2021 20210416 820.19 JOHNSON BROTHERS LIQUOR CO 1772614 04/01/2021 20210416 2,604.99 JOHNSON BROTHERS LIQUOR CO 1772616 04/01/2021 20210416 4,461.76 JOHNSON BROTHERS LIQUOR CO 1772615 04/01/2021 20210416 2,482.14 JOHNSON BROTHERS LIQUOR CO 1772617 04/01/2021 20210416 2,168.57 JOHNSON BROTHERS LIQUOR CO 1772609 04/01/2021 20210416 735.79 JOHNSON BROTHERS LIQUOR CO 1772610 04/01/2021 20210416 2,316.12 JOHNSON BROTHERS LIQUOR CO 1772629 04/01/2021 20210416 3,186.50 JOHNSON BROTHERS LIQUOR CO 1772627 04/01/2021 20210416 825.01 JOHNSON BROTHERS LIQUOR CO 1772611 04/01/2021 20210416 768.62 JOHNSON BROTHERS LIQUOR CO 1772628 04/01/2021 20210416 4,095.59 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 17 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET JOHNSON BROTHERS LIQUOR CO 1772626 04/01/2021 20210416 637.00 JOHNSON BROTHERS LIQUOR CO 1772625 04/01/2021 20210416 372.76 JOHNSON BROTHERS LIQUOR CO 1772624 04/01/2021 20210416 1,788.03 JOHNSON BROTHERS LIQUOR CO 1772623 04/01/2021 20210416 931.86 JOHNSON BROTHERS LIQUOR CO 1772602 04/01/2021 20210416 2,720.05 JOHNSON BROTHERS LIQUOR CO 1772621 04/01/2021 20210416 4,357.05 JOHNSON BROTHERS LIQUOR CO 1772608 04/01/2021 20210416 2,491.51 JOHNSON BROTHERS LIQUOR CO 1772622 04/01/2021 20210416 1,665.18 JOHNSON BROTHERS LIQUOR CO 141570 04/01/2021 20210416 -75.60 JOHNSON BROTHERS LIQUOR CO 1772605 04/01/2021 20210416 2,482.13 JOHNSON BROTHERS LIQUOR CO 1772604 04/01/2021 20210416 266.38 JOHNSON BROTHERS LIQUOR CO 1772603 04/01/2021 20210416 479.38 JOHNSON BROTHERS LIQUOR CO 1772601 04/01/2021 20210416 2,276.48 JOHNSON BROTHERS LIQUOR CO 1772600 04/01/2021 20210416 1,173.40 JOHNSON BROTHERS LIQUOR CO 1772598 04/01/2021 20210416 509.16 JOHNSON BROTHERS LIQUOR CO 1772599 04/01/2021 20210416 325.93 JOHNSON BROTHERS LIQUOR CO 1772606 04/01/2021 20210416 1,401.73 JOHNSON BROTHERS LIQUOR CO 122313 04/08/2021 20210416 -136.18 JOHNSON BROTHERS LIQUOR CO 142430 04/02/2021 20210416 -30.33 JOHNSON BROTHERS LIQUOR CO 142185 04/01/2021 20210416 -4.22 CHECK 458308 TOTAL: 81,565.66 458309 04/16/2021 PRTD 103409 KELBRO COMPANY 2607964 04/01/2021 20210416 136.16 KELBRO COMPANY 2607910 04/01/2021 20210416 138.99 KELBRO COMPANY 2607915 04/01/2021 20210416 91.75 CHECK 458309 TOTAL: 366.90 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 18 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET 458310 04/16/2021 PRTD 138279 KFT FIRE TRAINER LLC 160.00003688 03/19/2021 20210416 2,193.30 CHECK 458310 TOTAL: 2,193.30 458311 04/16/2021 PRTD 100944 KIWI KAI IMPORTS INC 121376 03/25/2021 20210416 81.25 KIWI KAI IMPORTS INC 22131 03/31/2021 20210416 1,200.20 KIWI KAI IMPORTS INC 122120 03/30/2021 20210416 380.25 KIWI KAI IMPORTS INC 122146 04/01/2021 20210416 1,754.40 CHECK 458311 TOTAL: 3,416.10 458312 04/16/2021 PRTD 130042 KULLY SUPPLY INC 541941 03/18/2021 20210416 23.10 CHECK 458312 TOTAL: 23.10 458313 04/16/2021 PRTD 101220 LANO EQUIPMENT INC 03-817898 03/15/2021 20210416 204.01 CHECK 458313 TOTAL: 204.01 458314 04/16/2021 PRTD 100852 LAWSON PRODUCTS INC 9308308838 03/19/2021 20210416 2,504.36 LAWSON PRODUCTS INC 9308308839 03/19/2021 20210416 1,334.70 CHECK 458314 TOTAL: 3,839.06 458315 04/16/2021 PRTD 134957 LEACH LAW OFFICE LLC 8078 03/13/2021 20210416 21,663.00 CHECK 458315 TOTAL: 21,663.00 458316 04/16/2021 PRTD 101552 LEAGUE OF MINNESOTA CITIES 6447 03/15/2021 20210416 1,523.99 CHECK 458316 TOTAL: 1,523.99 458317 04/16/2021 PRTD 101552 LEAGUE OF MINNESOTA CITIES 6454 03/17/2021 20210416 12,351.25 CHECK 458317 TOTAL: 12,351.25 458318 04/16/2021 PRTD 135867 LIBATION PROJECT 34483 03/30/2021 20210416 129.50 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 19 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET CHECK 458318 TOTAL: 129.50 458319 04/16/2021 PRTD 130046 LIFE INSURANCE COMPANY OF NORTH A MARCH 2021 03/19/2021 20210416 2,905.74 CHECK 458319 TOTAL: 2,905.74 458320 04/16/2021 PRTD 130046 LIFE INSURANCE COMPANY OF NORTH A ABL 962671 1 7 03/2103/18/2021 20210416 3,603.35 CHECK 458320 TOTAL: 3,603.35 458321 04/16/2021 PRTD 141434 LUBE TECH 2573066 03/21/2021 20210416 490.59 CHECK 458321 TOTAL: 490.59 458322 04/16/2021 PRTD 146427 LUCID BREWING LLC 10058 04/01/2021 20210416 146.00 CHECK 458322 TOTAL: 146.00 458323 04/16/2021 PRTD 141916 LUPULIN BREWING COMPANY 36064 03/31/2021 20210416 360.90 LUPULIN BREWING COMPANY 36065 03/30/2021 20210416 314.70 CHECK 458323 TOTAL: 675.60 458324 04/16/2021 PRTD 100864 MACQUEEN EQUIPMENT LLC P33397 03/17/2021 20210416 75.24 CHECK 458324 TOTAL: 75.24 458325 04/16/2021 PRTD 100864 MACQUEEN EQUIPMENT LLC P33361 03/16/2021 20210416 7.83 CHECK 458325 TOTAL: 7.83 458326 04/16/2021 PRTD 134063 MANSFIELD OIL COMPANY 22262063 03/18/2021 20210416 12,561.44 MANSFIELD OIL COMPANY 22262064 03/18/2021 20210416 679.81 CHECK 458326 TOTAL: 13,241.25 458327 04/16/2021 PRTD 122554 MATHESON TRI-GAS INC 23095717 02/18/2021 20210416 1,005.49 CHECK 458327 TOTAL: 1,005.49 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 20 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET 458328 04/16/2021 PRTD 141215 MAVERICK WINE LLC INV561034 03/30/2021 20210416 217.50 MAVERICK WINE LLC INV561022 03/30/2021 20210416 217.50 CHECK 458328 TOTAL: 435.00 458329 04/16/2021 PRTD 130477 MCDONALD DISTRIBUTING COMPANY 574551 03/31/2021 20210416 94.00 MCDONALD DISTRIBUTING COMPANY 574549 03/31/2021 20210416 42.00 MCDONALD DISTRIBUTING COMPANY 574550 03/31/2021 20210416 272.00 MCDONALD DISTRIBUTING COMPANY 574552 04/01/2021 20210416 1,310.00 MCDONALD DISTRIBUTING COMPANY 574548 04/01/2021 20210416 178.00 MCDONALD DISTRIBUTING COMPANY 574547 04/01/2021 20210416 84.00 CHECK 458329 TOTAL: 1,980.00 458330 04/16/2021 PRTD 101483 MENARDS 13408 01/17/2021 20210416 11.62 MENARDS 14138 01/28/2021 20210416 26.85 CHECK 458330 TOTAL: 38.47 458331 04/16/2021 PRTD 101483 MENARDS INC 35736 03/15/2021 20210416 89.88 MENARDS INC 35780 03/16/2021 20210416 22.69 MENARDS INC 35860 03/17/2021 20210416 111.80 MENARDS INC 35919 03/18/2021 20210416 314.84 MENARDS INC 36110 03/22/2021 20210416 163.92 CHECK 458331 TOTAL: 703.13 458332 04/16/2021 PRTD 134067 METRO BLOOMS 1345 03/16/2021 20210416 2,450.00 CHECK 458332 TOTAL: 2,450.00 458333 04/16/2021 PRTD 102729 METROPOLITAN FORD LLC 523087 03/17/2021 20210416 303.97 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 21 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET CHECK 458333 TOTAL: 303.97 458334 04/16/2021 PRTD 101161 MIDWEST CHEMICAL SUPPLY INC 43972 03/22/2021 20210416 809.12 MIDWEST CHEMICAL SUPPLY INC 48961 03/18/2021 20210416 607.05 CHECK 458334 TOTAL: 1,416.17 458335 04/16/2021 PRTD 145395 MILK AND HONEY LLC 8277 03/25/2021 20210416 198.00 MILK AND HONEY LLC 8276 03/25/2021 20210416 198.00 CHECK 458335 TOTAL: 396.00 458336 04/16/2021 PRTD 127062 MINNEHAHA BUILDING MAINTENANCE IN 180176771 03/21/2021 20210416 21.51 MINNEHAHA BUILDING MAINTENANCE IN 180176772 03/21/2021 20210416 32.26 CHECK 458336 TOTAL: 53.77 458337 04/16/2021 PRTD 105704 MINNEHAHA CREEK WATERSHED DISTRIC 180176770 03/21/2021 20210416 5.38 CHECK 458337 TOTAL: 5.38 458338 04/16/2021 PRTD 144364 MINNESOTA DRIVERS & VEHICLE SERVI 6695 03/22/2021 20210416 28.50 CHECK 458338 TOTAL: 28.50 458339 04/16/2021 PRTD 140955 MODIST BREWING LLC E-20451 03/25/2021 20210416 308.00 MODIST BREWING LLC E-20622 03/30/2021 20210416 126.00 CHECK 458339 TOTAL: 434.00 458340 04/16/2021 PRTD 143339 MR CUTTING EDGE 3094 03/17/2021 20210416 240.00 CHECK 458340 TOTAL: 240.00 458341 04/16/2021 PRTD 100906 MTI DISTRIBUTING INC 1292681-00 03/16/2021 20210416 39.51 MTI DISTRIBUTING INC 1292681-01 03/18/2021 20210416 22.92 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 22 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET CHECK 458341 TOTAL: 62.43 458342 04/16/2021 PRTD 124541 MULTIFAMILY CARPET CLEANERS INC 9642 03/16/2021 20210416 566.18 CHECK 458342 TOTAL: 566.18 458343 04/16/2021 PRTD 130266 MUNICODE 00355474 03/15/2021 20210416 479.50 CHECK 458343 TOTAL: 479.50 458344 04/16/2021 PRTD 100920 GENUINE PARTS COMPANY 3599-115046 03/16/2021 20210416 27.78 CHECK 458344 TOTAL: 27.78 458345 04/16/2021 PRTD 160050 NELSON-RUDIE & ASSOCIATES INC 44163 03/16/2021 20210416 25,293.50 NELSON-RUDIE & ASSOCIATES INC 44164 03/16/2021 20210416 1,100.00 CHECK 458345 TOTAL: 26,393.50 458346 04/16/2021 PRTD 100076 NEW FRANCE WINE CO 172016 03/31/2021 20210416 430.00 NEW FRANCE WINE CO 172015 03/31/2021 20210416 470.00 NEW FRANCE WINE CO 172017 04/01/2021 20210416 484.00 CHECK 458346 TOTAL: 1,384.00 458347 04/16/2021 PRTD 160071 NATIONAL ORGANIZATION A SOUND-CON 1025 03/17/2021 20210416 1,155.00 CHECK 458347 TOTAL: 1,155.00 458348 04/16/2021 PRTD 100926 NORTHERN TOOL & EQUIPMENT 0035062372 03/18/2021 20210416 143.26 CHECK 458348 TOTAL: 143.26 458349 04/16/2021 PRTD 103578 OFFICE DEPOT 159183659001 03/19/2021 20210416 71.44 OFFICE DEPOT 159188784001 03/19/2021 20210416 22.99 OFFICE DEPOT 162861961001 03/22/2021 20210416 36.37 OFFICE DEPOT 162861199001 03/22/2021 20210416 17.64 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 23 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET CHECK 458349 TOTAL: 148.44 458350 04/16/2021 PRTD 100936 OLSEN CHAIN & CABLE CO INC 667750 03/18/2021 20210416 194.55 CHECK 458350 TOTAL: 194.55 458351 04/16/2021 PRTD 141965 OMNI BREWING COMPANY LLC E-9410 04/01/2021 20210416 101.00 CHECK 458351 TOTAL: 101.00 458352 04/16/2021 PRTD 999998 MARLENY LAKIN 7913 04/07/2021 20210416 777.00 CHECK 458352 TOTAL: 777.00 458353 04/16/2021 PRTD 999998 MARY HARTWIG 7726 04/06/2021 20210416 1,447.60 CHECK 458353 TOTAL: 1,447.60 458354 04/16/2021 PRTD 999998 PAUL MELNICHUK 7727 04/06/2021 20210416 1,425.43 CHECK 458354 TOTAL: 1,425.43 458355 04/16/2021 PRTD 999998 STEPHANIE HALL 8082 04/13/2021 20210416 1,009.52 CHECK 458355 TOTAL: 1,009.52 458356 04/16/2021 PRTD 999998 THOMAS KROCHESKI 7723 04/06/2021 20210416 87.93 CHECK 458356 TOTAL: 87.93 458357 04/16/2021 PRTD 999995 ASHTON MCGEE RESTORATION GROUP ED187208-REFUND 04/07/2021 20210416 237.75 CHECK 458357 TOTAL: 237.75 458358 04/16/2021 PRTD 999995 SICORA DESIGN BUILD ED186065-Refund 04/09/2021 20210416 245.00 CHECK 458358 TOTAL: 245.00 458359 04/16/2021 PRTD 999995 WS & D PERMIT SERVICE INC ED186905-REFUND 04/07/2021 20210416 316.59 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 24 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET CHECK 458359 TOTAL: 316.59 458360 04/16/2021 PRTD 999994 ARMSTRONG CRANE & RIGGING 7917 04/07/2021 20210416 9.00 CHECK 458360 TOTAL: 9.00 458361 04/16/2021 PRTD 999994 STILE FINANCIAL SERVICES 7961 04/08/2021 20210416 300.00 CHECK 458361 TOTAL: 300.00 458362 04/16/2021 PRTD 999996 ADAM THOMPSON 8024 04/09/2021 20210416 54.00 CHECK 458362 TOTAL: 54.00 458363 04/16/2021 PRTD 999996 KAROLINE SPERLING 7954 04/09/2021 20210416 84.00 CHECK 458363 TOTAL: 84.00 458364 04/16/2021 PRTD 999996 SARAH JOHNSON 8038 04/12/2021 20210416 84.00 CHECK 458364 TOTAL: 84.00 458365 04/16/2021 PRTD 999996 STEPHANIE PIERCE 7953 04/09/2021 20210416 90.00 CHECK 458365 TOTAL: 90.00 458366 04/16/2021 PRTD 999996 ZACH NELSON 7914 04/07/2021 20210416 69.00 CHECK 458366 TOTAL: 69.00 458367 04/16/2021 PRTD 149249 PEQUOD DISTRIBUTING W-96862 04/01/2021 20210416 385.75 PEQUOD DISTRIBUTING W-96864 04/01/2021 20210416 382.00 CHECK 458367 TOTAL: 767.75 458368 04/16/2021 PRTD 137833 PEREGRINE AWARDS AND PROMOTIONAL 6225 03/17/2021 20210416 474.73 CHECK 458368 TOTAL: 474.73 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 25 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET 458369 04/16/2021 PRTD 160064 PETSMART LLC 3150 03/22/2021 12577359 20210416 248.97 CHECK 458369 TOTAL: 248.97 458370 04/16/2021 PRTD 100119 PING INC 15590623 03/15/2021 20210416 136.20 CHECK 458370 TOTAL: 136.20 458371 04/16/2021 PRTD 145378 PJS AND ASSOCIATES INCORPORATED 2615 03/22/2021 20210416 658.51 CHECK 458371 TOTAL: 658.51 458372 04/16/2021 PRTD 130926 PLANTSCAPE INC 363369 03/15/2021 20210416 2,223.86 CHECK 458372 TOTAL: 2,223.86 458373 04/16/2021 PRTD 125979 PRECISE MRM LLC 200-1030162 03/22/2021 20210416 150.00 CHECK 458373 TOTAL: 150.00 458374 04/16/2021 PRTD 102642 PRESTIGE FLAG 491377 03/17/2021 20210416 1,697.61 CHECK 458374 TOTAL: 1,697.61 458375 04/16/2021 PRTD 143618 PRYES BREWING COMPANY LLC W-19862 03/25/2021 20210416 274.00 PRYES BREWING COMPANY LLC W-21125 03/31/2021 20210416 380.00 PRYES BREWING COMPANY LLC W-21123 03/31/2021 20210416 256.00 CHECK 458375 TOTAL: 910.00 458376 04/16/2021 PRTD 100977 RICHFIELD PLUMBING COMPANY 81776 03/15/2021 20210416 99.50 CHECK 458376 TOTAL: 99.50 458377 04/16/2021 PRTD 101000 RJM PRINTING INC 114197 03/22/2021 20210416 273.81 CHECK 458377 TOTAL: 273.81 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 26 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET 458378 04/16/2021 PRTD 101659 ORKIN 208313595 03/16/2021 20210416 153.42 ORKIN 208314436 03/16/2021 20210416 149.47 CHECK 458378 TOTAL: 302.89 458379 04/16/2021 PRTD 132210 RUSCIANO GROUP 66270 03/22/2021 20210416 1,655.00 CHECK 458379 TOTAL: 1,655.00 458380 04/16/2021 PRTD 134173 SAFE-FAST INC INV243515 03/19/2021 20210416 138.84 CHECK 458380 TOTAL: 138.84 458381 04/16/2021 PRTD 144553 SALTCO LLC 59024 03/15/2021 20210416 70.00 CHECK 458381 TOTAL: 70.00 458382 04/16/2021 PRTD 100349 SCOTT COUNTY 7490 04/02/2021 20210416 50.00 CHECK 458382 TOTAL: 50.00 458383 04/16/2021 PRTD 144403 SENTEXT SOLUTIONS 201376 03/20/2021 20210416 299.00 CHECK 458383 TOTAL: 299.00 458384 04/16/2021 PRTD 141332 SOUTH TOWN REFRIGERATION INC W63847 03/16/2021 20210416 1,485.48 CHECK 458384 TOTAL: 1,485.48 458385 04/16/2021 PRTD 104672 SPRINT SPECTRUM LP 873184124-220 03/18/2021 20210416 140.64 CHECK 458385 TOTAL: 140.64 458386 04/16/2021 PRTD 145599 SSI MN TRANCHE 1 LLC 8408 03/15/2021 20210416 28,244.13 SSI MN TRANCHE 1 LLC 8409 03/15/2021 20210416 6,628.99 CHECK 458386 TOTAL: 34,873.12 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 27 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET 458387 04/16/2021 PRTD 101645 STATE OF MINNESOTA 3500380 02/28/2021 20210416 1,692.40 CHECK 458387 TOTAL: 1,692.40 458388 04/16/2021 PRTD 139006 OFFICE OF MINT SERVICES W21020575 03/12/2021 20210416 299.40 OFFICE OF MINT SERVICES W21020572 03/12/2021 20210416 2,931.95 CHECK 458388 TOTAL: 3,231.35 458389 04/16/2021 PRTD 133068 STEEL TOE BREWING LLC 39231 03/31/2021 20210416 264.00 STEEL TOE BREWING LLC 39230 04/01/2021 20210416 165.00 CHECK 458389 TOTAL: 429.00 458390 04/16/2021 PRTD 103882 STEELE COUNTY 7664 03/29/2021 20210416 400.00 CHECK 458390 TOTAL: 400.00 458391 04/16/2021 PRTD 124029 STERICYCLE 8181693445 03/22/2021 20210416 61.70 CHECK 458391 TOTAL: 61.70 458392 04/16/2021 PRTD 143698 STORM COMBATIVES TRAINING AND CON 1145 04/09/2021 20210416 799.00 CHECK 458392 TOTAL: 799.00 458393 04/16/2021 PRTD 146040 STRAYER, JUSTIN 6769 03/25/2021 20210416 302.00 STRAYER, JUSTIN 6768 03/25/2021 20210416 538.00 CHECK 458393 TOTAL: 840.00 458394 04/16/2021 PRTD 135803 SUN LIFE ASSURANCE COMPOANY OF CA MARCH 2021 03/19/2021 20210416 5,208.21 SUN LIFE ASSURANCE COMPOANY OF CA MARH 2021 03/19/2021 20210416 3,019.18 SUN LIFE ASSURANCE COMPOANY OF CA MARCH 2021 #2 03/19/2021 20210416 7,437.54 SUN LIFE ASSURANCE COMPOANY OF CA MARCH 2021 #3 03/19/2021 20210416 145.90 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 28 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET CHECK 458394 TOTAL: 15,810.83 458395 04/16/2021 PRTD 146347 TELEFLEX FUNDING LLC 9503739468 03/16/2021 20210416 562.50 CHECK 458395 TOTAL: 562.50 458396 04/16/2021 PRTD 146870 TERRY'S HARDWARE 305925/1 03/22/2021 20210416 3,600.00 CHECK 458396 TOTAL: 3,600.00 458397 04/16/2021 PRTD 160038 TREVOR OLSON 1822 02/15/2021 20210416 625.00 CHECK 458397 TOTAL: 625.00 458398 04/16/2021 PRTD 101038 TOLL COMPANY 10397166 03/22/2021 20210416 134.04 CHECK 458398 TOTAL: 134.04 458399 04/16/2021 PRTD 151773 TOP GOLF USA INC 5496 03/15/2021 20210416 9,162.21 CHECK 458399 TOTAL: 9,162.21 458400 04/16/2021 PRTD 134673 TOTAL MECHANICAL SYSTEMS INC S1005 03/18/2021 20210416 365.00 TOTAL MECHANICAL SYSTEMS INC S1006 03/18/2021 20210416 820.00 CHECK 458400 TOTAL: 1,185.00 458401 04/16/2021 PRTD 142455 TRACER ELECTRONICS LLC 126449 03/19/2021 20210416 107.79 CHECK 458401 TOTAL: 107.79 458402 04/16/2021 PRTD 104064 TRANS UNION LLC 02110229 02/25/2021 20210416 31.68 CHECK 458402 TOTAL: 31.68 458403 04/16/2021 PRTD 101360 TWIN CITY HARDWARE COMPANY INC PSI2031732 03/17/2021 20210416 274.95 CHECK 458403 TOTAL: 274.95 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 29 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET 458404 04/16/2021 PRTD 103973 ULINE INC 131486462 03/18/2021 20210416 224.45 CHECK 458404 TOTAL: 224.45 458405 04/16/2021 PRTD 131957 UNIVERSAL ATHLETIC BOZEMAN 150-0053085-01 03/22/2021 20210416 2,759.40 CHECK 458405 TOTAL: 2,759.40 458406 04/16/2021 PRTD 100050 USPS 7918 04/08/2021 20210416 1,674.00 CHECK 458406 TOTAL: 1,674.00 458407 04/16/2021 PRTD 144033 USS MINNESOTA ONE MT LLC 3135 03/15/2021 20210416 3,646.31 CHECK 458407 TOTAL: 3,646.31 458408 04/16/2021 PRTD 101058 VAN PAPER COMPANY 568589-00 03/16/2021 20210416 35.52 VAN PAPER COMPANY 568977-00 03/19/2021 20210416 44.67 CHECK 458408 TOTAL: 80.19 458409 04/16/2021 PRTD 103252 VEAP INC (VOLUNTEERS ENLISTED TO 211286 03/16/2021 20210416 100,000.00 CHECK 458409 TOTAL: 100,000.00 458410 04/16/2021 PRTD 144209 VENN BREWING COMPANY LLC 2412 03/24/2021 20210416 175.50 VENN BREWING COMPANY LLC 2413 03/24/2021 20210416 160.50 CHECK 458410 TOTAL: 336.00 458411 04/16/2021 PRTD 101066 VIKING ELECTRIC SUPPLY S004529577.001 03/19/2021 20210416 122.08 CHECK 458411 TOTAL: 122.08 458412 04/16/2021 PRTD 144654 VINEYARD VINES LLC 1184430 03/15/2021 20210416 192.64 VINEYARD VINES LLC 1184621 03/16/2021 20210416 346.63 VINEYARD VINES LLC 1184768 03/16/2021 20210416 1,315.33 VINEYARD VINES LLC 1186966 03/22/2021 20210416 66.14 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 30 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET CHECK 458412 TOTAL: 1,920.74 458413 04/16/2021 PRTD 119454 VINOCOPIA INC 0275850-IN 03/25/2021 20210416 457.75 VINOCOPIA INC 0275851-IN 03/25/2021 20210416 1,756.75 VINOCOPIA INC 0275838-IN 03/25/2021 20210416 235.50 VINOCOPIA INC 0275839-IN 03/25/2021 20210416 405.00 VINOCOPIA INC 0275842-IN 03/25/2021 20210416 680.75 VINOCOPIA INC 0275841-IN 03/25/2021 20210416 153.25 VINOCOPIA INC 0275840-IN 03/25/2021 20210416 161.25 VINOCOPIA INC 0276253-IN 04/01/2021 20210416 490.50 VINOCOPIA INC 0276254-IN 04/01/2021 20210416 388.50 VINOCOPIA INC 0276256-IN 04/01/2021 20210416 492.50 CHECK 458413 TOTAL: 5,221.75 458414 04/16/2021 PRTD 100023 VOGEL, ROBERT C 221007 03/22/2021 20210416 3,750.00 CHECK 458414 TOTAL: 3,750.00 458415 04/16/2021 PRTD 143468 VONDENKAMP, MARK 000562 03/25/2021 20210416 228.00 VONDENKAMP, MARK 000561 03/25/2021 20210416 162.00 CHECK 458415 TOTAL: 390.00 458416 04/16/2021 PRTD 140285 WALSER BLOOMINGTON TOYOTA 429059 10/20/2020 20210416 261.51 WALSER BLOOMINGTON TOYOTA 434493 04/07/2021 20210416 169.48 CHECK 458416 TOTAL: 430.99 458417 04/16/2021 PRTD 120784 WALSH GRAPHICS INC 15989 03/17/2021 20210416 330.54 WALSH GRAPHICS INC 15990 03/18/2021 20210416 178.87 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 31 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET CHECK 458417 TOTAL: 509.41 458418 04/16/2021 PRTD 100183 WASHINGTON COUNTY 187033 03/15/2021 20210416 4,173.63 CHECK 458418 TOTAL: 4,173.63 458419 04/16/2021 PRTD 123616 WATER CONSERVATION SERVICES INC 11210 03/15/2021 20210416 474.36 CHECK 458419 TOTAL: 474.36 458420 04/16/2021 PRTD 150986 WILLIAMS SCOTSMAN INC 8612478 03/22/2021 20210416 1,377.25 CHECK 458420 TOTAL: 1,377.25 458421 04/16/2021 PRTD 101033 WINE COMPANY 167282 03/24/2021 20210416 653.00 WINE COMPANY 167292 03/24/2021 20210416 990.85 WINE COMPANY 168041 03/31/2021 20210416 1,017.20 WINE COMPANY 168028 03/31/2021 20210416 437.00 WINE COMPANY 168042 03/31/2021 20210416 619.50 WINE COMPANY 168030 04/01/2021 20210416 653.00 WINE COMPANY 168043 04/01/2021 20210416 940.05 CHECK 458421 TOTAL: 5,310.60 458422 04/16/2021 PRTD 124503 WINSUPPLY EDEN PRAIRIE MN CO 207804 01 03/18/2021 20210416 14.36 CHECK 458422 TOTAL: 14.36 458423 04/16/2021 PRTD 142162 WOODEN HILL BREWING COMPANY LLC 2648 03/19/2021 20210416 194.40 WOODEN HILL BREWING COMPANY LLC 2647 03/19/2021 20210416 379.50 WOODEN HILL BREWING COMPANY LLC 2646 03/19/2021 20210416 250.80 WOODEN HILL BREWING COMPANY LLC 2656 03/26/2021 20210416 316.50 WOODEN HILL BREWING COMPANY LLC 2663 04/01/2021 20210416 448.20 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 32 CASH ACCOUNT: 9999 1012 Control BS - CashAP CHECK NO CHK DATE TYPE VENDOR NAME INVOICE INV DATE PO CHECK RUN NET CHECK 458423 TOTAL: 1,589.40 458424 04/16/2021 PRTD 127774 WORLDWIDE CELLARS INC R21-51004 03/30/2021 20210416 686.50 CHECK 458424 TOTAL: 686.50 458425 04/16/2021 PRTD 105740 WSB & ASSOCIATES R-017155-000-4 03/15/2021 20210416 2,556.50 WSB & ASSOCIATES R-015816-000-7 03/17/2021 20210416 522.00 CHECK 458425 TOTAL: 3,078.50 458426 04/16/2021 PRTD 103410 WW GOETSCH ASSOCIATES INC 10724 03/19/2021 20210416 9,230.00 CHECK 458426 TOTAL: 9,230.00 458427 04/16/2021 PRTD 101103 WW GRAINGER 9836441759 03/15/2021 20210416 -276.21 WW GRAINGER 9840023841 03/17/2021 20210416 360.32 CHECK 458427 TOTAL: 84.11 458428 04/16/2021 PRTD 101572 ZARNOTH BRUSH WORKS INC 0183976-IN 03/22/2021 20210416 2,335.00 CHECK 458428 TOTAL: 2,335.00 458429 04/16/2021 PRTD 101091 ZIEGLER INC IN000033700 03/18/2021 20210416 109.04 ZIEGLER INC IN000034863 03/20/2021 20210416 3,763.22 CHECK 458429 TOTAL: 3,872.26 458430 04/16/2021 PRTD 136192 ZOLL MEDICAL CORPORATION 3251301 03/17/2021 20210416 406.88 CHECK 458430 TOTAL: 406.88 City of Edina, MN A/P CASH DISBURSEMENTS JOURNAL Report generated: 04/15/2021 13:08User: LJeffersonProgram ID: apcshdsb Page 33 NUMBER OF CHECKS 201 *** CASH ACCOUNT TOTAL *** 693,395.23 COUNT AMOUNT TOTAL PRINTED CHECKS 201 693,395.23 *** GRAND TOTAL *** 693,395.23 Date: April 20, 2021 Agenda Item #: VI.C. To:Mayor and City Council Item Type: Report / Recommendation From:Donald Uram, Finance Director Item Activity: Subject:Resolution No. 2021-35: Amending 2020 Budgeted Liquor Transfers Action CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: Approve Resolution 2021-35 amending the 2020 Budgeted Liquor Transfers. INTRODUCTION: In 2020, all of the City's enterprises were impacted by the pandemic including the Art Center, Braemar Arena and the liquor operations. As a result, staff is recommending that the budgeted liquor transfers be amended per the attached resolution to match the net income of the liquor operations. T his helps to accomplish the following objectives: Ensures positive cash balances Provides the Arena a reserve in case of an unbudgeted repair Maintains transfer to Construction Fund Prevents Liquor from using fund balance to pay for transfer ATTACHMENTS: Description Resolution No. 2021-35: Amending 2020 Budgeted Liquor Transfers RESOLUTION NO. 2021-35 AMENDING THE 2020 BUDGETED LIQUOR TRANSFERS WHEREAS, the City’s 2020 Budget included a transfer from Edina Liquor to various enterprise funds and the construction fund to support their operations; and WHEREAS, due to COVID-19, the enterprises scheduled to receive a Liquor transfer were either closed or had their operations restricted based on the Governor’s Executive Orders limiting the size of gatherings; and WHEREAS, Edina Liquor’s revenues were also impacted by the pandemic resulting in 2020 Net Income less than the budgeted transfer amount; and WHEREAS, to ensure that the affected funds maintain positive cash balances, provide continued support for the construction fund and to reduce the amount of transfer from Edina Liquor without using fund balance, the following action will be taken; and NOW THEREFORE BE IT RESOLVED by the City Council of the City of Edina, Minnesota, that the following amendment be made to the 2020 Budgeted Liquor Transfers: FACILITY BUDGETED TRANSFER RECOMMENDED TRANSFER Art Center 225,000 125,000 Braemar Arena 300,000 300,000 Centennial Lakes Park 100,000 0 Construction Fund 175,000 175,000 TOTAL LIQUOR TRANSFER $800,000 $600,000 Passed and adopted by the City Council on April 20, 2021. ATTEST: Sharon Allison, City Clerk James B. Hovland, Mayor STATE OF MINNESOTA ) COUNTY OF HENNEPIN )SS CITY OF EDINA ) CERTIFICATE OF CITY CLERK I, the undersigned duly appointed and acting City Clerk for the City of Edina do hereby certify that the attached and foregoing Resolution was duly adopted by the Edina City Council at its Regular Meeting of April 20, 2021, and as recorded in the Minutes of said Regular Meeting. WITNESS my hand and seal of said City this day of , 20____. City Clerk Date: April 20, 2021 Agenda Item #: VI.D. To:Mayor and City Council Item Type: Report / Recommendation From:Scott Neal, City Manager Item Activity: Subject:Approve Agreement for the Dissolution of the Edina Firefighters Relief Association Action CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: Approve Agreement for the Dissolution of the Edina Firefighters Relief Association (EFRA). INTRODUCTION: Due to changing demographics and needs of the community, the City has determined it is in the best interests of the City to eliminate the paid on-call program in favor of an exclusive full-time staffing program. This transition necessitates the termination of the Retirement Plan and dissolution of the EFRA. The City and the EFRA have agreed that a voluntary dissolution is in their respective best interests and have met in good faith to negotiate the terms of the attached agreement. T his agreement was approved by the EFRA Board on April 14. Also attached is a EFRA Resolution that was ratified unanimously by the general membership at their April 14 meeting. T his resolution states their intent to dissolve and the actions necessary to wind down the association by December 31, 2021. ATTACHMENTS: Description Dissolution Agreement EFRA Resolution AGREEMENT FOR THE DISSOLUTION OF THE EDINA FIREFIGHTERS RELIEF ASSOCIATION This Agreement for the Dissolution of the Edina Firefighters Relief Association ("Agreement") is entered into by and between the City of Edina, a Minnesota municipal corporation, ("City") and the Edina Firefighters Relief Association, a Minnesota nonprofit corporation, ("EFRA"). The City and the EFRA may hereinafter be referred to individually as a "party" or collectively as the "parties." RECITALS A. The EFRA was established in 1942, is a Minnesota nonprofit corporation under Minnesota Statutes, chapter 317A, and is associated with the City of Edina Fire Department ("Fire Department"). B. The Fire Department currently has 41 full-time paramedic/firefighters ("FT Firefighters"), which participate in the Police and Fire Plan administered by the Minnesota Public Employees Retirement Association. C. In addition to the full-time program, the Fire Department also has a paid on-call program ("POC Program"). The POC Program includes most of the FT Firefighters, who provide on-call services outside of their regular full-time hours, and seven additional firefighters ("Exclusive POC Firefighters") who are not full-time employees of the Fire Department and work exclusively under POC Program (the FT Firefighters and Exclusive POC Firefighters are hereinafter referred to collectively as the ("POC Firefighters"). The term POC Firefighters includes all active and inactive members of the EFRA entitled to the payment of a pension benefit from the EFRA. D. The EFRA established and administers a retirement plan ("Retirement Plan") for the POC Firefighters. The Retirement Plan provides a defined contribution service pension and related benefits to the POC Firefighters in accordance with Minnesota Statutes, chapter 424A. E. The Retirement Plan is funded by fire state aid, which is calculated based on service provided in the year previous to the year in which it is paid. The City receives the fire state aid payment in October or November and then forwards the funds to the EFRA. This Agreement provides for the distribution of fire state aid for service provided in 2020, which is paid in 2021, and a portion of the fire state aid paid in 2022 for service provided from January 1, 2021 through April 30, 2021. F. In accordance with Minnesota Statutes, chapter 424A, the funds held by the EFRA to pay pensions and related benefits are contained within its special fund ("Special Fund") and all other EFRA funds are maintained in its general fund ("General Fund"). G. Due to changing demographics and needs of the community, the City has determined it is in the best interests of the City to eliminate the POC Program in favor of an exclusive full-time 1 ED190-1-708053.v5 staffing program. This transition necessitates the termination of the Retirement Plan and dissolution of the EFRA. H. In 2020, the legislature adopted Minnesota Statutes, section 424B.22 ("Act") to provide the exclusive method for terminating paid on call firefighter retirement plans and dissolving relief associations. The Act provides both a voluntary and involuntary dissolution process. The City has indicated it would pursue the involuntary dissolution process if the parties are not able to reach agreement on a voluntary dissolution process. I. The City has communicated to the EFRA that it intends to dissolve the EFRA and, as a result, the Retirement Plan, effective as of December 31, 2021 in accordance with the Act. Because the Act does not address the full range of issues important to the POC Firefighters related to the dissolution process, the parties determined it is in their respective best interests to reach agreement on a voluntary dissolution of the EFRA. As a result, the parties have met in good faith to identify issues and negotiate the terms of this Agreement. J. Due to an April 30, 2021 deadline for the City to act on an involuntary dissolution, if the EFRA does not execute this Agreement on or before April 14, 2021, which is the packet deadline for the last City Council meeting in April, the City will proceed with an involuntary dissolution process. K. The parties intend to accomplish the voluntary termination of the Retirement Plan and the dissolution of the EFRA in accordance with the Act and the provisions of this Agreement by no later than December 31, 2021. AGREEMENT In consideration of the mutual promises, representations, and agreements contained herein, which both parties acknowledge is sufficient, and intending to be legally bound, the parties agree as follows: 1. EFRA Representations. The EFRA represents to the City, as inducement for the City to enter into this Agreement, that prior to the effective date of this Agreement it has adopted a resolution, supported by a vote of the POC Firefighters, committing to complete all of the following, and to take such other steps as may be needed, to accomplish the dissolution of the EFRA on or before December 31, 2021. (a) Dissolution Plan. Develop and adopt a resolution approving a plan for the dissolution of the EFRA ("Dissolution Plan") in accordance with Minn. Stat. § 317A.721, subd. 2. The dissolution plan will provide for all of the following: (1) The determination of assets and liabilities as provided in Subdivision 5(a) of the Act and Minn. Stat. § 317A.725; 2 ED190-1-708053.v5 (2) Developing the schedule of members and benefits required by Subdivision 5(b) of the Act including the distribution of any forfeited accounts as provided in Subdivision 5(c) of the Act; (3) Identifying any missing members as required by Subdivision 9(d) of the Act; (4) Moving of the EFRA investment assets in the special fund into a low-risk investment as required by Subdivision 6 of the Act; (5) Providing the 30-day notice of termination required by Subdivision 11 of the Act; (6) Complete the distribution of all pension and related payments to eligible members and survivors as required by Subdivision 8 of the Act prior to December 31, 2021; (7) Complete the dissolution and winding up of the EFRA as required by Subdivision 12 of the Act and Minn. Stat. §§ 317A.721-317A.733 on or before December 31, 2021; and (8) Identify and set out such other steps as may be required to terminate the Retirement Plan, pay all required benefits, and to dissolve and wind up the affairs of the EFRA on or before December 31, 2021. (b) Member Vote. Prior to the effective date of this Agreement the EFRA obtained a vote of support from the POC Firefighters for the dissolution of the EFRA in accordance with the terms and conditions of this Agreement and will conduct another vote if needed to ratify the dissolution of the EFRA. 2. Termination of the Retirement Plan. The EFRA agrees to implement its Dissolution Plan and to take all other actions required to dissolve and wind up the EFRA on or before December 31, 2021. The Relief Board agrees to not engage in or support any efforts to avoid or extend the dissolution of the EFRA beyond December 31, 2021. 3. Member Pensions. (a) Fully Vested. The parties agree the POC Firefighters become 100% vested in their respective pensions as provided Subdivision 3(b) of the Act. (b) Fire State Aid. The parties agree the amounts to be included in the EFRA special fund, and to be distributed to Members under the Retirement Plan in accordance with the EFRA bylaws and the Act, includes the following: (1) 2021 Distribution. The full amount of the 2021 fire state aid payment, including the supplemental state aid portion, the City anticipates receiving in October 2021 shall be distributed to the EFRA within 10 days of receipt. The EFRA shall deposit the fire state aid payment in its Special Fund for distribution in accordance with its Retirement Plan. 3 ED190-1-708053.v5 (2) Anticipated 2022 Distribution. The City agrees to contribute to the EFRA Special Fund an amount equal to the estimated amount of fire state aid to be distributed in 2022 for the period of service from January 1, 2021 to April 30, 2021. The amount of this contribution shall equal one-third of the fire state aid received by the City in 2021 (for service in 2020). The City shall pay the identified amount to the EFRA for deposit in its Special Fund and distribution in accordance with its Retirement Plan. The City shall make this payment to the EFRA at the same time it pays the 2021 distribution. (c) Distribution of Benefits. The EFRA is solely responsible for determining and paying all pension and related benefits to POC Firefighters and their survivors from the special fund prior to December 31, 2021. The EFRA shall provide written notice to the City within 10 days of paying all benefits required under law. (d) Supplemental Benefits. The City agrees to pay supplemental benefits under Minn. Stat. § 424A.10 to each POC Firefighter and survivor who satisfies the requirements of Minn. Stat. § 424A.10, subd. 2 in accordance with Subdivision 10 of the Act. The City will seek reimbursement of the amount it pays for supplemental benefits from the Minnesota Department of Revenue as provided in law. 4. Historical Committee. The City agrees to include in its 2022 budget for the Fire Department funds to assist in carrying out the activities of the Fire Department's Historical Committee. In future years, the Fire Department may elect to include an amount for activities of the Historical Committee in its proposed budget. 5. Dissolution of the EFRA. The EFRA agrees to implement its Dissolution Plan that results in the termination of the Retirement Plan, and the dissolution and wind up of the EFRA by no later than December 31, 2021. 6. TeHnination of POC Firefighters. The parties agree all of the EFRA members will be separated from their employment as POC Firefighters with the Fire Department effective on April 30, 2021. This separation from employment ends all of the part-time positions on the Fire Department, but does not affect the full-time status of the FT Firefighters. (a) Release Agreement. The Exclusive POC Firefighters have the option of entering into a release agreement with the City regarding the separation from their positions on the Fire Department. The release agreement will be in the foun provided by the City and, if agreed to, will provide for a lump sum payment to the Exclusive POC Firefighter in the amount of $2,500. (b) Unemployment. The parties make no representations as to the eligibility of POC Firefighters for unemployment insurance payments resulting from their termination from the Fire Department as POC Firefighters. 4 ED190-1-708053.v5 7. Costs and Expenses. Each party is responsible for paying its own legal and accounting costs incurred related to negotiating this Agreement and in carrying out their respective duties under this Agreement. The EFRA is responsible for paying from its General Fund all other administrative expenses it incurs to deterniine and pay benefits, and to complete all steps required to dissolve and wind up the EFRA. 8. No City Interest. The City agrees it has no interest in, or right of payment from, the EFRA Special Fund or General Fund. 9. No Additional Payments. The parties agree the City's obligations to make payments to the EFRA and the POC Firefighters as a result of the dissolution are limited to those specifically identified in this Agreement. 10. Breach. The EFRA acknowledges and agrees the City is forgoing its right to undertake an involuntary dissolution of the EFRA in 2021 in exchange for the promises the EFRA makes in this Agreement to voluntarily dissolve the EFRA by December 31, 2021. Because there is an April 30, 2021 deadline for the City to act to involuntarily dissolve the EFRA effective on December 31, 2021, the City is relying on the representations and agreements made by the EFRA in this Agreement. Notwithstanding anything to the contrary in this Agreement, the parties agree that if the EFRA fails to complete all actions needed to terminate its Retirement Plan, to pay all pension and other benefits due to the POC Firefighters, and to dissolve and wind up the EFRA on or before December 31, 2021: (a) The EFRA voluntarily waives all interest in the fire state aid distributed to the City after 2021, including the portion of the 2022 distribution the City agreed to advance to the EFRA under this Agreement. If the City has made the advanced payment, the EFRA agrees to refund the full amount of the payment to the City; and (b) The EFRA shall pay all costs, including attorneys' fees, the City incurs to involuntary dissolve the EFRA, to claw back any amounts to be refunded to the City, and to defend the use of the 2022 fire state aid distribution for the FT Firefighters' pension program or other uses allowed under law. 11. General Provisions. (a) Compliance. Each party is responsible for complying with all applicable laws in carrying out its duties under this Agreement. (b) Term and Termination. This Agreement goes into effect as of the date of the last party to execute it and shall remain in effect until the EFRA has terminated the Retirement Plan, paid all pension and benefit obligations, and has fully dissolved and wound up the EFRA. (c) Entire Agreement. This Agreement, including the recitals which are incorporated herein, contains the entire understanding between the parties relating to the termination of the Retirement Plan and the dissolution of the EFRA. 5 ED190-1-708053.v5 (d) Minnesota Law Applies. This Agreement will be governed by the laws of the State of Minnesota and shall be construed and enforced thereunder. Any claim pursuant to this Agreement shall be brought in the District Court for the State of Minnesota, Hennepin County, or the United States District Court for the District of Minnesota. The parties to this Agreement consent to the sole and exclusive jurisdiction of such courts over the subject matter of any such claim as well as over the parties. (e) Invalidity. If any term of this Agreement is deemed to be invalid or unenforceable by a court, the validity, enforceability, and legality of the remaining terms will not be affected or impaired. In addition, whenever possible the court is to amend or modify the offending term to the minimal extent necessary to make it enforceable. (1) Binding Upon Successors. This Agreement shall be binding upon and shall inure to the benefit of City and the EFRA, and their respective heirs, administrators, representatives, executors, successors and assigns. IN WITNESS WHEREOF, the parties have executed this Agreement effective as of the date of the last party to execute it. EDINA FIREFIGHTERS RELIEF ASSOCIATION Joshua Link, President gea, SoCeo stp / Ben Sorensen, Secretary 0 i-/-Iii -2v 2 1 Date ED190-1-708053.v5 6 CITY OF EDINA James Hovland, Mayor Scott Neal, City Manager Date ED190-1-708053.v5 7 Resolution of the Edina Firefighters Relief Association Stating the Intent of the Board of Trustees and Members to Dissolve and Wind Up the Association by December 31, 2021 Whereas, due to changing demographics and the needs of the community, the city of Edina ("the City") has determined it is in the best interest of the City to end the paid on-call firefighter program in favor of an exclusive fulltime staffing program, and Whereas, the City managers informed all members of the Edina Firefighters Relief Association ("EFRA") on February 10, 2021 that the City will no longer hire new paid on-call firefighters and that it intended to develop and implement a plan to phase out the paid on-call portion of the Fire Department with a target date of December 31, 2021 which meant the last day of work for paid on-call firefighters would be April 30,2021, and Whereas, in 2020 the legislature adopted Minn. Stat. § 424B.22 to provide the exclusive method for teiminating paid on-call firefighting retirement plans and dissolving relief associations, and Whereas, Minn. Stat. § 424B.22 provides for both a voluntary and involuntary dissolution process, and the City has indicated it would pursue the involuntary dissolution process effective as of December 31, 2021 if the parties are not able to reach an agreement on a voluntary dissolution, and Whereas, because Minn. Stat. § 424B.22 does not address the full range of issues important to the EFRA and its members as it relates to the dissolution process and the EFRA wants to maintain a positive relationship with the City, the parties have determined that it is in their respective best interests to reach an agreement on a voluntary dissolution of the EFRA and as a result the parties met in good faith in March 2021 to identify issues and negotiate terms for the dissolution of the EFRA by December 31, 2021. Therefore, be it resolved, that the Board of Trustees approves, and authorizes the President and Secretary of the EFRA to enter into, the attached Agreement for the Dissolution of the EFRA between the City and the EFRA ("Dissolution Agreement") effective upon approval of the City Council at its April 20, 2021 meeting. Be it further resolved, that the EFRA will take all actions necessary under Minn. Stat. § 424B.22 and under Minnesota Nonprofit Law to dissolve and wind up the EFRA under the terms of the Dissolution Agreement, Minn. Stat. § 424B.22 and the Minnesota Nonprofit Corporation Act and that this will be accomplished by December 31, 2021. Be it further resolved, that the EFRA will develop and adopt a fonural Resolution approving a plan for dissolution of the EFRA in accordance with Minn. Stat. § 317A.721, subd. 2 and Minnesota Statutes § 424B.22 by no later than June 1, 2021. The dissolution plan will provide for the following: 1. Deten tination of assets and liabilities as provided in Minn Stat. § 424B.22, subd. 5(a) and Minn. Stat. § 317A.725 by no later than November 1, 2021. 2. Develop a schedule of members and benefits required by Minn. Stat. § 424B.22, subd. 5(b) including distribution of any forfeited accounts as provided in Minn. Stat. § 424B.22, subd. 5(c) by no later than November 1, 2021. 3. Identifying any missing members as required in Minn. Stat. § 424B.22, subd. 9 (b). 4. Moving of the EFRA investment assets from the special fund to low risk investments as required by Minn. Stat. § 424B.22, subd. 6 at a time determined by the EFRA Board of Trustees. 5. Terminate the retirement plan in accordance with Minn. Stat. § 424B.22, subd. 1(b) and designating the termination date of the retirement plan as April 30, 2021. 6. Providing 30 day notice of termination as required by Minn. Stat. § 424B.22, subd. 11. 7. Complete the distribution of all pensions or related investments to all eligible members or survivors as required by Minn. Stat. § 424B.22, subd. 8 prior to December 31, 2021 by allowing an initial distribution of pension amounts to all eligible beginning May 15, 2021 or as soon thereafter as is practicable and by providing for a final distribution no later than November 30, 2021. 8. Complete the dissolution of the EFRA as required by Minn Stat. § 424B.22, subd. 12 and Minn. Stat. § 317A.721 and Minn. Stat. § 317A.733 on or before December 31, 2021. 9. Take any other necessary action to terminate the retirement plan, pay all required benefits and dissolve and wind up the affairs of the EFRA on or before December 31, 2021. Be it further resolved, consistent with the Dissolution Agreement that the members pensions will be treated in the following manner: 1. All paid on-call firefighters and EFRA members who meet the definition of "member" in Minn. Stat. §424B.01, subd. 3e shall become 100% vested for all periods of eligible service their respective pension accounts as of April 30, 2021. 2. Fire State Aid and supplemental fire state aid paid in 2021 will be distributed to the EFRA and paid into the retirement plan and allocated to accounts of members. The fire state aid and supplemental fire state aid payments the City anticipates receiving in October, 2021 will be distributed to the EFRA within 10 days of receipt. 3. The City agrees to contribute to the EFRA special fund an amount equal to the fire state aid and supplemental fire state aid to be distributed in 2022 for the period between January 1, 2021 and April 30, 2021 which shall be one third of the amount received by the City in 2021 and paid at the same time as regular fire state aid. 4. The City will also pay any supplemental benefits to members of the EFRA in conjunction with the dissolution who are eligible to receive the benefit under Minn. Stat. § 424A.10. The EFRA will prepare and take all actions necessary to and be responsible for the distribution of benefits to each of its members. Be it further resolved, in the Dissolution Agreement the City agrees to include in its 2022 budget for the fire department funds to carry out the activities of the Fire Department Historical Committee and in future years the fire department may elect to include an amount for activities of the Historical Committee in its proposed budget. Be it further resolved, paid on-call firefighters who are separated from employment with the department on April 30, 2021 are entitled to severance payments from the City in the amount of $2,500 provided they execute the City's release agreement of any claims against the City or expenses. Be it further resolved, that the Board of Trustees directs Union Bank & Trust Co. ("UBT") to commence an accounting and reconciliation of benefits due all members and provide 100% vesting for all of those members who qualify under Minn. Stat. §424B.22 because of the dissolution of the EFRA, in connection with this calculation UBT shall use its most recent accounting statement for all person except one individual who did not meet the requirement of having one year of service credit under Minn. Stat. §424B.01, subd 3e(a)(2) Be it further resolved, that, in addition to the normal distribution process for members eligible to withdraw their account balances, distribution of members eligible to rollover their account balances due to the dissolution of the EFRA will be done in two phases: an initial distribution will occur by or before May 15, 2015 based on assets of the EFRA on April 30, 2021 and a second distribution will occur on November 1, 2021 after fire state aids and the city contribution are paid into the Special Fund of the EFRA; Be it further resolved, that the EFRA Board of Trustees directs that all funds invested with UBT be converted to liquid assets to protect the account balances of all members; Be it further resolved, that the Board of Trustees directs the law firm of Rice, Walther & Mosley, LLP to perform necessary legal work to ensure the EFRA complies with Minnesota law in paying benefits to members and the EFRA winds up its corporate affairs and dissolves itself Be it further resolved, that the Board of Trustees authorizes the payment of all banking, trust, accounting, evaluation, and legal fees associated with the dissolution of the EFRA; Be it further resolved, the EFRA will also terminate the EFRA General Fund as part of the dissolution process and distribute all funds in the EFRA General Fund in equal shares to all persons who were active members of the EFRA on April 30,2021, this distribution will at the time the EFRA is dissolved. Be it finally resolved, that the Board of Trustees acknowledges that the language of this Resolution does not alter the terms and conditions of the Dissolution Agreement and that in order for the Dissolution Agreement to become effective it must be adopted by the EFRA Board of Trustees and ratified by a vote of the membership of the EFRA at its meeting held on April 14, 2021. Approved by the Edina Firefighters Relief Association Board of Trustees on April 14, 2021. President a e vl Secretary So cevisov)/041-t This Resolution was ratified by a majority vote of the Membership of the Edina Firefighters Relief Association at its meeting held on April 14, 2021. President Y(L- etv? Sof eV Se vl Secretary i Date: April 20, 2021 Agenda Item #: VI.E. To:Mayor and City Council Item Type: Request For Purchase From:Ross Bintner P.E., Engineering Services Manager Item Activity: Subject:Request for Purchase: Engineering Services for Lift Station No. 3 Replacement Action CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: Approve Request for Purchase for engineering services for Lift Station No. 3 replacement with Bolton and Menk in the amount of $56,950. INTRODUCTION: See attached request for purchase and study showing that the lift station is beyond its useful life and letter proposal. Staff recommends full replacement. ATTACHMENTS: Description Request for Purchase: Engineering Services for Lift Station No. 3 Replacement Lift Station No. 3 Feasibility Study Agreement Request for Purchase Requisition Number 1 CITY OF EDINA 4801 W 50th St., Edina, MN 55424 www.EdinaMN.gov | 952-927-8861 12100082 Department:Engineering Buyer:Ross Bintner Date: 04/09/2021 Requisition Description:Engineering Services for Lift Station 3 Replacement Vendor:BOLTON & MENK INC Cost:$56,950.00 REPLACEMENT or NEW:REPLACEM - REPLACEMENT PURCHASE SOURCE:SERVIC K - SERVICE CONTRACT DESCRIPTION: Engineering services for lift station 3 replacement including design, bidding and construction phase services. BUDGET IMPACT: This project is funded from the sanitary sewer fund and detailed in CIP Project No. 19-339. Additional funds are being utilized for the capital replacement of the lift station from savings associated with the 2020 SCADA Project and the 2021 Street Reconstruction Projects. Environmental Impact - item specific: 2 ENVIRONMENTAL IMPACT: Engineering services has little environmental impact. Staff will ensure the deign of the lift station accounts for the City's sustainability goals. This type of infrastructure does use natural resources and energy to operate. Vehicle - Make/Model/Year requested vehicle: Vehicle - Make/Model/Year current vehicle (if replacement): Vehicle - Does purchase meet Green Fleet Recommendations? - Vehicle - If does not meet Green Fleet Recommendations, justification: - MPG: Carbon Emissions: MEMORANDUM Date: March 11, 2021 To: Ross Bintner, P.E., Engineering Services Manager Nathan Kaderlik, Utilities Supervisor From: Seth A. Peterson, P.E. Jacob Humburg, P.E. Subject: Edina, Minnesota Lift Station 3 Feasibility Study BMI No: 0M2.123420 Introduction Lift Station 3 is a wastewater pumping station in the City of Edina, located off the cul-de-sac on Warden Avenue just west of Tracy Avenue. The station is located on city-owned property on the south side of Warden Avenue with a church to the west and private residences to the east and south. It was originally constructed in 1959 as a wet well/dry well station with a building at the surface. The dry well side of the station contains two Flygt dry pit submersible pumps, each capable of pumping 750 gallons per minute, which were installed in the late 1980s. The controls for the pumps are located inside the building at ground level, above the dry well. Other improvements to the lift station include replacement of the mechanical (HVAC) systems, associated electrical components, and the building roof in 2005, some piping replacement in the dry well approximately five years ago, and controls replacement within the last two years. In December 2020 and January 2021 Bolton & Menk met on-site with City of Edina employees to assess the station. The assessment was done with the rehabilitation of the station in mind and considered all aspects of the station. Existing Lift Station Description & Assessment The pumps and process piping in Lift Station 3 are over 30 years old and although still functioning are beyond their useful life. Some of the piping and valves in the dry well have been recently replaced and could possibly be reused, but the rest of the piping in the dry well and that passing through the concrete dividing wall and into the wet should be replaced, along with any Name: Lift Station 3 Feasibility Study Date: March 11, 2021 Page: 2 other process piping in the wet well. A concrete block vault located just north of the main station contains a gate valve isolating the station and what appears to be some type of bypass piping setup; this piping is also deteriorated and in need of replacement. The station runs for approximately 13 hours per day on average, usually with just a single pump operating. In 2020 there was at least one instance of the total station runtime being over 24 hours, meaning that for some period both pumps were required to run simultaneously. During any station rehab or replacement consideration should be given as to whether the pump size needs to change in order to handle all foreseeable conditions with one pump inoperable (station firm capacity). There have been past events during which the water level in the wet well has significantly surpassed the wet well capacity and flooded the dry well side. The existing wet well does contain adequate storage volume for larger pumps, though downstream sewer system capacity would need to be analyzed. Figure 1. Dry Well & Pumps The existing underground structure condition appears to be fair. The dry well coating system is failing in numerous places, and the wet well doesn’t appear to have any type of coating applied. The wet well contains a ladder and steel catwalk which both appear to be in poor condition due to the corrosive environment. The hatch separating the wet well from the rest of the underground Name: Lift Station 3 Feasibility Study Date: March 11, 2021 Page: 3 portion of the station does not have safety grating. Because the existing wet well and dry well are constructed of concrete, the underground portion of the station has the potential to last for 20 years or possibly more if properly maintained. Figure 2. Wet Well Interior The existing building is brick construction with a shingled hip roof. The roof is 15 years old and is showing wear. Ice dams have been an issue, and the roof doesn’t have a traditional soffit system. A roof hatch that was installed to provide access for removing pumps and other equipment from the dry well is unused, as the city is able to use their crane truck to access the dry well from the east doorway. The roof hatch has the potential to cause leaks. Also located on the roof are exhaust fans for a portion of the building HVAC system. These fans, along with the rest of the HVAC system, are approximately 15 years old. The brick building walls are in fair condition, with some minor tuckpointing needed in places. Some openings remain from when a permanent generator was located inside the building, and the city has indicated a desire to block up these openings should the building remain. Name: Lift Station 3 Feasibility Study Date: March 11, 2021 Page: 4 Figure 3. Lift Station Building The last major overall improvements to the lift station electrical infrastructure took place in 2005/2006, though pump-related controls were replaced in early 2019, including new variable frequency drives (VFDs). Electrical infrastructure in the underground portion of the station was not addressed during the 2005/2006 project, and the majority of these components are in poor condition. The electrical installations below grade and the components in the control room do not meet current electrical code. The wet well is not physically sealed from the dry well or the control room, and both the underground portion of the station and the building control room would be rated a Class 1/Division 1 area which would require all electrical infrastructure to be explosionproof. Any project to upgrade the existing station would need to address this issue. Power is supplied to the lift station by Xcel and the current service is a 230V/3-phase “open delta” type. Xcel is slowly replacing all of their services of this type, and it may be possible to make modifications to the service at reduced or zero cost to the city. The city has already had some discussion with Xcel about a new 208V/3-phase service. Currently there is a portable Caterpillar generator semi-permanently connected to the station via receptacles on the building exterior on the west side of the building. The generator is parked on a concrete pad and has a wooden fence around it which adjoins the station building but is otherwise unprotected. The city has expressed the desire to retain the generator power at the Name: Lift Station 3 Feasibility Study Date: March 11, 2021 Page: 5 station and to construct a lean-to or shelter to protect the unit while also moving it farther from the building. Figure 4. Portable Generator The rest of this report will detail three alternatives for a project involving Lift Station 3: rehabilitating the station while maintaining its current wet well/dry well configuration, removing the existing building and converting it to a submersible station with a new electrical building separate from the existing structure, or constructing a new submersible lift station on the site including circular precast wet well and valve vault structures along with an electrical building. The evaluation of the alternatives includes preliminary cost estimations and discussion on the various aspects and challenges associated with each. Name: Lift Station 3 Feasibility Study Date: March 11, 2021 Page: 6 Alternative 1 – Rehabilitation of the Existing Station The first alternative for rehabilitating Lift Station #3 includes maintaining its present configuration as a wet well/dry well station while replacing existing components and making other improvements as needed. Significant work for this alternative would include the following: • Replace existing building roof and doors • Add roof structure over and extend pad under portable generator • Block up unused opening in existing building • Replace pumps, valves, and all existing piping inside station and install flow meters for each pump • Transition exterior vault to bypass structure and replace buried forcemain up to HDPE transition • Replace existing HVAC system • Upgrade electrical service to new 208V/3-phase • Replace all below-grade (wet well/dry well) electrical infrastructure • Prep and coat wet well and dry well The original structure, including the concrete station below grade and building, appears to be in satisfactory condition. The roof would be replaced along with the removal of the unused roof access hatch. Unused openings in the brick building would be blocked up, and minor tuckpointing done on portions of the existing building where required. The city has expressed the need for the new roof to extend over a new generator pad to shelter the generator from snow, tree debris, etc., as well as an extension or replacement of the fence to protect the generator. The current semi-permanent portable generator installation would be maintained. With the replacement of the roof, both HVAC fans mounted there would need to be removed and based on the age and condition it is assumed that the HVAC system in its entirety would be replaced. As part of Alternative 1, the concrete in the wet well and dry well would need to be assessed prior to being recoated. The wet well interior is difficult to see while the station is in operation, but it appears that some shallow concrete rehabilitation is needed in this area prior to applying coatings. The catwalk in the wet well would be assessed and either removed or replaced, and safety grating added to the wet well hatch opening. As previously mentioned, some additional evaluation should be performed to determine sizing of the new pumps. However, they would likely be replaced with Flygt units similar in size to the current ones. Magnetic flow meters would be added to each pump discharge line to provide more Name: Lift Station 3 Feasibility Study Date: March 11, 2021 Page: 7 accurate measurement of flows through the station. The underground vault outside of the station, which currently contains a gate valve for isolating the station, would be converted to a bypass vault with a connection tee for bypassing flow around the station if ever needed. Finally, the rest of the buried cast-iron forcemain up to its transition to HDPE in the station driveway would be replaced, and the driveway would be expanded around the east side of the station to provide better access to the station for city crane trucks. All electrical infrastructure in the underground portion of the station (wet well and dry well) would be replaced and be brought up to code. Some of the components in the control room would likely also have to be replaced or modified, and this could be in part addressed through the upgrades currently taking place throughout Edina’s SCADA system which have not yet reached Lift Station 3. Alongside the electrical upgrades in the control room and replacement of the building HVAC, all penetrations between the control room and the below-grade station would need to be completely sealed so as to avoid an explosionproof classification in the control room. Table 1, below, presents construction cost estimates for Alternative 1. Table 1 – Alternative 1 Cost Estimates Mobilization $40,000 Demolition/Removals $30,000 Grading/Site Work/Driveway $20,000 Building Repairs/Roof/Modifications $45,000 Misc. Metals (Hatches/Grating/Etc.) $25,000 Piping/Valves/Flow Meters $75,000 Submersible Pumps $70,000 Mechanical/HVAC $80,000 Electrical & Controls $100,000 Generator Shelter/Pad/Fence $20,000 Bypass Pumping $45,000 Construction Subtotal $620,000 Contingencies (20%) $125,000 Construction Total $745,000 Engineering (15%) $115,000 Total $860,000 Name: Lift Station 3 Feasibility Study Date: March 11, 2021 Page: 8 While Table 1 accounts for the capital costs associated with construction, it does not detail lifetime costs for the station associated with Alternative 1. Because of the building, these will be higher than for the other alternatives. The building (roof and architectural components) as well as the mechanical systems would require regular maintenance and would need to be replaced every 15-20 years. Alternative 2 – Convert Existing Station to Submersible The second alternative for Lift Station 3 is to do away with the current wet well/dry well configuration and convert the existing station to a submersible (wet well/valve vault). Significant work for Alternative 2 includes the following: • Demolish existing building and replace the concrete floor/top slab • Extend the wall separating the existing wet well and dry well up to grade • Demolish all existing HVAC & electrical equipment below grade • Remove any existing concrete benching from wet well • Replacement of pumps and replacement/reconfiguration of all station piping • Rehabilitation (if needed) and recoating of concrete in the new valve vault • Replacement of existing pumps and controls/electrical • Construction of new prefabricated building to house the electrical components The existing wall that separates the wet well and dry well would be extended up to grade to create true separation between the new wet well and valve vault. The wet well would remain the wet well but the existing stairs and top slab/landing would be removed and submersible pumps, guide rails, and controls installed. The space currently serving as the dry well would be converted to a valve vault, with the removal of the existing centrifugal pumps and replacement and reconfiguration of the piping and valves. To perform this work the existing building would need to be demolished. After its removal and the completion of all or most of the below-grade work, a new top slab would be put in place which would include hatches for access to the valve vault and wet well sides. The valve vault stairs and sump pump system would also be replaced as part of Alternative 2. The new controls for the station would be housed in a purpose-built prefabricated building placed adjacent to the station. The portable generator would be connected similarly to its current setup, with the addition of a larger pad and a shelter structure as included in Alternative 1. Depending on the exact final configuration of the valve vault in Alternative 2 and how it is accessed, it is likely that ventilation of the area would be required meaning the installation of new HVAC equipment would be included in construction. Name: Lift Station 3 Feasibility Study Date: March 11, 2021 Page: 9 Alternative 2 is, of the three considered in this report, likely the most complex and expensive to construct. A significant amount of piping reconfiguration and other work inside the existing station would be required, and flow would need to be bypassed around the station throughout construction. It is the least likely of the alternatives to be chosen to construct and as such a detailed cost estimate for Alternative 2 was not assembled. Alternative 3 – Relocate and Replace with Submersible Lift Station Alternative 3 comprises replacing the existing station in its entirety with a new submersible wet well/valve vault station in a slightly different location. Major components include: • Construct new duplex submersible lift station with precast wet well and valve vault • Furnish and install new prefabricated lift station controls building • Construct new generator pad and shelter structure • Demolish existing lift station building, bury and abandon remainder of structure This option would utilize a completely new submersible station which would meet all current design standards and practices. New submersible pumps would be installed in the wet well while the valve vault would contain all valves, the flow meters, and a configuration for bypassing. Hatches would be cast into both structure lids and would include safety grating. As with the previous alternative, controls would be housed in a prefabricated building that would be set adjacent to the station. The mobile generator would be stationed on a new concrete pad with a shelter above and surrounded by a privacy fence. Alternative 3 would allow the majority of construction to take place with the existing station remaining in service. After the new station is constructed and in service the existing station building would be demolished and the underground portions of the stations filled and abandoned. This alternative would also include some underground piping replacement and replacement of at least a portion of the driveway. Table 2, below, presents construction cost estimates for Alternative 3. Name: Lift Station 3 Feasibility Study Date: March 11, 2021 Page: 10 Table 2 – Alternative 3 Cost Estimates Mobilization $40,000 Demolition/Removals $60,000 Grading/Site Work/Driveway $20,000 New Lift Station Structures $290,000 Piping/Valves/Flow Meters $45,000 Coatings $7,000 Submersible Pumps $70,000 Mechanical/HVAC $80,000 Electrical & Controls (Prefab. Building) $100,000 Generator Shelter/Pad/Fence $25,000 Bypass Pumping $8,000 Construction Subtotal $665,000 Contingencies (20%) $135,000 Construction Total $800,000 Engineering (15%) $120,000 Total $920,000 Summary The existing lift station needs upgrades and repairs and this memo details two main options for improving the lift station. Alternative 1 is keeping the station as a wet-well/dry well station while making upgrades to comply with electrical codes issues (explosion proof) and updating the building mechanicals and structure. This option will also have additional long-term maintenance (HVAC, roof, building structure, etc.) than alternative 3. However, Alternative 1 does have the lower initial capital cost. Alternative 3 replaces the existing station with a submersible lift station and valve vault. Alternative 3 is the higher capital cost option but would have lower lifetime maintenance costs. Removing the building also would provide for an opportunity to redesign the site. April 8, 2021 Mr. Ross Bintner, PE Engineering Services Manager RBintner@EdinaMN.gov RE: SCOPE AND FEE: Lift Station 3 Improvements City of Edina, Minnesota Dear Mr. Bintner, Bolton & Menk, Inc. is pleased to present this scope and fee letter to you for professional engineering services in support of the city’s Lift Station 3 Improvements project. This scope and fee letter is based off the Feasibility Study memo dated March 11, 2021. As a part of this letter, we describe our understanding of the project, detail our proposed scope of work, and provide our fees for service. This letter is being offered as a Supplemental Agreement to our June 18, 2013 Master Agreement for Professional Engineering Services with the City of Edina. PROJECT UNDERSTANDING Lift Station 3 is in need of rehabilitation. The lift station was originally constructed in 1959 as a wet well/dry well station with a building at the surface. The dry well side of the station contains two Flygt dry pit submersible pumps, each capable of pumping 750 gallons per minute, which were installed in the late 1980s. Due to the age of the lift station structure, building, pumps, valves and piping, extensive improvements are needed. The Feasibility Study evaluated three different options for completing the improvements to Lift Station 3. Alternative 3 was selected and includes demolition of the existing lift station structure and building and construction of a new submersible lift station at a different location on the site. This alternative also includes a building for the electrical controls and a structure covering the portable generator. Rehabilitation of Lift Station 3 is included in the City’s CIP and programed for bidding in 2021. The City of Edina has requested this scope and fee letter from Bolton & Menk to complete the design/bidding and construction phase services for this project. SCOPE OF WORK We have identified two (2) tasks to complete the work as described above. A summary of the tasks is described below. Task 1 – Final Design/Bidding Phase • Topographic survey • Geotechnical evaluation (BMI to coordinate, City to pay directly) • Hazardous materials survey (BMI to coordinate, City to pay directly) • Prepare final plans and specifications Proposal: Lift Station 3 – Final Design/Bidding Date: April 8, 2021 Page: 2 • Design review meetings with City staff • Construction cost estimates • Assist with State and local agency reviews and permitting (We do not anticipate any permits are required from the MPCA or the MCES since this is an existing lift station) • Bidding services Task 2 – Construction Phase Services • Construction Staking • Construction Observation • Contract Administration • Record Drawings PROPOSED FEES Bolton & Menk proposes to complete the Final Design/Bidding Phase services for the Lift Station 3 improvements for an hourly not to exceed fee of $56,950. Because the engineer has no direct control over the scheduling or operations of the project contractor, construction phase services described in this proposal are proposed to be provided on an hourly basis. Rates for construction staking, observation and administration will vary based on expertise of specific personnel assigned to the project and will follow our attached Schedule of Fees. We do not believe that any permits are required from the MPCA or MCES for this project. However, if any permits are required, the permit application fees shall be the responsibility of the City. Thank you, for allowing us the opportunity to prepare this scope and fee letter for you. If you find it satisfactory, your signature will constitute acceptance of the terms outlined and your authority for us to proceed. Please call if you wish to discuss this letter. We look forward to providing these professional engineering services to you on this project and appreciate your consideration of Bolton & Menk, Inc. Sincerely, Bolton & Menk, Inc. Seth A. Peterson, P.E. Sarah E. Lloyd, P.E. Principal Environmental Engineer Principal Engineer Signed Date Printed Name Submitted by Bolton & Menk, Inc. 1 2021 SCHEDULE OF FEES The following fee schedule is based upon competent, responsible professional services and is the minimum, below which adequate professional standards cannot be maintained. It is, therefore, to the advantage of both the professional and the client that fees be commensurate with the service rendered. Charges are based on hours spent at hourly rates in effect for the individuals performing the work. The hourly rates for principals and members of the staff vary according to skill and experience. The current specific billing rate for any individual can be provided upon request. The fee schedule shall apply for the period through December 31, 2021. These rates may be adjusted annually thereafter to account for changed labor costs, inflation, or changed overhead conditions. These rates include labor, general business, and other normal and customary expenses associated with operating a professional business. Unless otherwise agreed, the above rates include vehicle and personal expenses, mileage, telephone, survey stakes, and routine expendable supplies; no separate charges will be made for these activities and materials. Expenses beyond the agreed scope of services and non-routine expenses, such as large quantities of prints, extra report copies, outsourced graphics and photographic reproductions, document recording fees, outside professional and technical assistance, and other items of this general nature will be invoiced separately. Rates and charges do not include sales tax, if applicable. Employee Classification Hourly Billing Rates Senior Principal $230-290/Hour Principal Engineer/Surveyor/Planner/GIS/Landscape Architect $150-225 Senior Engineer/Surveyor/Planner/GIS/Landscape Architect $130-220 Project Manager (Inc. Survey, GIS, Landscape Architect)$130-215 Project Engineer/Surveyor/Planner/Landscape Architect $70-185 Design Engineer/Landscape Designer/Graduate Engineer/Surveyor $90-190 Specialist (Nat. Resources; GIS; Traffic; Graphics; Other)$70-175 Senior Technician (Inc. Construction, GIS, Survey1)$90-180 Technician (Inc. Construction, GIS, Survey1)$65-160 Administrative/Corporate Specialists $60-140 Structural/Electrical/Mechanical/Architect $120-175 GPS/Robotic Survey Equipment NO CHARGE CAD/Computer Usage NO CHARGE Routine Office Supplies NO CHARGE Routine Photo Copying/Reproduction NO CHARGE Field Supplies/Survey Stakes & Equipment NO CHARGE Mileage NO CHARGE 1 No separate charges will be made for GPS or robotic total stations on Bolton & Menk, Inc. survey assignments; the cost of this equipment is included in the rates for Survey Technicians. Date: April 20, 2021 Agenda Item #: VI.F. To:Mayor and City Council Item Type: Request For Purchase From:Noah Silver, Electrical/HVAC Supervisor Item Activity: Subject:Request for Purchase: Braemar Arena Dehumidification System Replacement Action CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: Approve Request for Purchase for Braemar Arena Dehumidification System Replacement with Northern Air Corporation for $292,600 at the Braemar Arena South Rink. INTRODUCTION: The existing dehumidification unit servicing Braemar Arena South Rink needs replacement due to system age and failure. Design and construction documents were developed under contract with Nelson-Rudie & Associates. An advertisement for bid was published on March, 18 and the opening of bids occurred on April 8. Northern Air Corporation (NAC) provided the lowest bid of three received per the design and construction specifications. Staff is recommending the approval of NAC's bid for replacement of the dehumidification system. ATTACHMENTS: Description Request for Purchase: Braemar Arena Dehumidification System Replacement Bid Results Contract Request for Purchase Requisition Number 1 CITY OF EDINA 4801 W 50th St., Edina, MN 55424 www.EdinaMN.gov | 952-927-8861 12100084 Department:Engineering Buyer:Noah Silver Date: 04/12/2021 Requisition Description:Braemar Arena Dehumidification System Replacement Vendor:NORTHERN AIR CORPORATION Cost:$292,600.00 REPLACEMENT or NEW:REPLACEM - REPLACEMENT PURCHASE SOURCE:QUOTE/BD - QUOTE/BID DESCRIPTION: The existing dehumidification unit servicing Braemar Arena South Rink needs replacement due to system age and failure. A temporary unit has been rented to keep the facility operational until this project can be completed. Design and construction documents were developed under contract with Nelson-Rudie & Associates. An advertisement for bid was published on March18th and the opening of bids occurred on April 8th. Northern Air Corporation (NAC) provided the lowest bid of three received per the design and construction specifications. BUDGET IMPACT: Funded from CIP No. ENG21064 Environmental Impact - item specific: 2 COMMUNITY IMPACT: Braemar Arena is a regionally significant ice complex serving a variety of users. The south arena can't be lost for any extended amount of time. The dehumidification system has failed and a temporary unit has been rented to keep the facility operational until this project can be completed. ENVIRONMENTAL IMPACT: Sustainability metrics were discussed during the design phase of the project. A sustainability analysis will be completed to document improvements to the facility and reductions in energy use with these upgrades of equipment. Vehicle - Make/Model/Year requested vehicle: Vehicle - Make/Model/Year current vehicle (if replacement): Vehicle - Does purchase meet Green Fleet Recommendations? - Vehicle - If does not meet Green Fleet Recommendations, justification: - MPG: Carbon Emissions: BRAEMAR ICE ARENA DEHUMIDIFICATION UPGRADE (#7666255) Owner: Edina MN, City ofSolicitor: Edina MN, City of 04/08/2021 02:00 PM CDT Section Title Item Description UofM Quantity Unit Price Extension Unit Price Extension Unit Price Extension Base Bid $289,900.00 $324,900.00 $329,000.00Dehumidification Upgrades LS 1 $289,900.00 $289,900.00 $324,900.00 $324,900.00 $329,000.00 $329,000.00 Alternate 1 $1,600.00 $6,300.00 $5,339.00 Bi-Polar Ionization Air Cleaning LS 1 $1,600.00 $1,600.00 $6,300.00 $6,300.00 $5,339.00 $5,339.00Alternate 2 $1,100.00 $960.00 $515.00 Installation and Service of Temporary DHU Unit and LS 1 $1,100.00 $1,100.00 $960.00 $960.00 $515.00 $515.00Base Bid Total:$289,900.00 $324,900.00 $329,000.00 Base Bid + Alternate 1 and 2 Total $292,600.00 $332,160.00 $334,854.00 PETERSON SHEET METALPioneer Power, Inc.Northern Air Corp APRIL 2018 D-1 IB CONTRACT NO FC 20-17 THIS AGREEMENT made this 20th day of April 2021, by and between the CITY OF EDINA, a Minnesota municipal corporation (“City”) and Northern Air Corporation (NAC) (“Contractor”). City and Contractor, in consideration of the mutual covenants set forth herein, agree as follows: 1. CONTRACT DOCUMENTS. The following documents shall be referred to as the “Contract Documents,” all of which shall be taken together as a whole as the contract between the parties as if they were set verbatim and in full herein: A. This Agreement. B. Instructions to Bidders. C. City of Edina General Contract Conditions. D. Addenda numbers #1-April 2nd, 2021; #2- April 5th, 2021 E. Specifications prepared by Nelson Rudie & Associates Inc. F. Plan sheets numbered; M0, A100, ME1, MES2 G. Performance Bond. H. Payment Bond. I. Responsible Contractor Verification of Compliance J. Contractor’s bid dated April 8th, 2021 including Alternates 1 & 2 K. Scope of Work The Contractor at a minimum shall provide the following services: Provide services to maintain temporary dehumidification unit (DHU) during term of contract. Unit must remain operational at all times of construction and commissioning. City to provide rental of unit and initial connections and start-up. Disconnect and shut down by contractor at conclusion of project. Provide services to remove existing DHU and associated controls and devices. This includes all electrical, mechanical, gas and hydronic connections. Any portion not being reused shall be terminated and capped back to nearest connection point at main. Provide & install new DHU unit and associated controls, power, ductwork, supports, penetrations, and patch-back and misc. equipment removal and sitework to support new DHU installation and start-up. New unit controls are to be compatible with Tridium Niagara 4 and connected into building automation system. Provide support and service during start-up and 3rd party commissioning and testing procedures. Building is occupied and will be in-use throughout duration of construction. Contractor shall make necessary precautions and arrangements to limit disruptions to service throughout project. Alt. #1—Bi-Polar Ionization is accepted and part of contract. Alt. #2—temporary unit start-up and mobilization is accepted and part of contract. APRIL 2018 D-2 IB Upon execution of contract, contractor shall procure submittals for DHU and send to architect for review. After approval contractor shall furnish confirmation of order and anticipated delivery date to architect. Any minor changes in the work resulting in additional cost to be approved City prior to payment. See section 1.2 for further details The Contract Documents are to be read and interpreted as a whole. The intent of the Contract Documents is to include all items necessary for the proper execution and completion of the Work and to require Contractor to provide the highest quality and greatest quantity consistent with the Contract Documents. If there are inconsistencies within or among part of the Contract Documents or between the Contract Documents and applicable standards, codes or ordinances, the Contractor shall provide the better quality or greater quantity of Work or comply with the more stringent requirements. 1.1 Before ordering any materials or doing any Work, the Contractor shall verify measurements at the Project site and shall be responsible for the correctness of such measurements. No extra charges or compensation will be allowed on account of differences between actual dimensions and the dimensions indicated on the Drawings. Any difference that may be found shall be submitted to the City for resolution before proceeding with the Work. 1.2 If a minor change in the Work is necessary due to actual field conditions, the Contractor shall submit detailed drawings of such departure to the City for approval before making the change. The City shall not be required to make any adjustment to either the Contract Sum or Contract Time because of any failure by the Contractor to comply with the requirements of this paragraph. Actual or alleged conflicts or inconsistencies between the Plans and Specifications or other Contract Documents shall be brought to the City’s attention in writing, prior to performing the affected Work. The City’s directions shall be followed by the Contractor. 2. OBLIGATIONS OF THE CONTRACTOR. The Contractor shall provide the goods, services, and perform the work in accordance with the Contract Documents. 3. OBLIGATIONS OF THE CITY. The City agrees to pay, and the Contractor agrees to receive and accept payment in accordance with the Contractor’s bid $292,600.00 4. PAYMENT PROCEDURES. A. Contractor shall submit Applications for Payment. Applications for Payment will be processed by City as provided in the General Conditions. B. Progress Payments; Retainage. City shall make 95% progress payments on account of the Contract Price on the basis of Contractor’s Applications for Payment during performance of the Work. C. Payments to Subcontractor. (1) Prompt Payment to Subcontractors. Pursuant to Minn. Stat. § 471.25, Subd. 4a, the Contractor must pay any subcontractor within ten (10) days of the Contractor’s receipt of payment from the City for undisputed services provided by the subcontractor. The Contractor must pay interest of 1½ percent per month or any part of a month to the subcontractor on any undisputed amount not paid on time to the subcontractor. The minimum monthly interest penalty payment for an unpaid balance of $100.00 or more is $10.00. For an unpaid balance of less than $100.00, the Contractor shall pay the actual penalty due to the subcontractor. (2) Form IC-134 required from general contractor. Minn. Stat. § 290.92 requires that the City of Edina obtain a Withholding Affidavit for Contractors, Form IC-134, before making final payments to Contractors. This form needs to be submitted by the Contractor to the Minnesota Department of Revenue for approval. APRIL 2018 D-3 IB The form is used to receive certification from the state that the vendor has complied with the requirement to withhold and remit state withholding taxes for employee salaries paid. D. Final Payment. Upon final completion of the Work, City shall pay the remainder of the Contract Price as recommended by City. 5. COMPLETION DATE. The Work must be completed and ready for final payment by October 1st, 2021. 6. CONTRACTOR’S REPRESENTATIONS. A. Contractor has examined and carefully studied the Contract Documents and other related data identified in the Contract Documents. B. Contractor has visited the Site and become familiar with and is satisfied as to the general, local, and Site conditions that may affect cost, progress, and performance of the Work. C. Contractor is familiar with and is satisfied as to all federal, state, and local Laws and Regulations that may affect cost, progress, and performance of the Work. D. Contractor has carefully studied all: (1) reports of explorations and tests of subsurface conditions at or contiguous to the Site and all drawings of physical conditions in or relating to existing surface or subsurface structures at or contiguous to the Site (except Underground Facilities) which have been identified in the General Conditions; and (2) reports and drawings of a Hazardous Environmental Condition, if any, at the Site. E. Contractor has obtained and carefully studied (or assumes responsibility for doing so) all additional or supplementary examinations, investigations, explorations, tests, studies, and data concerning conditions (surface, subsurface, and underground facilities) at or contiguous to the Site which may affect cost, progress, or performance of the Work or which relate to any aspect of the means, methods, techniques, sequences, and procedures of construction to be employed by Contractor, including any specific means, methods, techniques, sequences, and procedures of construction expressly required by the Bidding Documents, and safety precautions and programs incident thereto. F. Contractor does not consider that any further examinations, investigations, explorations, tests, studies, or data are necessary for the performance of the Work at the Contract Price, within the Contract Times, and in accordance with the other terms and conditions of the Contract Documents. G. Contractor is aware of the general nature of work to be performed by City and others at the Site that relates to the Work as indicated in the Contract Documents. H. Contractor has correlated the information known to Contractor, information and observations obtained from visits to the Site, reports and drawings identified in the Contract Documents, and all additional examinations, investigations, explorations, tests, studies, and data with the Contract Documents. I. Contractor has given City written notice of all conflicts, errors, ambiguities, or discrepancies that Contractor has discovered in the Contract Documents, and the written resolution thereof by City is acceptable to Contractor. J. The Contract Documents are generally sufficient to indicate and convey understanding of all terms and conditions for performance and furnishing of the Work. K. Subcontracts: APRIL 2018 D-4 IB (1) Unless otherwise specified in the Contract Documents, the Contractor shall, upon receipt of the executed Contract Documents, submit in writing to the City the names of the subcontractors proposed for the work. Subcontractors may not be changed except at the request or with the consent of the City. (2) The Contractor is responsible to the City for the acts and omissions of the Contractor's subcontractors, and of their direct and indirect employees, to the same extent as the Contractor is responsible for the acts and omissions of the Contractor's employees. (3) The Contract Documents shall not be construed as creating any contractual relation between the City and any subcontractor. (4) The Contractor shall bind every subcontractor by the terms of the Contract Documents. 7. WARRANTY. The Contractor guarantees that all new equipment warranties as specified within the bid shall be in full force and transferred to the City upon payment by the City. The Contractor shall be held responsible for any and all defects in workmanship, materials, and equipment which may develop in any part of the contracted service, and upon proper notification by the City shall immediately replace, without cost to the City, any such faulty part or parts and damage done by reason of the same in accordance with the bid specifications. 8. INDEMNITY. The Contractor agrees to indemnify and hold the City harmless from any claim made by third parties as a result of the services performed by it. In addition, the Contractor shall reimburse the City for any cost of reasonable attorney’s fees it may incur as a result of any such claims. 9. MISCELLANEOUS. A. Terms used in this Agreement have the meanings stated in the General Conditions. B. City and Contractor each binds itself, its partners, successors, assigns and legal representatives to the other party hereto, its partners, successors, assigns and legal representatives in respect to all covenants, agreements, and obligations contained in the Contract Documents. C. Any provision or part of the Contract Documents held to be void or unenforceable under any Law or Regulation shall be deemed stricken, and all remaining provisions shall continue to be valid and binding upon City and Contractor, who agree that the Contract Documents shall be reformed to replace such stricken provision or part thereof with a valid and enforceable provision that comes as close as possible to expressing the intention of the stricken provisions. D. Data Practices/Records. (1) All data created, collected, received, maintained or disseminated for any purpose in the course of this Contract is governed by the Minnesota Government Data Practices Act, Minn. Stat. Ch. 13, any other applicable state statute, or any state rules adopted to implement the act, as well as federal regulations on data privacy. (2) All books, records, documents and accounting procedures and practices to the Contractor and its subcontractors, if any, relative to this Contract are subject to examination by the City. E. Copyright/Patent. Contractor shall defend actions or claims charging infringement of any copyright or patent by reason of the use or adoption of any designs, drawings or specifications supplied by it, and it shall hold harmless the City from loss or damage resulting there from. If the equipment provided by the Contractor pursuant to this Agreement contains software, including that which the manufacturer may have embedded into the hardware as an integral part of the equipment, the Contractor shall pay all software licensing fees. The Contractor shall also pay for all software updating fees for a period of one year following cutover. The Contractor shall have no obligation to pay for such fees thereafter. Nothing in the software license or licensing agreement shall obligate the City to pay any additional fees as a condition for continuing to use the software. APRIL 2018 D-5 IB F. Assignment. Neither party may assign, sublet, or transfer any interest or obligation in this Agreement without the prior written consent of the other party, and then only upon such terms and conditions as both parties may agree to and set forth in writing. G. Waiver. In the particular event that either party shall at any time or times waive any breach of this Agreement by the other, such waiver shall not constitute a waiver of any other or any succeeding breach of this Agreement by either party, whether of the same or any other covenant, condition or obligation. H. Governing Law/Venue. The laws of the State of Minnesota govern the interpretation of this Agreement. In the event of litigation, the exclusive venue shall be in the District Court of the State of Minnesota for Hennepin County. I. Severability. If any provision, term or condition of this Agreement is found to be or becomes unenforceable or invalid, it shall not affect the remaining provisions, terms and conditions of this Agreement, unless such invalid or unenforceable provision, term or condition renders this Agreement impossible to perform. Such remaining terms and conditions of the Agreement shall continue in full force and effect and shall continue to operate as the parties’ entire agreement. J. Entire Agreement. This Agreement represents the entire agreement of the parties and is a final, complete and all inclusive statement of the terms thereof, and supersedes and terminates any prior agreement(s), understandings or written or verbal representations made between the parties with respect thereto. K. Permits and Licenses; Rights-of-Way and Easements. The Contractor shall procure all permits and licenses, pay all charges and fees therefore, and give all notices necessary and incidental to the construction and completion of the Project. The City will obtain all necessary rights-of-way and easements. The Contractor shall not be entitled to any additional compensation for any construction delay resulting from the City’s not timely obtaining rights-of-way or easements. L. If the work is delayed or the sequencing of work is altered because of the action or inaction of the City, the Contractor shall be allowed a time extension to complete the work but shall not be entitled to any other compensation. M. Responsible Contractor. This contract may be terminated by the City at any time upon discovery by the City that the prime contractor or subcontractor has submitted a false statement under oath verifying compliance with any of the minimum criteria set forth in Minn Stat. § 16C.285, subd. 3. CITY OF EDINA CONTRACTOR BY: ____________________________ BY: ____________________________ Its Mayor Its AND AND ___________________________ Its City Manager Its Date: April 20, 2021 Agenda Item #: VI.G. To:Mayor and City Council Item Type: Report / Recommendation From:MJ Lamon, Community Engagement Coordinator Item Activity: Subject:Ordinance No. 2021-02: Amending Chapter 2 of the City Code Boards, Committees and Commissions Action CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: Approve Ordinance No. 2021-02 amending Chapter 2 of the City Code Boards, Committees and Commissions and grant second reading. INTRODUCTION: Staff has reviewed City Code Generally section of Article III related to Boards & Commissions and provided recommended changes. ATTACHMENTS: Description Ordinance No. 2021-02: Amending Chapter 2 of the City Code Boards, Committees and Commissions Staff Memo from Jan. 5, 2021 City Council Work Session ORDINANCE NO. 2021-02 AN ORDINANCE AMENDING CHAPTER 2 OF THE EDINA CITY CODE CONCERNING BOARDS, COMMITTEES AND COMMISSIONS THE CITY COUNCIL OF EDINA ORDAINS: Page 1 of 5 Section 1. Chapter 2, Article III, of the Edina City Code is amended by adding the following provisions: Sec. 2-78. Establishment. (a) Authority to establish. Pursuant to Minn. Stats. § 412.621, and other such statutes as are specifically cited herein, the council establishes or continues the following boards and commissions to advise the council with respect to municipal functions and activities and to investigate subjects of interest to the city. (b) How established. A board or commission may be established by a majority vote of the council. An ordinance shall be adopted prescribing the purpose, duties and composition of the board or commission. (c) Subject to provisions in this chapter. All boards and commissions established by the council shall be subject to the provisions of this chapter, unless otherwise specified in city ordinance or state law. (d) Purposes and duties generally. All boards and commissions established by the council shall be advisory to the council and shall have the responsibility to: (1) Investigate matters within the scope of the particular board or commission or as specifically directed by the council. (2) Advise the council by communicating the viewpoint or advice of the board or commission. (3) At the direction of the council, hold hearings, receive evidence, conduct investigations, and, on the basis of such hearings, evidence and investigations, make decisions and recommendations to the council. (e) Advisory role. A board or commission established by the council shall not assume the role of an administrative or legislative body. (Code 1970; Code 1992, § 1500.01; Ord. No. 162, 4-4-1974; Ord. No. 162-A1, 3-6-1975; Ord. No. 162-A2, § 180, 5- 16-1990; Ord. No. 2007-21, 1-2-2008; Ord. No. 2009-7, 5-5-2009; Ord. No. 2011-02, 2-10-2011; Ord. No. 2011-14, 8-4-2011; Ord. No. 2012-06, 2-21-2012) Sec. 2-79. Cooperation of city officials subject to direction of city manager. The City Mmanager may make available city staff members to perform administrative duties and records management on behalf of the board or commission. record and prepare minutes of board and commission meetings. Such staff members shall perform only such clerical duties on behalf of a board or commission as provided in the bylaws of that board or commission or as assigned by the chairperson with the consent of the manager. The manager may assign additional staff to assist a board or commission. (Code 1970; Code 1992, § 1500.02; Ord. No. 162, 4-4-1974; Ord. No. 162-A1, 3-6-1975; Ord. No. 162-A2, § 180, 5- 16-1990; Ord. No. 2007-21, 1-2-2008; Ord. No. 2009-7, 5-5-2009; Ord. No. 2011-02, 2-10-2011; Ord. No. 2011-14, 8-4-2011; Ord. No. 2012-06, 2-21-2012) Created: 2021-03-11 12:41:06 [EST] (Supp. No. 11) Page 2 of 5 Sec. 2-80. Membership. (a) Regular members. Regular members of boards and commissions established by the council shall be adult residents of the city unless otherwise expressly stated by ordinance. Members who discontinue legal residency in the city shall automatically be deemed to have resigned from the board or commission office as of the date of such discontinuance. (b) Student members. Student members shall be residents of the city or officially open enrolled as a student at Edina High School and entering sophomore, junior or senior year. Student members shall be nonvoting. (1) Until September 1, 2021, each commission may have up to three student members and two thereafter. (Code 1970; Code 1992, § 1500.03; Ord. No. 162, 4-4-1974; Ord. No. 162-A1, 3-6-1975; Ord. No. 162-A2, § 180, 5- 16-1990; Ord. No. 2007-21, 1-2-2008; Ord. No. 2009-7, 5-5-2009; Ord. No. 2011-02, 2-10-2011; Ord. No. 2011-14, 8-4-2011; Ord. No. 2012-06, 2-21-2012; Ord. No. 2015-11 , § 1, 8-5-2015; Ord. No. 2018-8 , § 1, 6-5-2018; Ord. No. 2020-12 , § 1, 8-18-2020) Sec. 2-81. Appointment and terms of membership. (a) Regular members. Commission members shall be appointed by majority vote of the council. Members of Arts and Culture Commission, Edina Community Health Commission, Energy and Environment Commission, Construction Board of Appeals, Heritage Preservation Commission, Human Rights and Relations Commission, Park Commission, Transportation Commission, and Board of Appeal and Equalization are eligible to serve two, three-year terms. Members of the Pplanning Ccommission are eligible to serve three, three-year terms. A member in good standing shall serve until a successor has been appointed. (b) Student members. Student members shall be appointed by majority vote of the council and serve in one-year terms. are eligible to serve two, one-year terms. (c) Resignation and removal. Members shall serve without compensation and may resign voluntarily by letter or e-mail to the city manager or designee or be removed by majority vote of the council or pursuant to Ssection 2-80 or 2-86. (d) Vacancies. Vacancies in membership may be filled by majority vote of the council for the balance of the unexpired term. (e) Term of appointment to fill vacancy. A person appointed to fill a vacancy shall be eligible to serve term limits as defined in paragraph (a) in addition to the balance of the unexpired term. (f) No concurrent membership. No person may serve concurrently on more than one board or commission. (g) Staggered terms. Terms of membership shall be staggered so that no more than one-half of the terms on a board or commission expire in any particular year. (h) Change in board or commission appointment. All uninterrupted board or commission service will count towards the term limit of the current position, (i) Total term limits. Regular members who complete the defined term limits in paragraph (a) are ineligible to serve on any board or commission for one year. (Code 1970; Code 1992, § 1500.04; Ord. No. 162, 4-4-1974; Ord. No. 162-A1, 3-6-1975; Ord. No. 162-A2, § 180, 5- 16-1990; Ord. No. 2007-21, 1-2-2008; Ord. No. 2009-7, 5-5-2009; Ord. No. 2011-02, 2-10-2011; Ord. No. 2011-14, 8-4-2011; Ord. No. 2012-06, 2-21-2012; Ord. No. 2015-11 , § 1, 8-5-2015; Ord. No. 2015-24 , § 2, 12-1-2015; Ord. No. 2017-01 , § 1, 3-7-2017) Created: 2021-03-11 12:41:06 [EST] (Supp. No. 11) Page 3 of 5 Sec. 2-82. Subcommittees and Working Groups. subcommittees. (a) Establishment. A board or commission may, with specific approval of the council or pursuant to its bylaws, establish committees, subcommittees, committees of the whole or working groups. that include members of the board or commission and additional persons as requested by the board or commission. (b) Composition. Subcommittees are comprised of board or commission members only. Working groups are comprised of board or commission members in addition to public members. Neither subcommittees or working groups may include a number board or commissioner members equal to or greater than the number sufficient to constitute a quorum of that board or commission. (b) (c) Prohibition. A committee, subcommittee, committee of the whole or working group may not engage in activities, functions, or duties outside the scope of authority granted to the board or commission by which it was established. (Code 1970; Code 1992, § 1500.05; Ord. No. 162, 4-4-1974; Ord. No. 162-A1, 3-6-1975; Ord. No. 162-A2, § 180, 5- 16-1990; Ord. No. 2007-21, 1-2-2008; Ord. No. 2009-7, 5-5-2009; Ord. No. 2011-02, 2-10-2011; Ord. No. 2011-14, 8-4-2011; Ord. No. 2012-06, 2-21-2012) Sec. 2-83. Officers Organization and bylaws. (a) Bylaws. Each board or commission will be governed by such bylaws as approved by the city council. (b) (a) Chairperson and vice-chairperson. Each board or commission annually shall elect from its members a chairperson and vice-chairperson to serve a term of one year. No person shall serve more than three consecutive one-year terms as chairperson of a particular board or commission. A chairperson elected to fill a vacancy shall be eligible to serve three full terms in addition to the remainder of the vacated term. There are no term limits for the position of vice-chairperson. (Code 1970; Code 1992, § 1500.06; Ord. No. 162, 4-4-1974; Ord. No. 162-A1, 3-6-1975; Ord. No. 162-A2, § 180, 5- 16-1990; Ord. No. 2007-21, 1-2-2008; Ord. No. 2009-7, 5-5-2009; Ord. No. 2011-02, 2-10-2011; Ord. No. 2011-14, 8-4-2011; Ord. No. 2012-06, 2-21-2012; Ord. No. 2015-11 , § 1, 8-5-2015; Ord. No. 2017-01 , § 2, 3-7-2017) Sec. 2-84. Time, location and types conduct of meetings. (a) Regular meetings. All board and commission meetings are open meetings subject to the Minnesota Open Meeting Law (Minn. Stats. ch. 13D) and shall be held at a fixed time, on a fixed date and in a fixed place as shall be determined by the board or commission. The city clerk shall give notice of all board and commission meetings as required for meetings of public bodies. A regular scheduled meeting may be rescheduled by a majority vote at a prior meeting. (b) Special meetings. Special meetings can be called by the chair, City Council, City Manager or by a majority vote of members. Notice of special meetings must conform to the Minnesota Open Meeting Law. Public comment. All board and commission meetings shall include scheduled time for public comment. (c) Quorum. A simple majority of voting members, appointed and serving, shall constitute a quorum for any regular or special meeting. If a quorum is not established or maintained during the course of a meeting, no votes on board or commission business may be taken except a motion to adjourn or recess. (d) Meetings conducted according to bylaws. All meetings shall be conducted according to the bylaws of the board or commission. Page 4 of 5 (Code 1970; Code 1992, § 1500.07; Ord. No. 162, 4-4-1974; Ord. No. 162-A1, 3-6-1975; Ord. No. 162-A2, § 180, 5- 16-1990; Ord. No. 2007-21, 1-2-2008; Ord. No. 2009-7, 5-5-2009; Ord. No. 2011-02, 2-10-2011; Ord. No. 2011-14, 8-4-2011; Ord. No. 2012-06, 2-21-2012) Sec. 2-85. Meeting minutes. (a) Official record. Approved minutes of board or commission proceedings shall be public record; the city shall retain a copy of the official minutes of each board or commission meeting in accordance with applicable state law. (b) Recording. The City Manager may make available a city staff member to serve as a meeting minutes recorder. A board or commission may appoint from its membership a secretary to record and prepare meeting minutes. Minutes so recorded Recorded minutes shall be reviewed and approved by the board or commission. and a copy forwarded to the city clerk. In the alternative, the manager may make available to the board or commission a member of city staff to serve as secretary to record and prepare meeting minutes. (c) Distributed to city council. Official minutes of each board or commission meeting shall be distributed to the council prior to the first regular council meeting after approval of the minutes by the board or commission. (Code 1970; Code 1992, § 1500.08; Ord. No. 162, 4-4-1974; Ord. No. 162-A1, 3-6-1975; Ord. No. 162-A2, § 180, 5- 16-1990; Ord. No. 2007-21, 1-2-2008; Ord. No. 2009-7, 5-5-2009; Ord. No. 2011-02, 2-10-2011; Ord. No. 2011-14, 8-4-2011; Ord. No. 2012-06, 2-21-2012) Sec. 2-86. Attendance requirements. (a) Purpose. To assist boards and commissions in fulfilling their purposes and duties and to ensure that they are not prevented from doing so by the repeated absence of their members, the council hereby establishes an attendance policy for members serving on boards and commissions. (b) Removal. Any member of a board or commission established by the council shall be deemed to have resigned as a member of the board or commission under the following circumstances: (1) The regular member fails to attend is absent from three consecutive regular meetings, or for a regular member of the planning commission fails to attend is absent from four consecutive regular meetings. (2) The regular member fails to does not attend at least 75 percent of the regular scheduled meetings in any calendar year, not including the joint work sessions with the council. For a regular member, whose term begins during a calendar year, attendance in that calendar year is measured as at least 75 percent of the scheduled meetings following the beginning of the member's term. (c) Exceptions. (1) The requirements of this subsection shall not apply to attendance at special meetings, or of meetings of subcommittees or working groups. subcommittees, including committees of the whole, established by a board or commission pursuant to section 2-82. (2) The requirements of this subsection shall not apply to members of the housing and redevelopment authority of the city, the East Edina Housing Foundation or the city council. (d) Annual review. The council shall conduct an annual review of the attendance of members of boards and commissions established by the council. (e) Vacancies. The successor to any member of a board or commission who has been removed pursuant to this subsection shall be appointed pursuant to section 2-81. Page 5 of 5 (Code 1970; Code 1992, § 1500.09; Ord. No. 162, 4-4-1974; Ord. No. 162-A1, 3-6-1975; Ord. No. 162-A2, § 180, 5- 16-1990; Ord. No. 2007-21, 1-2-2008; Ord. No. 2009-7, 5-5-2009; Ord. No. 2011-02, 2-10-2011; Ord. No. 2011-14, 8-4-2011; Ord. No. 2012-06, 2-21-2012; 2014-12 , § 1, 8-19-2014; Ord. No. 2017-01 , § 3, 3-7-2017; Ord. No. 2018- 03 , §§ 1, 2, 2-21-2018) Secs. 2-87—2-115. Reserved. This ordinance is effective upon adoption. First Reading: April 6, 2021 Second Reading: April 20,2021 Published: ATTEST: _________________________________ _________________________________ Sharon Allison, City Clerk James B. Hovland, Mayor Please publish in the Edina Sun Current on: Send one affidavit of publication Bill to Edina City Clerk City of Edina • 4801 W. 50th St. • Edina, MN 55424 Administration Department Advisory Boards & Commissions Date: January 5, 2021 To: Mayor & City Council From: MJ Lamon, Community Engagement Coordinator Subject: Boards and Commissions: Governing Documents Governing Documents Advisory Boards and Commissions currently have several governing documents: including City Code, Bylaws, and other policies and procedures. These documents contain duplicate information and / or conflict with one another. This makes it difficult to communicate, navigate and update procedures. Current Documents City Code City code contains the collection of ordinances that have the full force and effect of law. Edina’s city code establishes Edina’s 10 Advisory Boards and Commissions and requirements. By-laws By-laws are not legally required and are similar in purpose to policies and procedures. The City’s by-laws currently define the commission structure. Board and Commission bylaws were revamped in 2013 to ensure there was consistency across all boards and commissions individual bylaws. By- laws encompass some board and commission procedures and cite several sections of City Code. Policies and Procedures The City has numerous policies and procedures that apply to boards and commissions. In 2016, handbooks were created for commission members and staff to navigate board and commission roles, requirements, and procedures more easily. Staff updates these documents at least annually. Recommendation Staff is reviewing City Code, By-laws, and policies for updates needed. Staff will recommend changes to avoid duplication and make these documents easier to use. Staff will recommend that Council: 1. Rescind Bylaws and as appropriate revise City Code & Policies to include necessary content from bylaws 2. Direct staff to continue to update and maintain policies and procedures, and bring to Council for discussion as needed Staff will bring the proposed City Code and by-law changes to a future council meeting for approval. Date: April 20, 2021 Agenda Item #: VI.H. To:Mayor and City Council Item Type: Request For Purchase From:Brian Olson, Director of Public Works Item Activity: Subject:Request for Purchase: 2021 Commodities Action CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: Approve Request for Purchase for 2021 Commodities from multiple vendors. INTRODUCTION: This purchase approval is for unit pricing of bituminous material, concrete, water treatment chemicals, cover and castings, retaining wall repair and concrete removal and replacement. See attached Quote Tabulation for unit pricing. ATTACHMENTS: Description Request for Purchase: 2021 Commodities 2021 Commodities City of Edina • 4801 W. 50th St. • Edina, MN 55424 Request for Purchase Date: April 20, 2021 To: Mayor and City Council From: Brian Olson, Director of Public Works Subject: Request for Purchase: 2021 Commodities Purchase Subject to: ☒List Quote/Bid ☐State Contract ☐Service Contract The Recommended Bid is: ☒Within Budget ☐Not Within Budget 2021 pricing increased 1.6% for concrete, 50% for water treatment chemicals, 5.9% for covers and castings, 6.9% for retaining wall repair, and 8.2% for concrete removal and replacement. Ready Mix Bituminous materials decreased -0.8%. Date Bid Opened or Quote Received: Bid or expiration Date: April 12, 2021 May 12, 2021 Company: Amount of Quote or Bid: Various – See attached Quote Tabulation Recommended Quote or Bid: Page 2 City of Edina • 4801 W. 50th St. • Edina, MN 55424 Request for Purchase Department Director Authorization: ________________________________________ City Council Authorization Date: ______________________ (for purchases over $20,000 only) Budget Impact • Funding Source – Utility and Public Works Operating Budgets Environmental Impact • N/A Community Impact • Purchase supports residents, working population and visitors who use City infrastructure and services. QUOTE FORM CITY OF EDINA 2021 COMMODITIES NAME OF SUPPLIERS NO. PRODUCT DESCRIPTION BID ITEM DELIVERED BID ITEM PICKED UP BID ITEM 1 READY MIX BITUMINOUS MATERIALS 1a (SPNWB330B) MnDOT Non-Wear Spec No. 2360 1a n/a 1a $48.00/ton Approximately 6000 Tons 1b (SPWEA340B) MnDOT Wear Spec No. 2360 1b n/a 1b $49.75/ton Approximately 10,000 Tons 1c (SPWEB340B) MnDOT Wear Spec No. 2360 1c n/a 1c $50.75/ton Approximately 10,000 Tons 1 READY MIX BITUMINOUS MATERIALS 1a (SPNWB330B) MnDOT Non-Wear Spec No. 2360 1a n/a 1a $44.20/ton Approximately 6000 Tons 1b (SPWEA340B) MnDOT Wear Spec No. 2360 1b n/a 1b $47.25/ton Approximately 10,000 Tons 1c (SPWEB340B) MnDOT Wear Spec No. 2360 1c n/a 1c $47.25/ton Approximately 10,000 Tons 1 READY MIX BITUMINOUS MATERIALS EP - Picked Up B'ville 1a (SPNWB330B) MnDOT Non-Wear Spec No. 2360 1a $43.70/ton 1a $41.60/ton Approximately 6000 Tons 1b (SPWEA340B) MnDOT Wear Spec No. 2360 1b $46.95/ton 1b $44.95/ton Approximately 10,000 Tons 1c (SPWEB340B) MnDOT Wear Spec No. 2360 1c $44.55/ton 1c $41.65/ton Approximately 10,000 Tons 2 CONCRETE Type 3F52F - 3900 lbs Approximately 200 cu yd 2a $140.00/c.y. Approximately 400 cu yd 2b $118.00/c.y. 2 CONCRETE Approximately 200 cu yd 2a $138.00/c.y. Approximately 400 cu yd 2b $119.00/c.y. 3 HYDROFLUOSILICIC ACID Delivery to all City pump house locations. Bulk delivery to 140 gal containers Approximately 123,000 lbs Producer Approximately 123,000 lbs 3 $38.00/cwt Producer PCS 4 LIQUID CHLORINE 150# Cylinders Approximately 130,000 lbs/year Delivery to all City pump house locations Approximately 130,000 lbs/year 4 $61.33/cwtDelivery to all City pump house locations 5 POLYPHOSPHATE ORTHO-PHOSPHATE BLEND WATER TREATMENT CHEMICAL - 50/50 BLEND Bulk delivery to all City pump house locations Approximately 9,800 Gallons Producer CARUS Approximately 9,800 Gallons 5 $7.84/gal Producer HAWKINS 6 TONKAZORB 3% Hydrolyzed Manganese Oxide Bulk delivery to Water Treatment Plant No. 3 and Water Treatment Plant No. 4 HAWKINS Approximately 11,000 Gallons 6 $14.67/gal 7 Ammonium Sulfate Bulk delivery to Water Treatment Plant No.6 HAWKINS Approximately 1,500 Gallons 7 $10.49/gal 8 COVERS AND CASTINGS Complete Casting & Lid Casting Only Lid Only A Sanitary Sewer - R1733 with self sealing solid cover or approved equal.8a1 $294.00/ea 8a2 $150.00/ea 8a3 $144.00/ea B Storm Sewer - Round lid R2390 or approved equal.8a1 $368.00/ea 8b2 $179.00/ea 8b3 $189.00/ea C Storm Sewer - Rectangular 3067V (no lettering) or approved equal.8c1 $431.00/ea 8c2 $195.00/ea 8c3 $139.00/ea D Cost of curb box 8d $113.00/ea 9 RETAINING WALL REPAIR Time and Labor 9 $30.85/sq. ft. COMMERCIAL ASPHALT BITUMINOUS ROADWAYS HAWKINS HAWKINS HAWKINS ESS Blackstone CS MCCROSSAN AVR Cemstone 1 QUOTE FORM CITY OF EDINA 2021 COMMODITIES NAME OF SUPPLIERS NO. PRODUCT DESCRIPTION BID ITEM DELIVERED BID ITEM PICKED UP BID ITEM 10 CONCRETE REMOVAL & REPLACEMENT 10 Curb and Guttter Flatwork 4"Flatwork 6" PLEASE NOTE: No. 3,4 & 5 will be a tied bid and awarded together. Recommend accepting bid $10.00/sq. ft. $14.00/sq. ft. No Quote No Quote No Quote No. 8A, B & C will be a tied bid and awarded together. Award based on complete casting and cover. Approximately 300 covers and castings will be in the Curbmasters No Quote No Quote No Quote $42.00/ln. ft.All Around Concrete Ti -Zack 2 Date: April 20, 2021 Agenda Item #: VI.I. To:Mayor and City Council Item Type: Request For Purchase From:Dave Goergen, Public Works Coordinator Item Activity: Subject:Request for Purchase: Fiber Optic Installation to Water Treatment Plant No. 3 Action CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: Approve Request for Purchase for fiber optic installation to Water Treatment P lant (WTP ) No. 3 with Castrejon for $65,300 and LOGIS for $24,592. INTRODUCTION: This purchase is for the installation of fiber optic to WTP 3. See attached Request for P urchase. ATTACHMENTS: Description Request for Purchase: Fiber Optic Installation to WTP 3 Request for Purchase Requisition Number 1 CITY OF EDINA 4801 W 50th St., Edina, MN 55424 www.EdinaMN.gov | 952-927-8861 12100079 Department:Public Works Buyer:Dave Goergen Date: 04/01/2021 Requisition Description:Water Treatment Plant (WTP) 3 Fiber Installation Vendor:CASTREJON INC Cost:$89,892.00 REPLACEMENT or NEW:NEW - NEW PURCHASE SOURCE:QUOTE/BD - QUOTE/BID DESCRIPTION:Fiber optic to WTP 3 to improve security and reliability. BUDGET IMPACT: Approved CIP - Utility Fund Environmental Impact - item specific: 2 COMMUNITY IMPACT:Improves security and reliability of essential infrastructure. ENVIRONMENTAL IMPACT:N/A Vehicle - Make/Model/Year requested vehicle: Vehicle - Make/Model/Year current vehicle (if replacement): Vehicle - Does purchase meet Green Fleet Recommendations? - Vehicle - If does not meet Green Fleet Recommendations, justification: - MPG: Carbon Emissions: Date: April 20, 2021 Agenda Item #: VI.J. To:Mayor and City Council Item Type: Report / Recommendation From:Sharon Allison, City Clerk Item Activity: Subject:Resolution No. 2021-36: Accepting Donations Action CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: Approve Resolution No. 2021-36 accepting donations. INTRODUCTION: To comply with State Statute, all donations to the City must be accepted by resolution and approved by two- thirds majority of the Council. See attached resolution with list of donations. ATTACHMENTS: Description Resolution No. 2021-36: Accepting Donations RESOLUTION NO. 2021-36 ACCEPTING DONATIONS ON BEHALF OF THE CITY OF EDINA WHEREAS, Minnesota Statute 465.03 allows cities to accept grants and donations of real or personal property for the benefit of its citizens; WHEREAS, said donations must be accepted via a resolution of the Council adopted by a two thirds majority of its members. NOW, THEREFORE, BE IT RESOLVED, that the Edina City Council accepts with sincere appreciation the following listed grants and donations on behalf of its citizens. Parks & Recreation • Pacy Erck $1,000 Memorial/Honor Garden • Pacy Erck $1,000 Memorial Fund Dated: April 20, 2021 Attest: Sharon Allison, City Clerk James B. Hovland, Mayor STATE OF MINNESOTA ) COUNTY OF HENNEPIN) SS CITY OF EDINA ) CERTIFICATE OF CITY CLERK I, the undersigned duly appointed and acting City Clerk for the City of Edina do hereby certify that the attached and foregoing Resolution was duly adopted by the Edina City Council at its Regular Meeting of April 20, 2021, and as recorded in the Minutes of said Regular Meeting. WITNESS my hand and seal of said City this _______ day of ___________________, 2021. City Clerk Date: April 20, 2021 Agenda Item #: VII.A. To:Mayor and City Council Item Type: Report / Recommendation From:Jeff Siems, Interim Fire Chief, & David Fisher, Chief Building Official Item Activity: Subject:Proclamation: Building Safety Month Action CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: Adopt proclamation declaring the month of May 2021, Building Safety Month. INTRODUCTION: This year’s theme is “Prevent, Prepare, Protect, Building Codes Save lives. “ Prevent, Prepare, Protect. Building Codes Save,” the theme for Building Safety Month 2021, encourages all Americans to raise awareness about the importance of safe and resilient construction; fire prevention; disaster mitigation; energy conservation; water safety; training the next generation; and new technologies in the construction industry. ATTACHMENTS: Description Proclamation: Building Safety Month Staff Report Building Safety Month May 2021 Proclamation April 20, 2021 Mayor and City Council Jeff Siems, Interim Fire Chief & David Fisher, Chief Building Official Proclamation: Building Safety Month Information / Background: The proclamation for May of 2021, as Building Safety Month, demonstrates our commitment to building safety and fire prevention in our community. This year’s theme is “Prevent, Prepare, Protect, Building Codes Save” Building Safety Month is a public awareness campaign to help individuals, families and businesses understand what it takes to create safe and sustainable structures. The campaign reinforces the need for adoption of modern, model building codes, a strong and efficient system of code enforcement and a well-trained, professional workforce to maintain the system. The campaign is presented by the International Code Council and its 64,000 members worldwide along with a diverse partnership of professionals from the building construction, design and safety community. Corporations, government agencies, professional associations, nonprofits and more come together to support Building Safety Month because they understand the need for safe and sustainable structures where we live, work and play. Our department is using Building Safety Month to educate the community. It is an opportunity to increase public awareness of the role building safety and fire prevention officials, local and state building departments and federal agencies play to protect lives and property. They are the “silent defenders” who are seldom seen but work daily to ensure safety in the built environment. Proclamation Building Safety Month May 2021 WHEREAS, our City of Edina is committed to recognizing that our growth and strength depends on the safety and economic value of the homes, buildings and infrastructure that serve our citizens, both in everyday life and in times of natural disaster, and; WHEREAS, our confidence in the structural integrity of these buildings that make up our community is achieved through the devotion of vigilant guardians––such as building safety and fire prevention officials and others in the construction industry––who work year-round to ensure the safe construction of buildings, and; WHEREAS, these guardians are dedicated members of the International Code Council, that are experts in the built environment to create and implement the highest-quality codes to protect us in the buildings where we live, learn, work, play, and; WHEREAS, these modern building codes include safeguards to protect the public from natural disasters such as hurricanes, snowstorms, tornadoes, wildland fires, floods and earthquake, and; WHEREAS, Building Safety Month is sponsored by the International Code Council to remind the public about the critical role of our communities’ largely unknown protectors of public safety – our local code officials – who assure us of safe, sustainable, energy efficient and livable buildings that are essential to America’s prosperity, and; WHEREAS, “ Prevent, Prepare, Protect. Building Codes Save,” the theme for Building Safety Month 2021, encourages all Americans to raise awareness about the importance of safe and resilient construction; fire prevention; disaster mitigation; energy conservation; water safety; training the next generation; and new technologies in the construction industry. WHEREAS, each year, in observance of Building Safety Month, people all over the world are asked to consider the commitment to improve building safety and to acknowledge the essential service provided to all of us by local and state building departments, fire prevention bureaus and federal agencies in protecting lives and property. NOW, THEREFORE, the City Council of the City of Edina, MN, hereby proclaim the month of May 2021, as Building Safety Month In the City of Edina, MN, accordingly, encourage our citizens to join with their communities in participation in Building Safety Month activities. _________________________________ James B. Hovland, Mayor Date: April 20, 2021 Agenda Item #: VII.B. To:Mayor and City Council Item Type: Report / Recommendation From:Luther Overholt, City Forester Item Activity: Subject:Proclamation: Arbor Day Action CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: Adopt Proclamation declaring April 30, 2021 Arbor Day. INTRODUCTION: Arbor Day is a holiday that originated in Nebraska City, Nebraska by J. Sterling Morton, to encourage the planting and caring for trees. The first Arbor Day was held on April 10, 1872, and an estimated one million trees were planted that day. Many countries now observe a similar holiday. T hough usually observed in the spring, the date varies, depending on climate and suitable planting season. Edina will recognize Arbor Day by planting trees at Fred Richards Park. The tree planting will take place on Friday, April 30 at 10 a.m. Staff will be planting 10 new trees as preemptive replacements for ash trees that will be lost at the park. In lieu of our regular celebration we will be having a virtual Arbor Day on Facebook Live. ATTACHMENTS: Description Proclamation Arbor Day 2021 PROCLAMATION ARBOR DAY APRIL 30, 2021 WHEREAS, in 1872, J. Sterling Morton proposed to the Nebraska Board of Agriculture that a special day be set aside for the planting of trees, and WHEREAS, this holiday, called Arbor Day, was first observed with the planting of more than a million trees in Nebraska, and WHEREAS, forest soils prevent flooding and reduce storm water by capturing and storing rainwater and snowmelt, which is then slowly released to our lakes, streams and groundwater; and WHEREAS, trees and forests improve our physical health by cleaning the air, reducing exposure to the sun’s UV rays and decreasing temperatures during the summertime; and WHEREAS, One tree provides $62,000 worth of pollution control over a period of 50 years; and WHEREAS, trees can reduce the erosion of our precious topsoil by wind and water, cut heating and cooling costs, moderate the temperature, clean the air, produce life-giving oxygen, and provide habitat for wildlife, and WHEREAS, forests create high-quality drinking water by acting as a natural filter; and WHEREAS, Edina is proud of the beautiful shade trees which grace our homes and public places; and NOW, THEREFORE, the City Council of the City of Edina, MN, hereby proclaim April 30, 2021, as Arbor Day In the City of Edina, MN, and call upon the spirited and foresighted citizens of Edina to plant trees now for our pleasure and that of future generations. Dated this 20th day of April 2021. _________________________________ James B. Hovland, Mayor Date: April 20, 2021 Agenda Item #: VII.C. To:Mayor and City Council Item Type: Report / Recommendation From:Heidi Lee, Race & Equity Coordinator Item Activity: Subject:Racial Restrictive Covenants Update Information CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: None. INTRODUCTION: Staff will provide an update about participating in the Just Deeds P roject and denouncing racially restrictive covenants in Edina. Date: April 20, 2021 Agenda Item #: VIII.A. To:Mayor and City Council Item Type: Report / Recommendation From:Andrew Scipioni, Transportation Planner Item Activity: Subject:Approve Travel Demand Management Policy Action CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: Approve Travel Demand Management Policy. INTRODUCTION: As part of their 2019 work plans, the Transportation and Planning Commissions formed a cross-commission committee to develop a Travel Demand Management (TDM) policy or ordinance for the City of Edina. T he committee presented a draft ordinance to City Council at their April 7, 2020 work session. Based on feedback received by Council at the work session, staff prepared a TDM policy. T his policy was reviewed by the Transportation Commission at their December 17, 2020 regular meeting and the Planning Commission at their March 10, 2021 regular meeting. See attached staff report and supporting materials. ATTACHMENTS: Description Staff Report: Travel Demand Management Policy Travel Demand Management Policy ETC/PC Draft TDM Ordinance CC April 7, 2020 Work Session Minutes ETC December 17, 2020 Meeting Minutes PC March 10, 2021 Meeting Minutes City of Edina • 4801 W. 50th St. • Edina, MN 55424 City of Edina • 4801 W. 50th St. • Edina, MN 55424 April 20, 2021 Mayor and City Council Andrew Scipioni, Transportation Planner Travel Demand Management Policy Approve the Travel Demand Management Policy as recommended by staff. Information / Background: As stated in the Transportation Chapter of the 2018 Comprehensive Plan, the primary emphasis of travel demand management (TDM) is to reduce the number of vehicular trips on congested roadways during peak travel times. Strategies that promote TDM may include pedestrian and bicycle infrastructure, utilization of transit service, car/vanpooling, shared mobility and telecommuting. Cities may require TDM plans for new developments if they are large enough to have significant traffic impacts. As part of their 2019 work plans, the Transportation and Planning Commissions formed a cross-commission committee to develop a Travel Demand Management policy or ordinance for the City of Edina. The committee presented a draft ordinance to City Council at their April 7, 2020 work session. The draft ordinance recommended thresholds for applicability, required plan components, and methods for administration and compliance. Based on feedback received by Council at the work session, staff prepared a TDM policy and presented a draft to the Transportation Commission at their December 17, 2020 regular meeting and to the Planning Commission at their March 10, 2021 regular meeting. Differences between Commission and Staff Recommendations While the cross-commission committee proposed an ordinance, Council expressed a desire to start with a policy. Council and staff noted that a policy would allow the City to adjust their TDM approach if needed and could be adopted as an ordinance in the future if so desired. The applicability thresholds between the two recommendations are identical with the exception that the draft policy grants Council discretion to require a TDM plan even when the requirement thresholds are not met. Other changes made to the draft policy include removal of the required three-year TDM plan, TDM plan agreement and financial guarantee. Additionally, administration of TDM plans is recommended to fall under the authority of the City Engineer rather than the Community Development Director. If approved, TDM plans will be required as part of traffic impact studies for new developments or redevelopments when applicable. REPORT / RECOMMENDATION Page 2 Attached: Draft TDM Policy Transportation/Planning Commission Draft TDM Ordinance Minutes of the April 7, 2020 City Council Work Session Minutes of the December 17, 2020 Transportation Commission meeting Minutes of the March 10, 2021 Planning Commission Meeting ☐City Council Approved: Click here to enter a date. ☒City-Wide Revised: Click here to enter a date. ☐Department City of Edina Policy Travel Demand Management Policy Purpose As stated in the Transportation Chapter of the 2018 Comprehensive Plan, the primary emphasis of travel demand management (TDM) is to reduce the number of vehicular trips on congested roadways during peak travel times. Strategies that promote TDM may include pedestrian and bicycle infrastructure, utilization of transit service, car/vanpooling, shared mobility and telecommuting. This policy will require developers to demonstrate that new projects are designed in ways that support TDM. Definitions 1. Gross floor area (GFA) – the sum of the horizontal areas of all the floors of a building as defined in Section 36-10 of the City’s Zoning Code. 2. Level of Service (LOS) – a qualitative measure of traffic operations related to the amount of average delay experienced by motorists, expressed in letter grades where A represents little-to-no delay and F represents excessive delays. 3. Single-occupancy vehicle (SOV) – a privately operated motor vehicle whose only occupant is the driver. 4. Traffic impact study (TIS) – a document that addresses the anticipated traffic impacts of a development/redevelopment and recommends mitigation options to eliminate or reduce negative impacts. 5. Volume-to-capacity (v/c) ratio – the number of vehicles traveling through an intersection or roadway segment in a specific amount of time divided by the expected capacity of the intersection or roadway. A roadway is typically considered to be congested when the V/C ratio is 0.8 or higher. Applicability The City of Edina currently requires developers proposing projects with the potential for significant traffic impacts to submit a traffic impact study (TIS) prepared by a qualified traffic consultant as part of the plan review and approval process. The thresholds currently in place to require such a study are projects that: • Increase existing site density (in terms of residential units or building square footage); • Require a parking stall variance; • Require rezoning or a Comprehensive Plan amendment; or • Are adjacent to an intersection operating at Level of Service (LOS) D or along a roadway operating at a volume-to-capacity (v/c) ratio of 0.8 or higher. As part of the traffic impact study, the City will require developers to submit a TDM plan. Recognizing development size and land use type directly affect automobile traffic congestion, the City has established two levels of TDM plan applicability: Page | 2 1. A Tier 1 TDM plan is required for developments/redevelopments which meet any of the following criteria: a. 50 or more residential units; b. 100 or more automobile parking stalls required by City Code; c. Flexibility sought from parking required by City Code; or d. Other development/redevelopment as required by Council condition. 2. A Tier 2 TDM plan is required for developments/redevelopments which meet any of the following criteria (provided a Tier 1 TDM program is not required): a. Over 5,000 square feet of gross floor area; b. 10 or more residential units; c. 20 or more automobile parking stalls required by City Code; or d. Other development/redevelopment as required by Council condition. TDM Plan Requirements 1. A Tier 1 TDM Plan shall include: a. Strategies, implementation measures and timeline. A minimum of five (5) unique strategies must be identified for implementation. b. Anticipated single-occupancy vehicle (SOV) trip reduction. c. Goals, including peak and total SOV trip reduction goals. d. Evaluation measures and process to track implementation and determine the effectiveness of the TDM strategies and progress toward achieving the SOV trip reduction goals. e. Proposed total expenditures to implement the TDM strategies. 2. A Tier 2 TDM Plan shall include: a. Strategies, implementation measures and timeline. A minimum of three (3) unique strategies must be identified for implementation. b. Proposed total expenditures to implement the TDM strategies. The TDM measures may include, but are not limited to; on-site transit facilities, preferential location for managed carpool and vanpool parking, telework, on-site bicycle, scooter and pedestrian facilities and financial incentives. Measures that are otherwise required by City Code shall not count towards a project’s required TDM strategies (e.g., minimum bicycle parking, pedestrian and bicycle facilities identified in comprehensive plans). Administration The TDM plan must be approved by the City Engineer or the Engineer’s designee prior to granting a building permit. Prior to obtaining a Certificate of Occupancy, the building owner must demonstrate that all structural components of the approved TDM plan have been implemented (e.g., pedestrian/bicycle infrastructure, carpool priority parking stalls, shared mobility infrastructure, etc.). The City Engineer, or the Engineer’s designee will administer Tier 1 and Tier 2 TDM Plans, including, but not limited to: 1. Reviewing and approving of TDM plans. 2. Maintaining files for approved TDM plans. 3. Recommending approval for Certificates of Occupancy. 4. Approving any amendments after the TDM plan has been approved. 1 City of Edina Draft Transportation Demand Management (TDM) Ordinance 12/15/2019 Purpose and Intent The purpose of Transportation Demand Management (TDM) is to maximize the potential for alternatives to single occupancy vehicle (SOV) automobile transportation to reduce traffic congestion, mitigate the impact of auto emissions on the environment, and promote health. TDM is a combination of information, services, resources, incentives, facilities and actions that promote alternatives to SOV automobile trips. The intent of this ordinance is to ensure that new developments and redevelopments are designed in ways to support TDM. Applicability Recognizing development size and land use type directly affect automobile traffic congestion, the City has established two levels of TDM program applicability: A Tier 1 TDM program is required for all new developments and redevelopments consisting of: 1. Developments where the City Code requires the provision of more than 100 automobile parking spaces. 2. Redevelopments where the resulting number of automobile parking spaces is more than 100. 3. Mixed use or multi-family residential housing developments greater than 50 units. 4. Developments or redevelopments seeking flexibility from the standard City Code parking requirements. A Tier 2 TDM program is required for: 1. Developments and redevelopments with over 5,000 square feet in floor area, provided a Tier 1 TDM program is not required. 2. Developments and redevelopments consisting of 10 or more residential units or where City Code requires 20 or more parking spaces, provided a Tier 1 TDM program is not required. TDM Plan Requirements Mandatory TDM plan requirements for the two levels are as follows: Tier 1 TDM Programs shall include: 2 1. A TDM study prepared by a qualified traffic consultant that includes: a. The projected transportation and parking impacts of the development at full site development, forecasts of SOV trips generated and the likely timing of those trips, and anticipated parking demand. The traffic study must be conducted in accordance with accepted methodology approved by the Community Development Director or the Director’s designee. The traffic study must be prepared by an independent traffic engineering professional, selected by the City, under the supervision of the Community Development Director or the Director’s designee, and paid for by the applicant. b. Impact of other planned developments in the area consistent with the Comprehensive Plan and approved Small Area Plans. 2. A Three-Year TDM plan, prepared by the property owner in the format specified in the TDM Policies and Procedures Document maintained by the Community Development Director or otherwise in a format approved by the Director or the Director’s designee, describing: a. Goals, including peak and total SOV trip reduction goals. b. Strategies, implementation measures, and timeline. The TDM measures may include, but are not limited to, on-site transit facilities, preferential location for managed carpool and vanpool parking, telework, on-site bicycle, scooter and pedestrian facilities and financial incentives. c. Anticipated SOV trip reduction d. Compliance with Edina Code of Ordinances Sec. 36 – 1274 to provide off-street bicycle parking and other required elements. e. Evaluation measures and process to track implementation and determine the effectiveness of the TDM strategies and progress toward achieving the SOV trip reduction goals. f. Proposed total expenditures to implement the TDM strategies. 3. A TDM plan agreement prepared by the City Attorney’s office, executed by the property owner and the City, and filed by the property owner with the records for that property in the Registrar of Title’s or Recorder’s Office of Hennepin County with proof thereof presented to the issuing Authority prior to issuance of a building permit. 4. A Financial Guarantee in the amount established by the TDM ordinance based on the scope of the project. 5. Periodic status updates, as required by the City (at least annually) in the format specified in the TDM Policies and Procedures Document maintained by the Community Development Director, or otherwise approved by the Director or the Director’s designee, hereinafter referred to as the “Annual Status Report”. 3 Tier 2 TDM Program shall include: 1. A TDM Plan describing: a. Goals, including SOV trip reduction goals. b. Strategies, implementation measures, and timeline. c. Compliance with Edina Code of Ordinances Sec. 36 – 1274 to provide off-street bicycle parking and other required elements. Tier 1 TDM Plan Financial Guarantee To ensure compliance, when a Tier 1 TDM Plan is required, the property owner shall provide a financial guarantee prior to the issuance of the Certificate of Occupancy. 1. The financial guarantee rate will be $100 per parking space for new developments and $100 per added parking space for redevelopments. The financial guarantee may be provided in the form of cash, bond or letter of credit at the discretion of the City. 2. The City will retain the cash payment, bond, or letter of credit for three years from the date of issuance of the Certificate of Occupancy. This date shall hereinafter be referred to as the “TDM Plan Implementation Date”. Administration Prior to granting a building permit there must be an approved TDM plan. Prior to granting a Certificate of Occupancy the building owner must demonstrate that they have complied with any structural elements of the TDM Plan required prior to occupancy unless an extension has been granted at the discretion of the Community Development Director. The Community Development Director, or the Director’s designee will administer Tier 1 and Tier 2 TDM Plans, including, but not limited to: 1. Reviewing and approving of TDM plans. 2. Maintaining files for approved TDM plans. 3. Recommending approval for Certificates of Occupancy. 4. Monitoring progress toward implementation of TDM strategies and evaluating success of efforts to achieve TDM plan goals. 5. Approving any amendments after the TDM plan has been approved. 6. Determining compliance in implementing a Tier 1 TDM plan as this relates to the release or forfeiture of financial guarantees. 7. Holding and releasing TDM financial guarantees for Tier 1 TDM Plans. 4 Compliance Tier 1 A property owner or its successors and assigns must: 1. Demonstrate compliance with the TDM Plan’s building and site structural elements and a good faith effort to implement administrative and behavioral strategies described in an approved TDM Plan. 2. Provide a TDM Annual Status Report within 30 days of the one-year, two-year and three-year anniversary dates of the TDM Plan Implementation Date (or more frequently if required by the City). The Annual Status Report must include at least the following: 1. Documentation of the implementation of TDM strategies listed in the approved TDM Plan. 2. Documentation of annual expenditures made to implement TDM strategies. 3. An evaluation of the success of planned strategies based on the measures in the approved TDM plan or on alternative measures proposed by the owner and approved at the discretion of the Community Development Director. Tier 2 A property owner or its successors and assigns must: 1. Demonstrate compliance with the TDM Plan’s building and site structural elements and a good faith effort to implement administrative and behavioral strategies described in an approved Tier 2 TDM Plan. Release of the Tier 1 TDM Plan Financial Guarantee The financial guarantee, less 10% retained as administrative fees, will be returned after three years (or any extension granted) if the TDM program has, in the opinion of the Community Development Director or designee, been successfully implemented. The Community Development Director will also have the discretion to release a portion of the financial guarantee once structural elements have been completed and may extend the term of a Tier 1 TDM Plan for up to one year. The TDM financial guarantee will be released to the property owner within 10 working days once released by the Community Development Director or the Director’s designee. Forfeiture of the Tier 1 TDM Financial Guarantee 5 Failure to comply with the provisions of an approved Tier 1 TDM Plan after three years (or after any extension granted) constitutes a violation of this Section of the City Code. The following may, at the discretion of the Community Development Director, be considered a failure to comply: (1) Not satisfactorily implementing the TDM Plan’s building and site structural elements. (2) Failure to submit timely Annual Status Reports. (3) Not demonstrating a good faith effort to implement the approved TDM Plan strategies set forth in their approved Tier 1 TDM Plan. If the Community Development Director, or the Director’s designee, determines during the review of the Annual Status Reports that the failure to implement the elements of the TDM Plan is attributable to a lack of good faith effort on the part of the property owner, or its successors and assigns, the financial guarantee will be immediately forfeited to the City. Forfeited financial guarantees, less the 10% administrative fee, shall be distributed to Pedestrian and Cyclist Safety Fund. MINUTES OF THE WORK SESSION OF THE EDINA CITY COUNCIL VIRTUAL MEETING APRIL 7, 2020 5:30 P.M. Mayor Hovland called the meeting to order at 5:43 p.m. ROLL CALL Answering roll call were Members Anderson, Brindle, Fischer and Staunton and Mayor Hovland. Staff in attendance: Scott Neal, City Manager; Chad Millner, Engineering Director; Jennifer Bennerotte, Communications Director; Andrew Scipioni, Transportation Planner; Cary Teague, Community Development Director; Ryan Browning, IT Director; Jennifer Garske, Executive Assistant; Sharon Allison, City Clerk. TRAVEL DEMAND MANAGEMENT (TDM) ORDINANCE RECOMMENDATION Transportation Planner Andrew Scipioni explained that the TDM ordinance recommendation was on the Transportation (ETC) and Planning (PC) Commissions’ 2019 work plan. ETC’s commissioner Bruce McCarthy discussed the work of the cross-commission which was to review TDM options and recommend a TDM policy or ordinance. McCarthy discussed the work of the cross-commission, key features of the draft ordinance which included commercial, mixed used and residential developments, and redevelopments on a two-tier scale requirement based on parking spaces, units, and square foot in floor area. Committee members Bruce McCarthy (ETC) and Lou Miranda (PC) answered questions of the City Council related to developers’ feedback and the pros and cons of having a policy versus an ordinance. Kirk Johnson (ETC Vice-Chair, committee member) and Ian Nemerov (PC) were also in attendance. ADJOURNMENT Mayor Hovland adjourned the meeting at 6:43 p.m. Respectfully Submitted, __________________________________________ Sharon Allison, City Clerk Minutes approved by the Edina City Council April 21, 2020. __________________________________________ James B. Hovland, Mayor Draft Minutes☐ Approved Minutes☒ Approved Date: January 21, 2021 Minutes City Of Edina, Minnesota Transportation Commission WebEx December 17, 2020 I. Call To Order Chair Richman called the meeting to order at 6:03 p.m. II. Roll Call Answering roll call were Commissioners Ahler, Johnson, Kane, Lafferty, McCarthy, Richman, Atri, Clark, Khariwala. Absent: Commissioners Plumb-Smith, Scherer Staff present: Transportation Planner Andrew Scipioni III. Approval Of Meeting Agenda Motion was made by Commissioner Ahler and seconded by Commissioner Kane to approve the agenda. All voted aye. Motion carried. IV. Approval Of Meeting Minutes Motion was made by Commissioner Lafferty and seconded by Commissioner Ahler approving the November 19, 2020 meeting minutes. All voted aye. Motion carried. V. Reports/Recommendations A. Draft Local Speed Limit Public Engagement Report Staff Liaison Scipioni presented the draft public engagement report for the local speed limit evaluation. Comments from Commissioners included: • How many Better Together Edina users are verified residents of Edina? • Feedback submitted online may not be reflective of the entire population. • The recommended approach is not consistent with adjacent cities (Minneapolis and St. Louis Park). • Will the Edina Police Department enforce the new limits? • Are there plans to address France Avenue? • Would rather see funds spent on more sidewalks and bike lanes. • Staff report is based on examples from other cities that are not comparable to Edina. • Edina is known to be aggressive at pulling people over. This seems to be a mistake if there is not enforcement. • Cities that have made these types of changes have only seen incremental change. • Would like more opportunity for public input, given the ongoing pandemic and the low level of engagement thus far. Draft Minutes☐ Approved Minutes☒ Approved Date: January 21, 2021 B. Draft Travel Demand Management Policy Staff Liaison Scipioni presented the draft travel demand management policy. Comments from Commissioners included: • TDM strategies add costs to development projects, but some are already including strategies. • Policy doesn’t have any incentives, but developers have noted that this is where the market is moving. • Is the genesis of this initiative to reduce carbon emissions? • What impact does reducing speed limits have on congestion, if any? • Would be helpful for ETC to have access to the TDM plans for review. • ETC recommendation included financial guarantee similar to that of Bloomington. • Recommend including the annual report requirement, or somehow including that in a TDM pilot program. • Having evaluation measures to track over time would be helpful. • How would developers report/verify non-structural strategies? • Add language to allow City Engineer to approve based on the scale of the proposed project and current City goals. • TDM committee thought a point system was a great idea, but wasn’t sure how to implement. C. Draft Traffic Impact Study Policy Staff Liaison Scipioni presented the draft policy for the completion of traffic impact studies. Comments from Commissioners included: • Are there cases where a TDM plan would be required but not a TIS? • Has there been a trend to limit the number of required parking spots in the City? • Would like to see data collection methodology identified or best practices noted. • The City’s process for selecting, hiring and paying the TIS consultant should be included and the City should have the only say in selecting the TIS consultant. • Is it possible to have a tiered system of traffic studies, where larger projects require a larger study area? • Support considering adjacent developments in the studies. D. 2020 Work Plan Updates • #1 CloverRide – No update. • #2 Traffic Impact Studies – No update. • #3 Travel Demand Management – The Commission reviewed and commented on staff’s draft policy. • #4 TIS Framework – The Commission reviewed and commented on staff’s framework. • #5 Educational Activities– Complete. • #6 Traffic Safety Reports – No update. • #7 CIP/PACS – No update. Draft Minutes☐ Approved Minutes☒ Approved Date: January 21, 2021 VI. Chair and Member Comments A. Street Funding Task Force Update Commissioner Scherer was absent; no update was provided. Commissioner Ahler felt that staff’s recent review of the tree ordinance was not what the Commission expected and missed the Living Streets aspect. Ahler suggested that the Commission consider proposing an additional work plan initiative to City Council related to trees and Living Streets. Commissioner Johnson asked what is the perceived different in reduced speed to 25 or 20 mph? If uniformity was a driving force of the current staff recommendation, then it doesn’t make sense to go with a different default speed limit than bordering cities. Johnson felt that 20 mph speed limits are most appropriate for Edina and suggested that staff base decisions on available safety data. Commissioner Kane thanked Staff Liaison Scipioni for putting together the materials for tonight’s meeting and for being patient with the Commission. Commissioner Lafferty enjoyed the spirited discussion tonight, hearing everyone’s perspective and learning. Lafferty wished the rest of the Commissioners happy holidays. Commissioner Atri noted that the meeting discussion was much livelier than previous meetings. Commissioner Clark noted that the discussion tonight was entertaining to watch. Commissioner Khariwala said that tonight’s meeting was engaging and that he learned a lot. Commissioner Richman noted that the traffic signals at W 58th Street and France Avenue have been taken down and won’t be reinstalled until the spring. Richman expressed grave concerns about the temporary two-way stop, particularly for pedestrians and children. The Assistant City Engineer said that residents should use alternative access points on France Avenue, but there aren’t any. The Richfield Transportation Commission said that you need to push harder on the County to get what you want. Richman thanked the Commissioners for their great work this year and looks forward to a better 2021. VII. Staff Comments • City Council approved the Beard Avenue sidewalk as part of the Creek Knoll reconstruction project. Council also affirmed the W 56th Street sidewalk as part of the Melody Lake/ Grandview/Birchcrest project but delayed the final decision on the project for up to 6 months. • City Council approved the preliminary rezoning and overall development plan for 7001 France Avenue. • Metro Transit is scoping out a traffic analysis of France Avenue for the proposed E Line BRT. • Staff Liaison Scipioni shared some of the Commission’s 2020 accomplishments; o Tested North Loop of CloverRide o Reviewed traffic studies for 4500 France Avenue, 4425 Valley View Road, 6600 France Avenue and 7001 France Avenue Draft Minutes☐ Approved Minutes☒ Approved Date: January 21, 2021 o Proposed a travel demand management ordinance to City Council o Crafted social media posts for #TransportationTuesday o Reviewed 140 Traffic Safety Requests (including the Beard Avenue/W 57th Street all-way stop and the Interlachen Bluff No Outlet sign) o Commented on draft PACS equity criteria o Commented on 2021 roadway reconstruction projects o Participated in Street Funding Task Force o Obtained Council approval to study organized trash collection in 2021 VIII. Schedule of Meeting and Events as of December 11, 2020 For information purposes only, no discussion. IX. Adjournment Motion was made by Commissioner Johnson and seconded by Commissioner Lafferty to adjourn the December 17, 2020 meeting at 8:53 p.m. All voted aye. Motion Carried. TRANSPORTATION COMMISSION ATTENDANCE J F M A M J J A S O N D # of Mtgs Attendance % Meetings/Work Sessions 1 1 1 1 1 1 1 1 1 1 1 1 12 NAME Ahler, Mindy 1 1 1 1 1 1 1 1 1 1 1 11 92% Johnson, Kirk 1 1 1 1 1 1 1 1 1 1 10 83% Kane, Bocar 1 1 1 1 1 1 1 1 1 1 1 1 12 100% Lafferty, Peter 1 1 1 1 1 1 1 7 100% McCarthy, Bruce 1 1 1 1 1 1 1 1 1 1 1 11 92% Plumb-Smith, Jill 1 1 1 1 1 1 1 1 1 1 10 83% Richman, Lori 1 1 1 1 1 1 1 1 1 1 1 1 12 100% Scherer, Matthew 1 1 1 1 1 1 1 1 1 9 75% Atri, Nihar (s) 1 1 1 3 75% Clark, Anna (s) 1 1 1 1 4 100% Khariwala, Anand (s) 1 1 1 1 4 100% Olson, Larry 1 1 Term Expired 2 N/A Ruthruff, Erik 1 1 1 1 1 1 1 1 1 Resigned 9 N/A Erickson, Tayden (s) 1 1 1 1 1 1 1 Term Expired 7 N/A Venell, Simon (s) 1 1 1 1 1 Term Expired 5 N/A Draft Minutes☒ Approved Minutes☐ Approved Date: ___, 2021 Page 1 of 3 Minutes City Of Edina, Minnesota Planning Commission VIRTUAL MEETING March 10, 2021 I. Call To Order Chair Nemerov called the meeting to order at 7:00 PM. II. Roll Call Answering the roll call were: Commissioners Miranda, Berube, Strauss, Cullen, Bennett, Agnew, Bartling, Alkire and Chair Nemerov. Staff Present: Cary Teague, Community Development Director, Emily Bodeker, Assistant City Planner and Liz Olson, Administrative Support Specialist. Absent from the roll call: Commissioner Olsen. III. Approval Of Meeting Agenda Commissioner Berube moved to approve the March 10, 2021, agenda. Commissioner Miranda seconded the motion. Motion carried unanimously. IV. Approval Of Meeting Minutes A. Minutes: Planning Commission, February 24, 2021 Commissioner Miranda moved to approve the February 24, 2021, meeting minutes. Commissioner Agnew seconded the motion. Commissioner Agnew offered up the amendment to change wording in every motion to read, “Motion carried unanimously.” Motion carried unanimously as amended. V. Special Recognitions and Presentation A. Welcome New Planning Commissioners – David Alkire and Rachel Bartling Chair Nemerov introduced the two new Planning Commissioners. Commissioner Rachel Bartling provided a brief history to the Commission. Commissioner David Alkire provided a brief history to the Commission. B. Annual Elections Director Teague indicated the Planning Commission needed to elect a Chair, Vice-Chair and Secretary. Draft Minutes☒ Approved Minutes☐ Approved Date: ___, 2021 Page 2 of 3 Chair Nemerov opened the floor for nominations for Chair of the Commission. Commissioner Berube indicated she would be honored to nominate current Chair Nemerov. Commissioner Strauss seconded the nomination. Commissioner Berube moved to appoint Commissioner Nemerov as Chair of the Planning Commission. Commissioner Strauss seconded the motion. Motion carried unanimously. Chair Nemerov opened the floor for nominations for Vice-Chair of the Commission. Commissioner Berube indicated she has filled in as Vice-Chair since Commissioner Thorsen left the Commission. She stated she realized due to other commitments that someone else on the Commission would be a better Vice-Chair at this time. She nominated Commissioner Agnew for Vice-Chair. Commissioner Berube moved to appoint Commissioner Agnew as Vice-Chair of the Planning Commission. Commissioner Strauss seconded the motion. Motion carried unanimously. Chair Nemerov explained he received from the City an interest not to have secretaries on the Commissions. He asked Director Teague for direction. Director Teague indicated a specific decision has not been made on that yet, so he has been directed to have that position filled. Chair Nemerov opened the floor for nominations for Secretary of the Commission. Commissioner Bennett indicated he would step up as secretary of the Planning Commission. Commissioner Berube moved to appoint Commissioner Bennett Secretary of the Planning Commission. Commissioner Agnew seconded the motion. Motion carried unanimously. C. Draft Travel Demand Management Policy Transportation Planner Andrew Scipioni presented the Travel Demand Management Policy to the Commission. The Commission commented on the proposed TDM Policy. Video of the meeting is available on the City website for review of comments. VI. Public Hearings A. B-21-05, Side Yard Setback Variance – 6117 Chowen Ave S Assistant City Planner Bodeker presented the request of a side yard setback variance for 6117 Chowen Ave S. Staff recommends approval of the side yard setback variance, as requested subject to the findings and conditions listed in the staff report. Staff answered Commission questions. Draft Minutes☒ Approved Minutes☐ Approved Date: ___, 2021 Page 3 of 3 Appearing for the Applicant Mr. Neil Theison addressed the Planning Commission and answered Commission questions. Public Hearing None. Commissioner Berube moved to close the public hearing. Commissioner Agnew seconded the motion. Motion carried unanimously. The Commission discussed this item. Video of the meeting is available on the City website for review of comments. Motion Commissioner Berube moved that the Planning Commission recommend approval to the City Council of the Side Yard Setback Variance as outlined in the staff memo subject to the conditions and findings therein. Commissioner Agnew seconded the motion. Motion carried unanimously. VII. Chair and Member Comments Commissioner Bennett discussed the “Homes within Reach” campaign in Edina. Commissioner Miranda discussed ways working at home have changed people’s lives and how that affects transportation. He also discussed Transportation Demand Management (TDM) and how it relates to congestion reduction. Chair Nemerov indicated he received the annual feedback response from Commissioners and hoped to discuss them at the April Work Session. He also addressed the sketch plan review that the Commission reviewed a few months ago for the affordable housing development in the Valley View Wooddale District. Chair Nemerov commented on the public feedback process. VIII. Staff Comments Planner Teague updated the Commission on City Council actions that were before the Planning Commission. He noted the March 24th Planning Commission has been cancelled but there will be a joint Work Session with the City Council that evening. IX. Adjournment Commissioner Alkire moved to adjourn the March 10, 2021, Meeting of the Edina Planning Commission at 8:40 PM. Commissioner Bartling seconded the motion. Motion carried unanimously. Date: April 20, 2021 Agenda Item #: VIII.B. To:Mayor and City Council Item Type: Report / Recommendation From:Chad A. Millner, PE, Director of Engineering Item Activity: Subject:Resolution No. 2021-34: Melody Lake A&B, Grandview A, Birchcrest C Neighborhood Roadway Reconstruction, Improvement No. BA-457 Action CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: Approve Resolution No. 2021-34 ordering improvement for Melody Lake A & B, Grandview A, Birchcrest C Neighborhood Roadway Reconstruction Improvement No. BA-457. INTRODUCTION: No additional comments were received for the public hearing opened on April 6 and closed at noon on Monday, April 12 for 5100-5113 Grove Street. Staff analyzed the project and feels that the project is necessary, cost-effective, and feasible from an engineering standpoint. See the attached staff report and refer to council packets dated December 7, 2020, December 15, 2020, and April 6, 2021 for more information specific to the project. ATTACHMENTS: Description Staff Report Resolution No. 2021-34: Melody Lake A&B, Grandview A, Birchcrest C Neighborhood Roadway Reconstruction Improvement NO. BA-457 Engineering Study BA-457 Mailing Certification BA-457 Mailing Certification No. 2 BA-457 Staff Presentation 1 Staff Presentation 2 April 20, 2021 Mayor and City Council Chad A. Millner, P.E. Director of Engineering Resolution No. 2021-34: Melody Lake A & B, Grandview A, Birchcrest C Neighborhood Roadway Reconstruction Improvement No. BA-457 Executive Summary: Adopt Resolution No. 2021-34 and approve preliminary assessment of $17,200 per residential equivalency unit (REU) based on the assessment policy dated April 6, 2021 and bids received on March 25, 2021 for the referenced project. Information / Background Recall a public hearing was conducted on Dec. 7, 2020 and April 6, 2021 for the referenced project. The estimated assessment amount per REU was estimated at $24,200. There were concerns with the amount of the assessment. At the same time, the street funding task force was completing their work related to street reconstruction funding. As allowed by state statue, the council delayed a final decision on the preliminary assessment amount per REU for up to 6-months for staff to bring back more information. The street funding task force completed a street funding recommendation report and presented those findings to the council on March 2, 2021. The council considered those recommendations during a council retreat on March 13 and at a City Council Meeting on April 6. At the April 6 meeting, the City Council approved step one of the street funding task force recommendations. The revised assessment policy removed subcuts and public retaining walls from assessments related to the 2021 Street Reconstruction Projects. A decision on the preliminary assessments was delayed for up to 6-months for staff to being back more information. Staff completed the bidding documents and accepted bids. Seven bids were received as listed below. The engineers construction cost estimate was $12,200,000. STAFF REPORT Page 2 Company Amount of Bid Valley Paving, Inc. $10,536,643.19 Bituminous Roadways, Inc. $11,307,043,54 GMH Asphalt Corporation $11,331,323.75 McNamara Contracting $11,832,821.01 Park Construction Company $11,900,886.16 Geislinger & Sons $12,479,552.40 Meter Contracting, Inc. $13,301,674.56 Cost Comparison Table (includes indirect costs for finance, engineering, administration, and contingency) CIP Project Cost Estimate Preliminary Engineering Report Project Cost Estimate Low Bid Project Cost Estimate $14,493,000 $16,400,000 $12,910,000 With the changes to the assessment policy dated April 6, 2021 that removed subcuts and public retaining walls, the preliminary assessment with a 5% contingency is $17,200 per REU. Without a contingency the estimated assessment is $16,400 per REU. Staff recommends adoption of Resolution No. 2021-34 and approve preliminary assessment of $17,200 per REU based on the assessment policy dated April 6, 2021 and bids received on March 25, 2021 for the referenced project. Staff will manage the project in the hope to lower the assessment amount as close to $16,400 per REU. RESOLUTION NO. 2021-34 ORDERING IMPROVEMENT FOR MELODY LAKE A&B, GRANDVIEW A, BIRCHCREST C NEIGHBORHOOD ROADWAY RECONSTRUCTION IMPROVEMENT NO. BA-457 WHEREAS, a resolution of the City Council, adopted the 4th day of November 2020, fixed a date for a council hearing on Improvement No. BA-457, the proposed improvement of Melody Lake A&B, Grandview A, Birchcrest C Neighborhood Roadway Reconstruction; and WHEREAS, ten days mailed notice and two weeks published notice of the hearing was given, and the hearing was held thereon on the 7th day of December 2020, at which all persons desiring to be heard were given an opportunity to be heard thereon; and WHEREAS, 5100 – 5113 Grove Street was not listed on Public Hearing notices mailed November 20, 2020 and were listed on a new notice mailed on March 19, 2021; WHEREAS, ten days mailed notice and two weeks published notice of the hearing was given, and an additional hearing was held thereon on the 6th day of April 2021 for the 5100-5113 Grove Street addresses, at which all persons desiring to be heard were given an opportunity to be heard thereon; and NOW THEREFORE, BE IT RESOLVED BY THE COUNCIL OF THE CITY OF EDINA, MINNESOTA: 1. Such improvement is necessary, cost-effective, and feasible to update aging infrastructure. 2. Such improvement is hereby ordered. 3. The city engineer is hereby designated as the engineer for this improvement. The engineer shall prepare plans and specifications for the making of such improvement. 4. The city council declares its official intent to reimburse itself for the costs of the improvement from the proceeds of tax exempt bonds. Dated: April 20, 2021 Attest: Sharon Allison, City Clerk James B. Hovland, Mayor STATE OF MINNESOTA ) COUNTY OF HENNEPIN )SS CITY OF EDINA ) CERTIFICATE OF CITY CLERK I, the undersigned duly appointed and acting City Clerk for the City of Edina do hereby certify that the attached and foregoing Resolution was duly adopted by the Edina City Council at its regular meeting of April 20, 2021, and as recorded in the Minutes of said Special Meeting. WITNESS my hand and seal of said City this ______ day of __________, 20___. _______________________________ City Clerk ENGINEERING STUDY MELODY LAKE A & B/GRANDVIEW A/ BIRCHCREST C NEIGHBORHOOD ROADWAY RECONSTRUCTION Bernard Place, Code Avenue, Dale Avenue, Eastview Drive, Grove Street, Hansen Road, Josephine Avenue, Melody Lane, Melody Lake Drive, Tingdale Avenue, Windsor Avenue, West 56th Street, West 57th Street, West 58th Street, West 59th Street IMPROVEMENT NO. BA-457 NOVEMBER 30, 2020 ENGINEERING DEPARTMENT CITY OF EDINA I hereby certify that this report was prepared by me or under my direct supervision and that I am a duly Licensed Professional Engineer under the laws of the State of Minnesota. 42003____11/30/20_____ Aaron Ditzler Reg. No. Date Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 2 SUMMARY: The project involves reconstruction of local bituminous and concrete streets, replacement of existing concrete curb and gutter, installation of new concrete curb and gutter, construction of new concrete sidewalk and localized rehabilitation of the sanitary sewer, watermain and storm sewer systems in the neighborhood. The estimated total project cost is $16,361,168. The estimated roadway construction cost is $7,200,468 and will be funded through special assessments at a rate of approximately $24,200 per residential equivalent unit (REU). Utility improvements amount to $8,427,150 and will be funded through the City’s utility funds. Sidewalk improvements are estimated to cost $504,892 and will be funded through the Pedestrian and Cyclists Safety (PACS) fund. Retaining wall improvements at 5700 Hansen Road are estimated to cost $228,658 and will be funded through the Pedestrian and Cyclists Safety (PACS) fund. INITIATION: The project was initiated by the Engineering Department as part of the City’s Neighborhood Reconstruction Program, identified in the Capital Improvement Plan. The project complies with the City’s Living Streets Policy, Vision Edina’s mission statement to “provide effective and valued public services” and “maintain a sound public infrastructure” and the “Strong Foundations” City budget goal. This project addresses updating substandard infrastructure with improvements associated with the roadway condition, watermain system, storm sewer system, sanitary sewer system and pedestrian facilities. LOCATION: The project includes Bernard Place, Code Avenue, Dale Avenue, Eastview Drive, Grove Street, Hansen Road, Josephine Avenue, Melody Lane, Melody Lake Drive, Tingdale Avenue, Windsor Avenue, West 56th Street, West 57th Street, West 58th Street and West 59th Street. A detailed location map of the project is shown in Figure 1. Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 3 Figure 1: Project Area Map Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 4 EXISTING CONDITIONS: Roadways The roadways in this neighborhood were originally constructed between 1940 and 1962 (see Photo 1). Photo 1: Melody Lake A/Grandview A Neighborhood, 1960 Maintenance records indicate seal coating was performed within a portion of the project area in 2007; The intersection of Code Avenue and Melody Lake Drive adjacent to Melody Lake was repaved in 2012 after installation of new storm sewer pipes (see Existing Storm Sewer). Approximately 60% of the streets in the neighborhood do not have concrete curb and gutter. The roadway width ranges from 20’ to 39’ and the average roadway width is 29’ (measured from the face of curb to the face of curb or edge of pavement). Just Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 5 over 22% of the project area has concrete streets, the majority are south of Grove Street. A recent geotechnical evaluation of the project area performed by Braun Intertec showed the roadway section varies from 1.75” to 9.75” of pavement over an apparent aggregate base followed by primarily clay soils with some silty sandy soils. As part of the City’s Pavement Management Program, all streets are regularly evaluated and rated on a scale from 1 to 100; 100 representing a brand-new road surface and 0 being extremely poor. This rating is referred to as the Pavement Condition Index (PCI), and is determined based on existing conditions and defects (alligator cracking, raveling, potholes, etc.). The average PCI for the City of Edina is 72 and the average PCI for Melody Lake A&B/Grandview A/Birchcrest C is 10. An example of the current bituminous and concrete pavement conditions can be seen in Photos 2 and 3, respectively. Photo 2: Existing Bituminous Pavement Condition Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 6 Photo 3: Existing Concrete Pavement Condition Canadian Pacific Railway The Canadian Pacific (CP) Railway runs through the north part of the project area and forms part of its western boundary. Approximately two trains run on this track per day and are operated by the Twin Cities and Wester (TC&W) Railroad. There is a steel reinforced rubber railroad crossing on Hansen Road at the intersection of West 56th Street. The crossing is in poor condition as referenced in Photo 4. There are cantilever flashing lights on both sides of Hansen Road to warn approaching vehicles, cyclists and pedestrians of approaching trains. Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 7 Photo 4: Existing CP Railway Crossing Surface Traffic and Crash Data Staff measured traffic volumes and speeds at several locations within or near the neighborhood. Average daily traffic volumes within the neighborhood range between 109 and 2,236 vehicles per day with 85th percentile speeds between 18.5 and 36.6 miles per hour. Traffic and crash data for this project is shown in Appendix A. Multi-Modal Transportation Pedestrian Facilities Sidewalk is present on the west side of Hansen Road between Vernon Avenue and the CP Rail. The sidewalk is in poor condition and has deteriorated significantly. Sidewalks are also present immediately adjacent to the project area on Vernon Avenue, Benton Avenue and Hansen Road (see Appendix B). Bicycle Facilities There are no bicycle facilities within the project area; however, there are bike lanes immediately adjacent to the project area on Vernon Avenue (see Appendix C). Public Utilities Sanitary Sewer The sanitary sewer system consists of 9” vitrified clay pipe (VCP) installed between 1951 and 1966. Historical records indicate there have been few sewer back-ups or blockages in the area (see Appendix D). Watermain The potable watermain system consists of 6” and 12” cast iron pipe (CIP) installed between 1952 and 1956. An 8” high density polyethylene (HDPE) raw watermain was installed along Hansen Road in 2014. The overall system has experienced a moderate number of breaks (see Appendix D). Most of the fire hydrants are original to the neighborhood. Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 8 Many homes in the neighborhood were constructed prior to the availability of municipal water. Although several have had private wells properly sealed, City records suggest some remain unsealed. Based on Utility Billing records, there is a single property in the project area that relies on private wells for domestic water. Staff will communicate the benefits of connecting to the City water supply to the property owner. Storm Sewer The storm sewer network is in both the Nine Mile Creek and Minnehaha Creek Watershed Districts. The system consists of 12” - 33” reinforced concrete pipe (RCP) and 15” corrugated metal pipe (CMP) installed between 1954 and 2012. There are a moderate amount of storm sewer inlets and pipes located within the project area. Two stormwater runoff treatment manholes were installed in 2012 at the intersection of Code Avenue and Melody Lake Drive. The majority of Melody Lake A and Grandview A streets within the project area drain to Melody Lake (and subsequently, Minnehaha Creek), while a small portion drains to Yancey Park (and subsequently, Nine Mile Creek). The majority of Melody Lake B and Birchcrest C streets within the project area drain to Birchcrest Lake (and subsequently, Nine Mile Creek). Private Utilities Gas, electric, communications, cable and fiber optic utilities are present in the neighborhood. These utilities are a combination of overheard and underground facilities located in backyards or along the boulevards. Street lighting consists of standard “cobra head” lights mounted on wooden poles located throughout the project area as shown in Appendix E. Hansen Retaining Wall Just south of the Canadian Pacific Railway tracks, on the west side of Hansen Road, there is an existing multi-tiered wood retaining wall. The wall spans for approximately 375 feet and ranges in height from 2 feet to 10 feet. The wall was originally constructed in 1984. The wall is recessed into a wooded area. Many sections of the wall are deteriorated and have begun to show signs of failure. DESIGN INPUT: City Council 2018 Pedestrian and Bicycle Master Plan This plan, part of the 2018 Comprehensive Plan, was developed to guide the City’s efforts to create a comprehensive pedestrian and bicycle network. As shown in Appendix B, there is a proposed sidewalk on Hansen Road between West 60th Street and Vernon Avenue, and on West 56th Street between Hansen Road and Code Avenue. Appendix C shows a proposed bike lane on Code Avenue between West 60th Street and Benton Avenue. 2015 Living Streets Policy This policy balances the needs of motorists, pedestrians, bicyclists and transit riders in ways that promote safety and convenience, enhance community identity, create Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 9 economic vitality, improve environmental sustainability and provide meaningful opportunities for active living and better health. The City will apply the Policy to all street projects, including those involving operations, maintenance, new construction, reconstruction, retrofits, repaving, rehabilitation or change in the allocation of pavement space on an existing roadway. The Living Streets Plan includes 15 principles to guide implementation of the Policy, divided into four categories: All Users and All Modes, Connectivity, Context Sensitivity and Sustainability. Below is a summary of how these principles are incorporated into this project: All Users and All Modes – This project will improve mobility and access to the transportation network for a variety of users, including pedestrians, cyclists, children, seniors and the disabled. Replacement of the pavement surfaces and traffic control signage will enhance safety and convenience for all users. Connectivity – This project involves maintaining a transportation system that can accommodate all modes of travel. Existing right-of-way will be repurposed to provide new multimodal transportation facilities, which in combination with existing and planned facilities, will form a multimodal network within the neighborhood. Context Sensitivity – Engineering strives to preserve and protect natural features within or adjacent to construction sites where feasible, including trees, waterways and sensitive slopes. Residents within the project area were invited to complete a questionnaire soliciting input on project design components, including multi-modal transportation, street lighting and local drainage problems. Sustainability – Engineering works closely with Public Works to implement infrastructure improvements with consideration of lifecycle costs and future maintenance. The new roadway section can be easily maintained long-term with the use of proactive rehabilitation treatments, which will significantly extend the life of the pavement. Reductions in impervious surfaces benefit water quality and may lessen the demand for chemicals to manage snow and ice (such as chloride). Construction operations are required to use the smallest footprint necessary to complete the work; this includes utilizing trenchless technologies, such as pipe bursting or cured-in-place pipe liners. This project will also reduce inflow and infiltration of clean water into the sanitary sewer system, minimizing regional wastewater treatment, reducing the risk of sewage surcharges, and limiting the risk of back-ups to residential properties. Relevant portions of the Living Streets Plan can be found in Appendix F. 2018 Comprehensive Water Resource Management Plan The CWRMP identified multiple areas of flood inundation within the project area for both the 10-percent and 1-percent-annual-chance flood event (also referred to as the 10-year and 100-year frequency event, respectively). The first area is along Dale Avenue between Grove Street and West 56th Street (see Figure 2). Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 10 Figure 2: Dale Avenue Roadway and Backyard Flood Zone (ML_12) This modeled inundation area impacts both the roadway and backyard sections of Dale Avenue. Approximately 9.5 acres of stormwater from the neighboring properties discharge to the City’s storm sewer system that runs along West 57th Street, Code Avenue and eventually drains into Melody Lake. 5-7 structures on Dale Avenue could be impacted by the 10- and 100-year flood zones. Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 11 The second area is Melody Lake Drive adjacent to Melody Lake (see Figure 3). Figure 3: Melody Lake Drive Backyard Flood Zone (ML_8) Melody Lake and its 173-acre watershed primarily impact the backyards along lake. The Melody Lake storm sewer outlet is pumped to the MnDOT Highway 100 drainage system. This system flows north and ultimately discharges to Minnehaha Creek. The 1-percent and 10-percent-annual-chance events could impact the structures at 5605 and 5609 Melody Lake Drive. Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 12 The third area was at the 5700 block of Hansen Road east of the CP Railway property (see Figure 4). Figure 4: Hansen Road Backyard Flood Zone (NMC_119) Two backyard depression areas collect 2.4 acres of stormwater from the neighboring properties and do not discharge to the City’s storm sewer system. The 1-percent and 10-percent-annual-chance events could impact the structures at 5720 and 5724 Hansen Road. Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 13 The fourth area is at the intersection of Hansen Road and West 56th Street (see Figure 5). Figure 5: Hansen Road/W. 56th Street Flood Zone (HL_31) This modeled inundation area primarily impacts the roadway section of West 56th Street but could impact the structure at 5617 Hansen Road. Nearly 7 acres of stormwater from the neighboring properties discharge to the City’s storm sewer system that runs along Hansen Road and discharges into the pond in Yancey Park. Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 14 The fifth area is a pond and ballfield at Yancey Park (see Figure 6). Figure 6: Yancey Park Flood Zone (HL_29b & HL_28) These two areas are connected to the City’s storm sewer system that runs along Warden Avenue and eventually drains into Hawkes Lake. Neither flood zone directly impacts a structure. Potential manhole surcharging was also identified in the 1-percent and 10-percent- annual-chance events. Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 15 The sixth area is a backyard depression on the 5800 block of Hansen Road (see Figure 7). Figure 7: Hansen Road Backyard Flood Zone (NMC_116) A backyard depression area collects 1.6 acres of stormwater from the neighboring properties and there is an adjacent public storm sewer network. The 1-percent and 10-percent-annual-chance events do not appear to impact the structures at 5804 and 5808 Hansen Road. Staff Public Works A draft engineering study was provided to the City’s Public Works Department. They support installation of concrete curb and gutter, as well as replacement of deficient watermain components (including fire hydrants, gate valves and water services). They also recommend replacement of existing CMP storm sewer within the project area. Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 16 Police and Fire A draft engineering study was provided to the City’s Police and Fire Departments. The Fire Department supports watermain improvements, including adding fire hydrants as necessary to meet public safety standards. They noted that temporary fire hydrants should be of a consistent style for ease of access, that emergency access should always be maintained during construction and that drive widths and turn arounds should meet fire code. Parks and Recreation A draft engineering study was provided to the City’s Parks and Recreation Department. They support improvements that promote non-motorized transportation to and from Yancey Park, but expressed concern about parking and traffic impacts during construction, as the park amenities are heavily used from early spring to late summer. Engineering staff will include Parks and Recreation in discussions about final design and will communicate with them before and during construction to minimize impacts to park facilities. Edina Transportation Commission Prior to the Edina Transportation Commission (ETC) regular meeting on October 22, 2020, a draft engineering study was provided for review. Relevant minutes from the ETC meetings are included in Appendix G. Residents As part of the Engineering Department’s practice of notifying residents 2-3 years prior to a potential reconstruction project, residents were invited to three open houses between September 2017 and September 2019. Materials from these meetings are available upon request. Additionally, a virtual neighborhood informational presentation was posted on Better Together Edina in August 2020. Residents were notified of the virtual meeting and were able to directly ask questions to staff from the Better Together Edina website, as well as telephone and email. Materials from this presentation can be found in Appendix I. On June 10, 2019, residents in Melody Lake A and Grandview A, were asked to complete a questionnaire, soliciting feedback on motorized and non-motorized transportation, street lighting and local drainage problems within the project area. The questionnaire was completed by 56 of 154 property owners, a return rate of 36%. The following is a summary of feedback received from residents: 18 of 56 (32%*) were concerned or very concerned with the speed of traffic in the neighborhood; 38 (68%) were not concerned. 25 (45%) were concerned or very concerned with motorist behavior in the neighborhood; 31 (55%) were not concerned. 32 (57%) identified an unsafe intersection within the neighborhood. 32 (57%) walk, run, or jog in the neighborhood at least 2-3 times per week. Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 17 11 (20%) ride a bicycle in the neighborhood at least 2-3 times per week. 6 (11%) reported parking on the street at least 2-3 times per week; 22 (39%) reported parking on the street less than once per month. 19 (34%) identified localized drainage problems in the neighborhood. 3 (75%) reported their preference that no parking exist on either side of West 56th Street between Hansen Road and Dale Street based on responses of residents with properties abutting that street segment. *Percentages based on number of returned surveys Residents in Melody Lake B and Birchcrest C, were asked to complete a questionnaire in the summer of 2020, soliciting feedback on motorized and non-motorized transportation, street lighting and local drainage problems within the project area. The questionnaire was completed by 43 of 152 property owners, a return rate of 28%. The following is a summary of feedback received from residents: 18 of 43 (42%*) were concerned or very concerned with the speed of traffic in the neighborhood; 25 (58%) were not concerned. 24 (56%) were concerned or very concerned with motorist behavior in the neighborhood; 19 (44%) were not concerned. 21 (49%) identified an unsafe intersection within the neighborhood. 39 (90%) walk, run, or jog in the neighborhood at least 2-3 times per week. 17 (40%) ride a bicycle in the neighborhood at least 2-3 times per week. 4 (9%) reported parking on the street at least 2-3 times per week; 30 (70%) reported parking on the street less than once per month. 12 (28%) identified localized drainage problems in the neighborhood. *Percentages based on number of returned surveys The full questionnaires and responses can be found in Appendix H. Relevant correspondence from residents regarding the project can be found in Appendix J. PROPOSED IMPROVEMENTS: The proposed improvements acknowledge many of the comments and concerns raised by residents throughout the information gathering process, while still maintaining the desired minimum standards of Engineering, Public Works and other City staff. Roadways Typical Section The bituminous and concrete roadway sections are proposed to be completely reconstructed to the subgrade. The existing bituminous pavement and suitable aggregate material will be recycled for use as base material in the new roadway where feasible. The existing concrete pavement and aggregate base material will be removed. A minimum of 8” of aggregate base material will be graded and compacted as the base layer prior to placement of 2.5” of bituminous non-wear and 1.5” of bituminous wear course. Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 18 Unsuitable subgrade materials will be replaced as necessary to provide adequate support for the new roadbed. Significant subgrade removals are anticipated project wide, based on the preliminary soil boring reports prepared by Braun Intertec. The reconstructed sections will meet the requirements of a minimum 20-year pavement design life based on projected traffic loadings. Hansen Road is designated as a Collector Street in the Living Streets Plan. However, Hansen Road is no longer a Municipal State Aid route, as it was in 2014 when the Living Streets classifications were originally created. Due to this change, it is more appropriate for Hansen Road to be classified as a Local Connector. This reclassification is also supported by the lack of proposed bicycle facilities along Hansen Road, which is a key difference between the Local Connector and Collector classifications. Per the Living Streets Plan’s design guidelines, Local Connector Streets have a typical width of 24’ (measured from the face of curb to the face of curb) with a 5’ sidewalk on one side. All remaining roadways within the project area are designated as Local Streets in the Living Streets Plan. Per this plan’s design guidelines, Local Streets have a typical width of 27’ (measured from the face of curb to the face of curb) without sidewalks or 24’ with a 5’ sidewalk on one side. The majority of the roadways are proposed to be reconstructed to 27’; West 56th Street between Hansen Road and Dale Avenue, is proposed to be reconstructed to 20’ due to the proposed sidewalk (see Pedestrian Facilities below) and narrow right-of-way (see Right-of-Way section below). Geometric Modifications Designated left-turn and right-turn lanes are proposed to be constructed on Hansen Road at the 3-way intersection with Vernon Avenue. This improvement will increase the service level of the intersection for northbound traffic by providing separate queueing space for westbound and eastbound movements. Parking Per the Living Streets Plan, on-street parking should be evaluated based on classification, adjacent land uses, existing demand and costs of construction and maintenance. As Hansen Road is proposed to be reclassified as a Local Connector, and given the existing demand for parking adjacent to Yancey Park, staff believes that parking on both sides of Hansen Road between the CP Rail and Vernon Avenue is appropriate, as well as one-sided parking on the west side of Hansen Road between Grove Street and the CP Rail. As parking is preferred on the same side of the road as the sidewalk for pedestrian safety, the proposed location of the parking was determined by the location of the sidewalk (see Pedestrian Facilities section below). Staff recommends no parking on West 56th Street between Hansen Road and Dale Avenue given the proposed narrow street width. The existing and proposed roadway widths, sidewalk widths and parking recommendations are shown in Table 1. Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 19 Street Existing Roadway Width¹ (face to face), feet Proposed Roadway Width (face to face), feet Sidewalk Width, feet Boulevard Width, feet Parking Bernard Place 31 27 - - Two-sided Code Avenue 31 27 - - Two-sided Dale Avenue 30 27 - - Two-sided Eastview Drive 28 27 - - Two-sided Grove Street 31 27 - - Two-sided Hansen Road north of CP Rail 39 27 5 5 Two-sided Hansen Road south of CP Rail 35-32 24 5 5 West side only Josephine Avenue 29 27 - - Two-sided Melody Lane 28 27 - - Two-sided Melody Lake Drive 28 27 - - Two-sided Tingdale Avenue 31 27 - - Two-sided Windsor Avenue 29 27 - - Two-sided West 56th Street Hansen - Dale 20 20 6 0 None West 56th Street Dale - Code 30 24 5 5 South side only West 57th Street 30 27 - - Two-sided West 58th Street 31 27 - - Two-sided West 59th Street 31 27 - - Two-sided ¹Existing roadway width is measured from edge of bituminous to edge of bituminous on streets with no curb and gutter Table 1: Street Widths, Sidewalks and Parking Canadian Pacific Railway The railroad crossing surface will be replaced with an embedded concrete rubber crossing due to its poor condition. A contractor, selected by Canadian Pacific, will install the crossing in accordance with Federal Railroad Administration standards. The existing railroad signal system will not be modified. Roadway Signage All traffic signage within the project area, including street name blades, will be replaced to improve visibility and reflectivity (see Appendix E). All new signs will conform to the standards of the Manual on Uniform Traffic Control Devices (MUTCD). Multi-Modal Transportation Pedestrian Facilities A 5’ boulevard-style concrete sidewalk is proposed on the west side of Hansen Road between West 60th Street and Vernon Avenue. This sidewalk will connect to the existing sidewalks on Vernon Avenue, Benton Avenue and Hansen Road. Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 20 A 6’ edge-of-road -style concrete sidewalk is also proposed on the south side of West 56th Street between Hansen Road and Dale Avenue. A 5’ boulevard-style concrete sidewalk is proposed for 2021 construction on the south side of West 56th Street between Dale Avenue and Normandale Road. This sidewalk will connect to the proposed sidewalk on Hansen Road and to existing pedestrian facilities on Normandale Road. Figure 8 shows all existing and proposed pedestrian facilities. Figure 8: Existing and Proposed Pedestrian Facilities Locations were selected by staff based on existing topography, connections to existing facilities and private utility conflicts. The grass boulevard that will separate the new curb and the proposed sidewalk along Hansen Road and West 56th Street, east of Dale Avenue, will be 5’-wide, but may vary depending on construction conflicts. The separation from vehicle traffic creates a more pedestrian-friendly environment and is preferred by Public Works for snow storage. The extra width needed for the sidewalk and boulevard will be balanced between both sides of the street, where feasible. The sidewalk on West 56th Street east of Code Avenue will be retrofitted behind the concrete curb and gutter within the available right-of-way. No boulevard will exist between the new curb and the proposed sidewalk along West 56th Street between Hansen Road and Dale Avenue due to the narrow right- of-way and existing conflicts. Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 21 All adjacent pedestrian curb ramps will be reconstructed to meet the current design standards of the Americans with Disabilities Act (ADA) and portions of the existing sidewalk will be reconstructed as necessary. The Hansen Road sidewalk adjacent to Yancey Park will be maintained by City staff, including snow plowing. As the remaining sidewalk segments are not along Municipal State Aid routes, adjacent to City property nor included in the City’s Active Routes to School Plan, they will be maintained by the adjacent property owners. Bicycle Facilities As previously mentioned, the Pedestrian and Bicycle Master Plan recommends bike lanes on Code Avenue between Benton Avenue and West 60th Street. All the local streets south of the project area were reconstructed between 2015 and 2017 with no bicycle facilities, and Benton Avenue is not anticipated to receive bicycle facilitates in the next 5 years. Since bike lanes on these two blocks of Code Avenue would not connect to any other bicycle facilities in the neighborhood, they are not proposed to be constructed as part of this project. Public Utilities Sanitary Sewer The sanitary sewer main has been televised, and portions will be repaired using a combination of open cut and cured-in-place-pipe (CIPP) methods. These repairs will address the issues of sags, cracks and groundwater infiltration into the sewer main. The manhole castings will also be removed and replaced to reduce inflow and infiltration of stormwater. Watermain Echologics, LLC was hired by the City to perform a non-invasive pipe condition assessment on the watermain within the project area, and staff has reviewed historical break data to determine the extent of improvements needed. All of the existing watermain, except for the 12” DIP from West 60th Street to Grove Street, will be replaced using a combination of pipe bursting, lining and open cut methods. Water service leads connected to replaced watermain will be replaced as well. All gate valves and fire hydrants within the project area will be replaced and, if needed, additional hydrants will be installed to meet current public safety standards. The new fire hydrants will include the Storz nozzle fittings desired by the Edina Fire Department for quick connection of fire hoses. As part of the City’s Wellhead Protection Plan, staff plans to engage property owners who have unsealed private wells and encourage them to have them properly sealed. Storm Sewer Based on existing conditions and the scope of utility work, new concrete curb and gutter will be installed throughout the project, providing a continuous, functional conduit for stormwater. The storm sewer network will have modifications to resolve existing drainage issues at various locations throughout the neighborhood. Some of the existing structures will be removed and replaced due to their poor condition. Sump drains will be installed where feasible to allow property owners to connect their sump pump discharges directly into the storm sewer system. Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 22 The 2018 Comprehensive Water Resources Management Plan recommended that the storm sewer system be upgraded to protect the structure at 5701 Dale Avenue from flooding during the 100-year frequency storm event. Staff is evaluating the feasibility of upsizing the existing pipe between Dale Ave and Code Ave. Staff will communicate and coordinate with adjacent property owners as necessary. Private Utilities Staff met with representatives of several private utility companies on October 28, 2020 to discuss the proposed 2021 reconstruction projects and preliminary improvements. Portions of the private utility networks may receive upgrades prior to construction; however, this work is not part of the City’s project. Currently, the City does not have a standard to determine where and when street lighting should be improved. Unlike other infrastructure improvements, lighting can be installed at a later date with minimal disturbance through the use of trenchless technologies. The lighting in the neighborhood is sufficient to delineate the intersections; therefore, staff is recommending no revisions to the current street lighting. Hansen Road Retaining Wall Staff has determined that due to the wall condition and to accommodate the proposed boulevard and walk along Hansen Road, the existing Hansen Road retaining wall will need to be replaced. Staff has retained Gale-Tec Engineering, Inc to provide replacement wall design options. Three options were provided and evaluated. Based on lower wall costs and lack of wall visibility, Staff proposes that a hybrid Geogrid Reinforced Big Block Wall and Reinforced Soil Slope be constructed to replace the existing wall. Gale-Tec Engineering, Inc’s full report can be viewed in Appendix K. RIGHT-OF-WAY/ EASEMENTS: Existing right-of-way in this neighborhood varies from 40’ to 60’. It is anticipated that the majority of this project can be constructed within existing ROW. Many properties have vegetation, boulders or other landscaped items within the right-of-way. A portion of these landscape items will interfere with some of the proposed infrastructure improvements and will need to be removed to complete the necessary work. A ROW permit from Hennepin County will be required for work that will occur at Hansen Road and Vernon Avenue. CP Railway signed separate permit agreements with the City that authorized the installation and maintenance of storm sewer and raw watermain within CP Railway right-of-way in 1984 and 2014, respectively. The City and CP Railway must enter into a new permit agreement to improve the existing 12” CIP watermain within CP Railway right-of-way. A ROW permit from CP Railway will be required for roadway and crossing surface work that will occur at Hansen Road and West 56th Street. Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 23 PROJECT COSTS: The total estimated project cost is $16,361,168 (see Table 2). The total cost includes direct costs for engineering, clerical and construction finance costs from the start of the project to the final assessment hearing. Item Amount Total Cost Funding Source Roadway Total: $7,200,468 Special Assessments Sanitary Sewer $1,051,460 Watermain $3,611,430 Storm Sewer $3,764,260 Utility Total: $8,427,150 City Utility Funds Hansen Wall $228,658 Hansen Rd Walk $236,678 W 56th St Walk West of Code Ave $118,339 W 56th St Walk East of Code Ave $149,875 Sidewalk Total: $733,550 PACS Fund Project Total: $16,361,168 Table 2: Estimated Project Costs Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 24 ASSESSMENTS: Assessments will be levied against the benefiting adjacent properties pursuant to Chapter 429 of the Minnesota State Statues. Based on the City’s Special Assessment Policy, there are 297.54 roadway residential equivalent units (REUs) in the Melody Lake A&B / Grandview A / Birchcrest C project area. The estimated assessment per REU is $24,200 (see Figure 9). The preliminary assessment role can be found in Appendix L. Figure 9: Preliminary Roadway Assessment Map All single-family residential properties located entirely within the project area receive an assessment of 1 REU, except for the properties shown in the tables below. There are 33 single-family residential properties located in the project limits that have been previously assessed a partial REU or are corner lots with an adjacent street that will be assessed with a future project. Tables 3 & 4 show their REU calculations based on the City’s assessment policy. Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 25 PID House Number Street Type of Property Proposed REU REU Factor Assessable REU 3311721220005 5405 HANSEN RD Corner lot 1 0.5 0.5 3311721320038 5300 BENTON AVE Corner lot 1 0.5 0.5 3311721320026 5216 BENTON AVE Corner lot 1 0.5 0.5 3311721310052 5120 BENTON AVE Corner lot 1 0.5 0.5 3311721320073 5200 BENTON AVE Corner lot 1 0.5 0.5 3311721310057 5100 BENTON AVE Corner lot 1 0.5 0.5 3311721320024 5215 BENTON AVE Corner lot 1 0.5 0.5 3311721320069 5325 BENTON AVE Corner lot 1 0.5 0.5 3311721310001 5101 BENTON AVE Corner lot 1 0.5 0.5 3311721320013 5201 BENTON AVE Corner lot 1 0.5 0.5 3311721310006 5121 BENTON AVE Corner lot 1 0.5 0.5 3311721320057 5900 BERNARD PL Corner lot 1 0.5 0.5 3311721320050 5820 DALE AVE Corner lot 1 0.5 0.5 3311721320039 5821 DALE AVE Corner lot 1 0.5 0.5 3311721310069 5828 EASTVIEW DR Corner lot 1 0.5 0.5 3311721310060 5833 EASTVIEW DR Corner lot 1 0.5 0.5 3311721320051 5821 HANSEN RD Corner lot 1 0.5 0.5 3211721410110 5824 HANSEN RD Corner lot 1 0.5 0.5 3211721410038 5900 HANSEN RD Corner lot 1 0.5 0.5 3311721310078 5900 JOSEPHINE AVE Corner lot 1 0.5 0.5 3311721310087 5901 JOSEPHINE AVE Corner lot 1 0.5 0.5 3311721310030 5821 TINGDALE AVE Corner lot 1 0.5 0.5 Table 3: Single-Family Residential Corner Properties with Future Additional Assessment Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 26 Table 4: Previously Assessed Single-Family Residential Properties There are four multi-family residential properties located in the project limits, Tables 5 & 6 show their REU calculations based on the City’s current assessment policy. PID House Number Street Type of Property Proposed REU REU Factor Assessable REU 3211721140053 5700 HANSEN RD Double Bungalow 2 0.8 1.6 3211721140074 5710 HANSEN RD Duplex 1 0.8 0.8 3211721140073 5714 HANSEN RD Duplex 1 0.8 0.8 Table 5: Multi-Family Residential – Single Family Attached Properties PID House Number Street Type of Property Proposed REU REU Factor Assessable REU 3311721220055 5525 HANSEN RD Apartment 24 0.5 12 Table 6: Multi-Family Residential – Multi-Family Properties PID House Number Street Previous Project Previous REU Assigned Proposed REU Assessable REU 3311721240043 5109 56TH ST W Richmond Hills – 2012 1 1 0 3311721220002 5532 CODE AVE Richmond Hills – 2012 1 1 0 3311721320063 5300 60TH ST W Birchcrest A – 2017 0.5 1 0.5 3311721310017 5124 60TH ST W Birchcrest B – 2015 1 1 0 3311721310023 5100 60TH ST W Birchcrest B – 2015 1 1 0 3311721310028 5044 60TH ST W Birchcrest B – 2015 1 1 0 3311721320080 5324 60TH ST W Birchcrest A – 2017 0.5 1 0.5 3311721320018 5200 60TH ST W Birchcrest A – 2017 0.5 1 0.5 3311721320020 5921 BERNARD PL Birchcrest A – 2017 0.5 1 0.5 3311721310082 5912 JOSEPHINE AVE Birchcrest B – 2015 0.33 1 0.67 3311721310084 5913 JOSEPHINE AVE Birchcrest B – 2015 0.33 1 0.67 Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 27 There are six city owned properties located in the project limits. Table 7 shows their REU calculations based on the City’s current assessment policy. PID House Number Street Description Comments Proposed REU 3211721140055 5520 HANSEN RD Yancey Park Potential development of 8 lots with current zoning and flood plain restrictions. 8 3311721240077 NONE MELODY LAKE DR City owned lot northwest side of Melody Lake Not developable with current zoning and flood plain restrictions. 0 3311721240020 NONE MELODY LAKE DR City owned lot northwest side of Melody Lake Not developable with current zoning and flood plain restrictions. 0 3311721310029 NONE TINGDALE AVE Tingdale Park Potential development of 2 lots with current zoning restrictions. 2 3311721240001 5100 GROVE ST Melody Lake Park Potential development of 2 lots with current zoning and flood plain restrictions. 2 3211721410039 5904 HANSEN RD City owned well house Facilities associated with the production or distribution of water shall not be assessed. 0 Table 7: City-Owned Properties There is one railroad owned property located in the project limits. Table 8 shows the REU calculation based on the City’s current assessment policy. PID House Number Street Description Comments Proposed REU 3311721230004 None HANSEN RD Railroad owned lot Not developable with current zoning restrictions. 0 Table 8: Railroad Owned Properties Engineering Study Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Reconstruction BA-457 November 30, 2020 28 PROJECT SCHEDULE: The following schedule outlines the past and future tasks to be performed related to the project: Neighborhood Open House (all 2019/2020 projects) September 25, 2017 Neighborhood Open House (all 2020/2021 projects) September 24, 2018 Neighborhood Informational Meeting (all 2020 projects) August 12, 2019 Neighborhood Informational Video Presentation (all 2021 projects) August 26, 2020 ETC Engineering Study Review October 22, 2020 Receive Engineering Study December 7, 2020 Open Public Improvement Hearing December 7, 2020 Close Public Improvement Hearing December 9, 2020 Public Improvement Hearing Council Decision December 15, 2020 Bid Opening March/April 2021 Award Contract/Begin Construction Spring 2021 Complete Construction Fall 2021 Final Assessment Hearing October 2022 RECOMMENDATION: Staff believes the project can be completed during the 2021 construction season, assuming an efficient replacement of gas main and services schedule by CenterPoint Energy. Staff believes the construction of this project is feasible, cost effective and necessary to improve the public infrastructure in the Melody Lake A&B/Grandview A/Birchcrest C neighborhood. APPENDIX: A. Traffic and Crash Data B. Comprehensive Plan Update – Pedestrian Facilities C. Comprehensive Plan Update – Bicycle Facilities D. Sewer Blocks and Watermain Breaks E. Streetlights and Signs F. Living Streets Plan G. Edina Transportation Commission Meeting Minutes H. Resident Questionnaire I. Neighborhood Informational Video Presentation Materials J. Correspondence from Residents K. Hansen Road – Retaining Wall Report L. Preliminary Assessment Roll APPENDIX A Traffic and Crash Data Melody Lake A&B/ Grandview A/Birchcrest C Traffic and Crash Data Traffic Data Location Description Year Average Daily Traffic 85th % Speed, mph 1 Hansen Road 2016 2,236 36.6 2014 1,751 N/A 2009 1,747 34.6 2 Hansen Road 2019 1,445 N/A 3 Dale Avenue 2019 109 25.3 4West 56thStreet 2019 415 27.5 2011 359 29.6 5 Code Avenue 2019 162 24.8 6 Melody Lane 2016 160 18.5 7 Hansen Road 2001 1,449 36.6 8 Tingdale Avenue 2016 469 26.2 9 Hansen Road 2020 457 28.4 10 Tingdale Avenue 2020 227 24.5 2010 214 24.7 Crash Data Location Severity Year Month Time A Property Damage – Collision with Curb 2018 December 9:00 p.m. Property Damage – Collision with Motor Vehicle 2017 January 4:00 p.m. Property Damage – Collision with Motor Vehicle 2016 February 4:00 p.m. Property Damage – Collision with Motor Vehicle 2013 September 3:00 p.m. Property Damage – Collision with Roadway Sign or Structure 2010 September 10:00 p.m. Fatal – Collision with Motor Vehicle 2010 September 6:00 p.m. B Property Damage – Collision with Motor Vehicle 2018 December 2:00 p.m. Property Damage – Collision with Motor Vehicle 2014 October 10:00 p.m. C Property Damage – Collision with Parked Vehicle 2014 January 2:00 p.m. D Possibly Injury – Collision with Motor Vehicle 2011 February 4:00 p.m. E Property Damage – Collision with Motor Vehicle 2015 July 8:00 p.m. Possible Injury – Collision with Motor Vehicle 2015 July 12:00 p.m. F Property Damage – Collision with Motor Vehicle 2016 January 8:00 a.m. Property Damage – Collision with Motor Vehicle 2013 March 9:00 a.m. G Property Damage – Collision with Motor Vehicle 2019 July 2:00 p.m. Property Damage – Collision with Motor Vehicle 2017 September 1:00 p.m. Melody Lake A&B/ Grandview A/Birchcrest C Traffic and Crash Data APPENDIX B City Comprehensive Plan Update – Pedestrian Facilities Map ?úA@ ?ÞA@ )y Mud Lake )y ?ÞA@ ?úA@ Minnehaha Creek Nin e M ile Cr eek Nine Mile CreekBLAKE RDSCHAEFER RDVERNON AVEFRANCE AVE SXERXES AVE SCAHILL RD70TH ST W 66TH ST W YORK AVE SINTERLACHEN BLVD MALONEY AVE 4 4 T H S T W 50TH ST W 54TH ST W 58TH ST W GLEASON RD70TH ST W 76TH ST W DEWEY HILL RD VALLEY VIEW RD VALLEY VIEW RD MINNESOTA DR78TH ST W / Engineering DeptJanuary 2020 Pedestrian Facilities Proposed FacilitiesExisting Facilities Existing Sidewalk Existing Park Pathway Nine Mile Creek Regional Trail New Primary Sidewalk New Secondary Sidewalk New Shared-Use Path Upgrade to Shared-Use Path Twin Loops Facility Existing Shared-Use Path Canadian Pacific Rail Regional Trail APPENDIX C City Comprehensive Plan Update – Bicycle Facilities Map æ ¹» æ æ æ¹»æ æ ¹º¹º ¹º ñ ñ ¹»æ æ æ ¹º ¹º æ ¹º æ æ ¹º ¹º æ æ ¹º ñ ¹» æ æ ñ æ æ æ ñ ñ ñ ?ÞA@ )y ?úA@ Mud Lake LakeEdina Mirror Lake Lake Cornelia ArrowheadLake HighlandsLake IndianheadLake Melody Lake LakePamela HawkesLake Harvey Lake Centennial Lake AldenPark VanValkenburgPark FoxMeadowPark HighlandsPark Todd Park Weber FieldPark KojetinPark BrowndalePark WooddaleParkWilliamsParkUtleyPark FrankTupaPark SherwoodPark ArdenPark YorkPark ChowenPark PamelaParkSt JohnsPark StrachauerPark RoslandPark BristolParkCorneliaPark ArnesonAcresPark LakeEdinaParkFred RichardsPark YorktownPark EdinboroughPark GardenPark MelodyLakePark TingdalePark CountrysidePark BredesenPark WalnutRidgePark KrahlHill Creek Valley Park HeightsPark NormandalePark McGuirePark LewisParkBraemar Park and Golf Course(Courtney Fields) Minnehaha Creek N ine Mile Creek Nine Mile Creek Canadian Pacific RailroadCanadian Pacific RailroadCityHall St Peters Lutheran Church & School FireStation Public Works &Park Maintenance CalvaryChurchPublicLibrary ConcordSchool EdinaCovenant CorneliaSchool ColonialChurch HighlandSchool CalvaryLutheran EdinaHighSchool Our Lady ofGrace Church& School SouthviewJr High CrossviewLutheran CountrysideSchool St Albans Episcopal Valley ViewJr High Creek Valley School NormandaleLutheran WooddaleChurch St PatricksCatholic New CityCovenantChurch NormandaleElementary St StephensEpiscopal EdinaCommunityCenter GoldenYearsMontessori CalvinChristianSchool GoodSamaritanMethodist EdinaMorningsideChurch ChristPresbyterianChurch ChapelHillsCongregtional Shepard of the HillsLutheran Edina Community Lutheran Church FireStationBlake RdVernon AveFrance Ave SXerxes Ave SCahill Rd70th St W Interlachen Blvd Maloney Ave 4 4th S t W 50th St W 54th St W 58th St W Gleason Rd70th St W 76th St W Dewey Hill Rd Valley View Rd Valley View Rd Minnesota Dr78th St W Wooddale AveTracy AveParklawn AveConcord AveBenton Ave Gle a s o n R dMalibu RdGreen Farms RdMcCauley Trl SMirror Lakes DrLincoln DrWashington AveDivision St Vernon AveGolf Ter Code AveWilryan AveNormandale RdWest Shore DrCornelia DrFrance Ave SYork Ave S77th St WOhms LnHilary Ln Olinger Blvd 66th St W Antrim Rd63rd St W Xerxes Ave S69th St W Bush Lake RdMetro Blvd66th St W 62nd St W Valley Ln Brookside Ave?úA@ ?ÞA@ )y 74th St W V alley V iew RdEngineering Dept.January 2020 / O:\Users\engineering\Projects\Bicycle_Facilities_Asbuilts.mxd Upgrade to Buffered Bike Lane Proposed Bicycle Facilities Nine Mile Creek Regional Trail Neighborhood Slow Street Standard Bike Lane New Buffered Bike Lane New Shared Use Path Upgrade to Shared Use Path Twin Loops Facility Canadian Pacific Rail Regional Trail APPENDIX D Sewer Blocks and Watermain Breaks 5205 5209521352175221 5300 5132-34 52005025 5909 5041 5212 5316 5721 5037 5501 5024 5709 501352095204520852135100 5525 5020 5805 5511 5018 5032 5717 5917 5829 5224 5433 5515 5028 5813 5908 5805 5807 5916 5912 5912 5409-11 5909 5817 59045904 5908 5917 5913 5816 5024 5304 5605 5416 5808 5817 5821 5825 5724 5309 6001 5213 5813 5913 5036 6001 5412 5417 5029 5228 5401 5809 5920 5405 5216 5220 5213 5713 5217 24 5208 5725 5812 542054255609 5100 5901 5232 5728 5921 5912 5625 5900 5004 5232 5604 5233 5700- 04 5008 5905 5612 5234 5110 5904 5801 5021 5325 5600 5017 5216 5908 5624 5053 5209 5908 5012 5120 5516 5828 5408 5317 5509 5904 5812 5400 5048 5808 5608 5900 5236 5300 5114 5328 53045805 5409 5208 5905 53125101 5120 5916 5821 5621 5700 5325 5809 5733 5033 5909 5120 5813 5121 5824 5612 5905 5301 5616 5124 5409 5805 5113 5812 5201 5817 5701 5804 5200 5710-14 5816 5916 5620 5105 5520 5912 5300 5012 5705 5716 5621 5729 5800 51205728 5117 5101 50405200 58125809 5204 5800 5813 52095208 5729 5012 5805 53015817 5804 5321 5120 5808 20552175716 52135804 5517 52135036 31330552095029 5808 5809 5801 5816 5616 5120-22 5620 5913 5108 5812 5605 5637 5800 5112 5616 5321 51155109 5116 5613 5609 5833 50055108 5017 5617 5901 5044 5825 5044 5201 5801 5829 5215 5603 5800 5821 5724 5117 5609 3175004 5621 5124- 26 5201 5412 3095821 5620 5212 502054105624 54165701 5801 5016 5224 5605 5600 5517 5615 5105 5121 5320 5105 5025 5212 5820 5109 5724 5708 5617 5008 5109 5324 5716 5521 5708 6000 5040 5629 500 5712 520150325205 5612 5216 5201 5208 5028 5204 5704 5020 5608 5720 5804 5033 5017 5201 5032 5209 5704 5020 5400 5617 5700 5401 5621 5025 5116 5720 5009 5305 5036 5100 57095313 5725 5712 5713 5717 5633 5705 5029 53096001 5717 5016 5724 5601 5705 5900 5017 5816 5005 5405 5045 5713 5721 5701 5124 5725 5301 5009522150256001 5100 5713 510851035312 5104 500 5321 5200 5028 5116 5313 5112 5721 5120 5608 5024 5317 5113 5100 5712 5205 5101 5713 5112 5013 5101 510953085121 5104 5049 5105 5625 51095117 5113 5208 5604 5105 5028 5113 6001 5701 5204 5709 6000 5117 5021 5705 5021 5720 5624 5820 512153205128-30 5415 531656015712 5717 5620 5600 53245813 5704 53045700 51125220 51045033 5708 51045205 6000 5025 19 6005 5041 50295037 50115605 6005 50175021 500 50365105510851165725 552451095048 50405013 5716 6004 50085721 5229 6000 51175009 5041 5 1 5900 5809 5716 5724 501250045616 60055225 50095720 51135021500850095056 50365617 50045404 50125041500550175033503250375108500850375520 5524 5109502550205600 5212 5029511250455528 51055608 50245029503350285532 5816 5009 50405037 501650125612 5604 50135033 5525501651085036504951045041501650285024503250205 116 5044505350085125 PROJECT LIMITS Garden Park V E R N O N A V E WINDSOR AVE W 56TH ST W 57TH ST GROVE STHANSEN RDHANSEN RDDALE AVEBERNARD PLCODE AVEMELODY LAKE DRMELODY LNCODE AVEW 58TH ST EASTVI EW DRHANSEN RDBERNARD PLCODE AVETINGDALE AVEJOSEPHINE AVEW 59TH ST BENTON AVE W 60TH ST Tingdale Park Melody Lake Park / Engineering Dept. October 2020 2021 Project Area Melody Lake A & B, Grandview A and Birchcrest C Watermain Breaks & Sewer BlockagesCITYOFEDINAMINNESOTAINCORPORATED 1888 , e Legend Watermain Break Sewer Blockage APPENDIX E Street Lights and Signs 5908 5117 51105105 5004 5712 5608 5532 5809 5120-22 5805 5812 5209503352095609 5021 5209 5200 5236 5045 5017 5121 5809 30950095708 5901 5829 52165212 5905 5913 5020 5101 5112 5041 50246001 5515 5408 6004 5805 5805 5008 5016 50085009 5617 5524 5401 5916 5112501750415132-34 50245033 5817 5912 5024 5733 5109 5625 5700 5605 3055613 5904 5233 5909 5013 5112 5712 5821 5616 560151095049 50055633 5724 5234 5629 5804 5101 50165509 5116 5807 5008 5416 5620 52085804 5600 5101 5909 5713 5704 5212 5317 510854205116 5701 51045328 50126001 5217 5117 5412 5828 5109 5813 50445113 5615 5109 5120 5624 5020 5128-30 5109 5105 5101 5800 5120 5728 5809 5301 502050375200 5608 5501 5025 5201 520954105729 50085724 5113 5056 500 5208 55255100 5705 50045025 5005032 5201 5808 5701 5900 50405904 51055816 5724 50205121 5213 5029 58175320 5637 50056005 5124 51205232 5620 5709 5705 5809 50135113 5916 5325 5520 5800 5221 5608 5817 5905 5021 5 1 53125213 5709 6000 50205521 5605 5005600 56045309 5037 5400 5612 502950085120 5113 5901 5801 50405805 5309 5201 5710-14 5025 5913 5032 5201 5701 5114 5117 5821 6005 5700 5228 5012 5117 50285708 5801 5809 50126001 5232 5216 50365224 5208 5724 5108 5205 5120 50455913 5621 5713 53015417 5028 5018 3175825 5904 5816 58135041 5204 51175717 5040 5804 5033 5200 5720 5609 5105 50375905 5220 5204 5813 56165324 5113 5029 572557285312 5316 5216 5716 50215204 5009 5808 50095224 5044 50125821 5021 521352055820 58165316 5 116 5120 5105 5100 5917 5912 5616 5713 5909 6000 5125 51125013 56205621 5601 5028 5112 5208 503350295401 6005 5208 5721 5904 5900 50375103 6000 5105 5305 5812 5025 5300 5511 5713 5109 51165804 5704 5029 5009 5816 5816 5712 5908 5516 5908 5121 5621 5400 50495415 5321 5033 500450045109 5713 5604 5921 5624 5409 5813 5721 5824 5100 5612 5032 5609 5717 5620 5404 5205 5708 5032 2055801 53045209 5104 5709 5608 5712 5833 5005 5821 501654255829 19 53135029 521331352005908 5621 5612 5716 5817 5116 5725 5600 5720 5108 5812 5808 53085053 5801 5717 5020 500952215044 5325 6001 5121 5917 510850285405 54165008522552015201 5208 5013 5215 5048 50326000 5304 5716 5520 50365405 5912 5716 5033 5704 5209 5041 5920 5812 5717 5617 5412 51045036502450175100 5600 5124- 26 5301 5605 5036 5213 50405409-11 5700- 04 5212 57245725 5036 5433 5115 5617 521751045012 5025 5321 50115617 5805 5205 5028 5720 5820 5517 5625 5517 5017 5300 5217 5320 5705 5800 5105 5525 24 5021 5041 5616 5900 5729 5108 5016 5017 5317 5916 5612 5104 505351005124 5808 5912 50165705 5313 5701 5800 5037 5048 5528 5024 5721 53045220 52045605 5324 5028 5813 50255700 5603 5300 5721 6001 5716 5812 5900 5212 5725 5012 5321 5409 5604 50365524 5017 5825 52135229 5720 5624 5108PROJECT LIMITS Garden Park V E R N O N A V E WINDSOR AVE W 56TH ST W 57TH ST GROVE STHANSEN RDHANSEN RDDALE AVEBERNARD PLCODE AVEMELODY LAKE DRMELODY LNCODE AVEW 58TH ST EASTVI EW DRHANSEN RDBERNARD PLCODE AVETINGDALE AVEJOSEPHINE AVEW 59TH ST BENTON AVE W 60TH ST Tingdale Park Melody Lake Park / Engineering Dept. October 2020 2021 Project Area Melody Lake A & B, Grandview A and Birchcrest C Street LightsCITYOFEDINAMINNESOTAINCORPORATED 1888 , e Legend Street Lights ª«¬¯±²!"$!"$!"$!"$!"$ bcdpf!"$!"$!"$!"$bcdpf !"$bcdpf !"$!"$bcdpf bcdpf !"$!"$bcdpf !"$!"$!"$!"$ !"$!"$bcdpf !"$!"$ ¹º»¼ !"$ ¹º»¼ !"$89:{ 89:;bcdpf !"$!"$!"$ 89:| !"$ ª«¬bcdpf !"$!"$!"$ 1238 1238 1238 1238 5205 5209521352175221 5300 5132-34 52005025 5909 5041 5212 5316 5721 5037 5501 5024 5709 501352095204520852135100 5525 5020 5805 5511 5018 5032 5717 5917 5829 5224 5433 5515 5028 5813 5908 5805 5807 5916 5912 5912 5409-11 5909 5817 59045904 5908 5917 5913 5816 5024 5304 5605 5416 5808 5817 5821 5825 5724 5309 6001 5213 5813 5913 5036 6001 5412 5417 5029 5228 5401 5809 5920 5405 5216 5220 5213 5713 5217 24 5208 5725 5812 542054255609 5100 5901 5232 5728 5921 5912 5625 5900 5004 5232 5604 5233 5700- 04 5008 5905 5612 5234 5110 5904 5801 5021 5325 5600 5017 5216 5908 5624 5053 5209 5908 5012 5120 5516 5828 5408 5317 5509 5904 5812 5400 5048 5808 5608 5900 5236 5300 5114 5328 53045805 5409 5208 5905 53125101 5120 5916 5821 5621 5700 5325 5809 5733 5033 5909 5120 5813 5121 5824 5612 5905 5301 5616 5124 5409 5805 5113 5812 5201 5817 5701 5804 5200 5710-14 5816 5916 5620 5105 5520 5912 5300 5012 5705 5716 5621 5729 5800 51205728 5117 5101 50405200 58125809 5204 5800 5813 52095208 5729 5012 5805 53015817 5804 5321 5120 5808 20552175716 52135804 5517 52135036 31330552095029 5808 5809 5801 5816 5616 5120-22 5620 5913 5108 5812 5605 5637 5800 5112 5616 5321 51155109 5116 5613 5609 5833 50055108 5017 5617 5901 5044 5825 5044 5201 5801 5829 5215 5603 5800 5821 5724 5117 5609 3175004 5621 5124- 26 5201 5412 3095821 5620 5212 502054105624 54165701 5801 5016 5224 5605 5600 5517 5615 5105 5121 5320 5105 5025 5212 5820 5109 5724 5708 5617 5008 5109 5324 5716 5521 5708 6000 5040 5629 500 5712 520150325205 5612 5216 5201 5208 5028 5204 5704 5020 5608 5720 5804 5033 5017 5201 5032 5209 5704 5020 5400 5617 5700 5401 5621 5025 5116 5720 5009 5305 5036 5100 57095313 5725 5712 5713 5717 5633 5705 5029 53096001 5717 5016 5724 5601 5705 5900 5017 5816 5005 5405 5045 5713 5721 5701 5124 5725 5301 5009522150256001 5100 5713 510851035312 5104 500 5321 5200 5028 5116 5313 5112 5721 5120 5608 5024 5317 5113 5100 5712 5205 5101 5713 5112 5013 5101 510953085121 5104 5049 5105 5625 51095117 5113 5208 5604 5105 5028 5113 6001 5701 5204 5709 6000 5117 5021 5705 5021 5720 5624 5820 512153205128-30 5415 531656015712 5717 5620 5600 53245813 5704 53045700 51125220 51045033 5708 51045205 6000 5025 19 6005 5041 50295037 50115605 6005 50175021 500 50365105510851165725 552451095048 50405013 5716 6004 50085721 5229 6000 51175009 5041 5 1 5900 5809 5716 5724 501250045616 60055225 50095720 51135021500850095056 50365617 50045404 50125041500550175033503250375108500850375520 5524 5109502550205600 5212 5029511250455528 51055608 50245029503350285532 5816 5009 50405037 501650125612 5604 50135033 5525501651085036504951045041501650285024503250205 116 5044505350085125 PROJECT LIMITS Garden Park V E R N O N A V E WINDSOR AVE W 56TH ST W 57TH ST GROVE STHANSEN RDHANSEN RDDALE AVEBERNARD PLCODE AVEMELODY LAKE DRMELODY LNCODE AVEW 58TH ST EASTVI EW DRHANSEN RDBERNARD PLCODE AVETINGDALE AVEJOSEPHINE AVEW 59TH ST BENTON AVE W 60TH ST Tingdale Park Melody Lake Park / Engineering Dept. October 2020 2021 Project Area Melody Lake A & B, Grandview A and Birchcrest C Street SignsCITYOFEDINAMINNESOTAINCORPORATED 1888 , e APPENDIX F Living Streets Plan Living Streets Plan 2015 Safety Health Choice Economy 8 2. Living Streets Policy INTRODUCTION The Living Streets Policy was developed to provide the framework for a Living Streets Plan. The policy initially stood alone and included sections to guide the creation of the Living Street Plan. This revised policy is now an integral part of the Living Streets Plan. The Living Streets Policy ties directly to key community goals outlined in the City’s 2008 Comprehensive Plan. Those goals include safe walking, bicycling and driving; reduced storm water runoff, reduced energy consumption, and promoting health. The Living Streets Policy also compliments voluntary City initiatives such the “do.town” effort related to community health, Tree City USA and the Green Step Cities programs related to sustainability. In other cases, the Living Streets Policy will assist the City in meeting mandatory requirements set by other agencies. The Living Streets Policy is broken up into three parts: Vision, Principles and Implementation. The Policy is followed by a description of core services provided by the City of Edina that are related to or implemented in part through Living Streets. POLICY Living Streets balance the needs of motorists, bicyclists, pedestrians and transit riders in ways that promote safety and convenience, enhance community identity, create economic vitality, improve environmental sustainability, and provide meaningful opportunities for active living and better health. The Living Streets Policy defines Edina’s vision for Living Streets, the principles Living Streets will embody, and the plan that will guide implementation of their construction. LIVING STREETS VISION Edina is a place where ... • Transportation utilizing all modes is equally safe and accessible; • Residents and families regularly choose to walk or bike; • Streets enhance neighborhood character and community identity; • Streets are safe, inviting places that encourage human interaction and physical activity; • Public policy strives to promote sustainability through balanced infrastructure investments; • Environmental stewardship and reduced energy consumption are pursued in public and private sectors alike; and • Streets support vibrant commerce and add to the value of adjacent land uses. Mini Fact Expect cyclists on the road. Watch for cyclists on the road. Treat them as you would any slow-moving vehicle. Living Streets Plan – 2. Living Streets Policy 9 LIVING STREETS PRINCIPLES Fifteen principles guide implementation of the Living Streets Policy in the areas of all users and all modes, connectivity, context sensitivity and sustainability. The City will incorporate these principles when planning for and designing the local transportation network and when making public and private land use decisions. All Users and All Modes Principle 1: Living Streets are high-quality transportation facilities that meet the needs of the most vulnerable users such as pedestrians, cyclists, children, seniors and the disabled; and Principle 2: Living Streets provide access and mobility for all transportation modes while enhancing safety and convenience for all users. Connectivity Principle 3: The City designs, operates and maintains a transportation system that provides a highly connected network of streets that accommodate all modes of travel; Principle 4: The City seeks opportunities to overcome barriers to active transportation by preserving and repurposing existing rights-of-way and adding new rights- of-way to enhance connectivity for pedestrians, bicyclists and transit; Principle 5: The City prioritizes improvements to non-motorized connections to key destinations such as public facilities, public transit, the regional transportation network and commercial areas; Principle 6: The City will require new developments to provide interconnected street and sidewalk networks that connect to existing or planned streets or sidewalks on the perimeter of the development; and Principle 7: Projects will include consideration of the logical termini by mode. For example, the logical termini for a bike lane or sidewalk may extend beyond the traditional limits of a street construction or reconstruction project, in order to ensure multimodal connectivity and continuity. Context Sensitivity Principle 8: Living Streets are developed with input from stakeholders and designed to consider neighborhood character and promote a strong sense of place; Principle 9: Living Streets preserve and protect natural features such as waterways, urban forest, sensitive slopes and soils; Principle 10: Living Streets are designed and built with coordination between business and property owners along commercial corridors to develop vibrant commercial districts; Living Streets Plan – 2. Living Streets Policy 10 Principle 11: Living Streets coordinate with regional transit networks and regional authorities; and Principle 12: The City will consider the fiscal context of projects and potential financial impacts when implementing Living Streets at the project level. Sustainability Principle 13: Living Streets will improve the current and future quality of life of the public, Principle 14: Living Streets will reduce environmental impacts associated with the construction and operation of roadways; and Principle 15: The City will increase the life span and resilience of its infrastructure and will build infrastructure with consideration for lifecycle costs and ease of maintenance. LIVING STREETS IMPLEMENTATION The City of Edina will develop Living Streets in the regular course of business of maintaining, expanding or redeveloping the road network and will be guided by the Vision and Principles established above. Implementation will happen predominantly through the neighborhood street reconstruction program, but also though specific stand-alone stormwater utility, pedestrian, bicycle or safety projects. Project prioritization is not specifically part of the Living Streets Plan. Prioritization of projects takes place in the City’s Capital Improvement Program and Budget and is determined by the City Council with guidance from the Living Streets Vision and Principles. The City will actively promote and apply the Living Streets Policy and Plan by: • Applying the Living Streets Policy and Plan to all street projects, including those involving operations, maintenance, new construction, reconstruction, retrofits, repaving, rehabilitation or changes in the allocation of pavement space on an existing roadway. This also includes privately built roads, sidewalks, paths and trails. • Drawing on all sources of transportation funding and actively pursuing grants, cost-sharing opportunities and other new or special funding sources as applicable. • Through all City departments supporting the vision and principles outlined in this Plan in their work. • By acting as an advocate for Living Streets principles when a local transportation or land use decision is under the jurisdiction of another agency. Projects that implement Living Streets will be guided by pedestrian and cyclist network plans and roadway classifications and will consider the physical, social, ecologic, regulatory and economic context in a given project area. Living Streets Plan – 2. Living Streets Policy 11 The project delivery system used to build Living Streets will: • Systematically engage Edina residents and project stakeholders to better inform project-level recommendations. • Keep Edina residents and project stakeholders informed about Living Streets and the range of services they help provide. • Follow minimum Living Streets design requirements and standards. • Manage construction impacts to residents and users of streets. Network The creation of a Living Streets network of road, pedestrian and bicycle facilities provides mobility, accessibility and access to people, places and spaces. The resulting interconnection of neighborhoods links people to goods and services and to one another, and increases quality of life for those who live in, work in, or visit the city. Existing and planned transportation networks are identified in the City of Edina Comprehensive Plan and other approved/adopted plans. Network plans include: • Roadway Network (Functional Classification, Jurisdictional Classification) • Sidewalk Facilities • Bicycle Facilities (Comprehensive Bicycle Transportation Plan) • Active Routes to School Comprehensive Plan • Transit Service Network plans are approved by the City Council. In most cases, modification requires an amendment of the Comprehensive Plan. The expansion, creation and improvement of pedestrian and bicycle networks will be well planned and prioritized: • Expansion of existing networks and providing connections to key traffic generators or destinations provide immediate benefit to all network users and is a top priority. • Network connections serving vulnerable users such as children, seniors and the disabled are a top priority. • Network connections serving high-volume uses such as schools, retail destinations or regional public transit are a top priority. Living Streets Plan – 2. Living Streets Policy 12 Context Contextual variety can either constrain or create opportunity in roadway and other infrastructure projects. The following are contexts that will be considered and will influence the planning, design and implementation of Living Streets. Exceptions Living Streets principles will be included in all street construction, reconstruction, repaving and rehabilitation projects, except under one or more of the conditions listed below. City staff will document proposed exceptions as part of a project proposal. • A project involves only ordinary maintenance activities designed to keep assets in serviceable condition, such as mowing, cleaning, sweeping, spot repair, concrete joint repair or pothole filling, or when interim measures are implemented on a temporary detour. Such maintenance activities, however, shall consider and meet the needs of bicyclists and pedestrians. CONTEXTS OF LIVING STREETS Ecological Water resource, ponds, wetlands, lakes, streams Natural resouces, trees, and urban forest Air quality Climate Sun and shade Materials, waste, energy, sustainability Regulatory State Aid roadway Watershed rules Operational Maintenance operations Traffic control or functional constraints Project Type Public Neighborhood street reconstruction Neighborhood street reconstruction with major associated utility work State Aid street reconstruction Stand-alone sidewalk, bicycle or utility project Public partner lead State County Transit agency Parks district Private development Will remain private Future public Living Streets Plan – 2. Living Streets Policy 13 • The City exempts a project due to an excessively disproportionate cost of establishing a bikeway, walkway or transit enhancement as part of a project. • The City determines that the construction is not practically feasible or cost effective because of significant or adverse environmental impacts to waterways, flood plains, remnants or native vegetation, wetlands or other critical areas. • Available budget is constrained or project timing allows more efficient construction at a later date. Engagement Members of the public have an interest in understanding and providing input for public projects. Project recommendations will be developed with a transparent and defined level of public engagement. The public will have access to the decision-making process and decision makers via public meetings and other correspondence and will be provided the opportunity to give input throughout the process. Project reports will discuss how their input helped to influence recommendations and decisions. The City of Edina’s Living Streets will continue to engage and solicit public input as a vital component of the project implementation process. See Chapter 5 for a more detailed discussion regarding the purpose of and opportunities for public engagement. Design The guidelines contained in the Living Streets Plan will be used to direct the planning, funding, design, construction, operation and maintenance of new and modified streets, sidewalks, paths and trails. The guidelines allow for context-sensitive designs. The Design Guidelines (see Chapter 6): • Keep street pavement widths to the minimum necessary. • Provide well-designed pedestrian accommodation in the form of sidewalks or shared-use pathways on all arterial, collector and local connector streets. Sidewalks shall also be required where streets abut a public school, public building, community playfield or neighborhood park. Termini will be determined by context. • Provide frequent, convenient and safe street crossings. These may be at intersections designed to be pedestrian friendly, or at mid-block locations where needed and appropriate. • Provide bicycle accommodation on all primary bike routes. • Allocate right-of-way for boulevards. • Allocate right-of-way for parking only when necessary and not in conflict with Living Streets principles. • Consider streets as part of our natural ecosystem and incorporate landscaping, trees, rain gardens and other features to improve air and water quality. The Design Guidelines in this Plan will be incorporated into other City plans, manuals, rules, regulations and programs as appropriate. As new and better practices evolve, the City will update this Living Streets Plan. Minimum standards will guide how vehicular, pedestrian and bicycle networks interact and share public right of way. Living Streets Plan – 2. Living Streets Policy 14 Benchmarks and Performance Measures The ability to measure the performance of a plan, as well as knowing that it is functioning as it is intended, is vitally important to overall success and the ability to sustain it. With this in mind, the City will monitor and measure its performance relative to the Living Streets Policy. Benchmarks that will demonstrate success include: Every street and neighborhood is a comfortable place for walking and bicycling. This does not mean that every street in the city will have walking and biking facilities. It means that each neighborhood will provide a network of these facilities such that walking and biking to and through neighborhoods is a comfortable experience. Every child can walk or bike to school or a park safely. It is essential that alternatives to driving to school or parks be provided to children and their caregivers. These alternatives – walking or bicycling – will be both safe and convenient modes of transportation. See the Edina Active Routes to School Plan for more information. Seniors, children, and disabled people can cross all streets safely and comfortably. Opportunities to cross all streets in Edina, including local, collectors and arterial streets, will be provided. These crossings will be safe and comfortable for all users, regardless of age or ability. An active way of life is available to all. Opportunities for active living should be made available to all members of the Edina community by connecting centers of activity via active, multimodal transportation. Each resident of and visitor to Edina will have the ability to lead an active way of life. There are zero traffic fatalities or serious injuries. Perhaps the ultimate safety benchmark is zero traffic fatalities or serious injuries. Modeled from the Vision Zero Initiative (www.visionzeroinitiative.com), an aspirational yet primary goal of Living Streets is to achieve this high level of safety on the City’s roadways. Reduce untreated street water flows into local waterways and reduce storm water volume. Cost-effective stormwater best management practices (BMPs) are strategically selected to go above and beyond regulatory requirements to provide for flood protection and clean water services through the use of infrastructure that retains, settles, filters, infiltrates, diverts or reduces the volume of stormwater that flows to local surface waters. Retail streets stay or become popular regional destinations. Part of Edina’s Living Streets vision is that “streets support vibrant commerce.” While most of the city’s streets are residential, Edina’s business districts are a vital part of the community. The benefits of Living Streets extend to retail streets as well, making them more attractive to businesses and consumers alike. Living Streets Plan – 2. Living Streets Policy 15 The City will draw on the following data to measure performance: • Number of crashes or transportation-related injuries reported to the Police Department. • Number and type of traffic safety complaints or requests. • Resident responses to transportation related questions in resident surveys. • Resident responses to post-project surveys. • The number of trips by walking, bicycling and transit (if applicable) as measured before and after the project. • Envision ratings from the Institute for Sustainable Infrastructure. • Additional performance measures may be identified as this Policy is implemented. Mini Fact Motorists must stop behind all crosswalks. Living Streets Plan – 2. Living Streets Policy APPENDIX G Edina Transportation Commission Meeting Minutes Draft Minutes☐ Approved Minutes☒ Approved Date: November 19, 2020 Minutes City Of Edina, Minnesota Transportation Commission WebEx October 22, 2020 I. Call To Order Chair Richman called the meeting to order at 6:05 p.m. II. Roll Call Answering roll call were Commissioners Ahler, Johnson, Lafferty, McCarthy, Richman, Clark, Khariwala. Late: Commissioners Kane, Plumb-Smith, Scherer, Atri Staff present: Transportation Planner Andrew Scipioni, Project Engineer Charlie Gerk, Assistant City Engineer Aaron Ditzler III. Approval Of Meeting Agenda Motion was made by Commissioner Ahler and seconded by Commissioner McCarthy to approve the agenda. All voted aye. Motion carried. IV. Approval Of Meeting Minutes Motion was made by Commissioner Ahler and seconded by Commissioner McCarthy approving the September 17, 2020 meeting minutes. All voted aye. Motion carried. Commissioner Kane arrived at 6:10. Commissioner Plumb-Smith arrived at 6:12. Commissioner Atri arrived at 6:14. Commissioner Scherer arrived at 6:35. V. Reports/Recommendations A. 2021 Roadway Reconstruction Projects Project Engineer Charlie Gerk and Assistant City Engineer Aaron Ditzler presented the draft engineering studies for the proposed 2021 roadway reconstruction projects. The following comments were made: • Melody Lake A&B/Grandview A/Birchcrest C o In response to a question, staff clarified that the proposed 5’ sidewalk width for Hansen Road is the City’s standard sidewalk width. o In response to a question, staff explained that bike lanes on Code Avenue are not proposed as part of this project as the neighborhood to the south was recently reconstructed without bike lanes and Benton Avenue does not yet have a dedicated bike facility. o In response to a question, staff noted that no pedestrian or bicycle facility is proposed adjacent to Tingdale Park. o Tingdale Avenue connects between Melody Lake Park and Tingdale Park. Draft Minutes☐ Approved Minutes☒ Approved Date: November 19, 2020 o In response to a question, staff noted that a proposed shared-use path is anticipated for Benton Avenue in the next 5 years. o A bike facility should be considered for Hansen Road to connect to Yancey Park. o The proposed 27’ street width only provides one travel lane if vehicles are parked on both sides; this is not in the benefit of safety. o In response to a question, staff explained that a topographic survey was conducted within the project area to aid in designed the project and that presentations were provided to property owners within the project area. • Creek Knoll A/B o The City should consider upgrading the pedestrian bridge over Minnehaha Creek at Beard Avenue to be ADA-compliant as part of a future reconstruction project in the neighborhood south of the creek. o In response to a question, staff noted they have discussed the proposed sidewalk on Beard Avenue with the property owner of 3501 West 54th Street. It was noted that the house at this property is very close to the property line. o In response to a question, staff noted that a proposed sidewalk on the east side of France Avenue between Fuller Street and West 57th Street may be included with the reconstruction project or may be constructed as a separate project in the same year. o The proposed sidewalk on the east side of France Avenue between Fuller Street and West 57th Street will be a great addition. B. Traffic Safety Report of September 29, 2020 The Commission reviewed the Traffic Safety Report of September 29, 2020. Motion was made by Commissioner Johnson and seconded by Commissioner Lafferty to approve the Traffic Safety Report of September 29, 2020. All voted aye. Motion carried. C. Local Speed Limit Update Staff Liaison Scipioni provided the Commission with a brief update on the City’s local speed limit evaluation, including public engagement opportunities and review schedule. D. 2020 Work Plan Updates • #1 CloverRide – Commissioner Ahler will take over as lead Commissioner. Staff has reached out to residential properties in Southdale to market available on-demand service. • #2 Traffic Impact Studies – 6600 France and 7001 France have submitted formal applications; staff will share associated traffic impact studies next week for review and comment. • #3 Travel Demand Management – Staff will present draft policy in November for review and comment. • #4 TIS Framework – Staff has drafted five components; Estimated Trip Generation, Capacity Analysis, Parking Analysis, Multi-Modal Facilities, and TDM Plan. • #5 Educational Activities– #TransportationTuesday posts continue on Facebook and Instagram; Commissioners were asked to like and share posts to expand reach. Draft Minutes☐ Approved Minutes☒ Approved Date: November 19, 2020 • #6 Traffic Safety Reports – Commissioner Richman requested staff note on the monthly work plan progress report when the Commission makes recommendations on these reports. • #7 CIP/PACS – Commission reviewed the 2021 roadway reconstruction projects; the PACS equity criteria will be reviewed in November. Commissioner Clark left at 7:30. E. 2021 Work Plan Update Commissioner Richman provided a recap of the October 7 City Council work session. Staff Liaison Scipioni noted that the Planning Commission proposed some initiatives that may involve the Transportation Commission, including a planning study for the Cahill Industrial Park and review of zoning ordinances related to drive-thrus and on-street parking regulations. Scipioni also noted that City Manager Scott Neal will present all Commission work plan proposals to City Council at their November 4 work session. Commissions can call in to listen to this meeting. Commissioner Scherer left at 7:48. F. Proposed 2021 Regular Meeting Dates Staff Liaison Scipioni noted that October 2021 regular meeting date approved by the Commissioner last month coincides with the start of the Minnesota Educator Academy (MEA) conference that year (Thursday, October 21.) Motion was made by Commissioner Lafferty and seconded by Commissioner Kane to move the proposed October 2021 regular meeting date to October 28. All voted aye. Motion carried. VI. Chair and Member Comments A. Street Funding Task Force Update Commissioner Sherer was absent at this point in the meeting; no update provided. Commissioner Ahler invited Commissioners to a candidate forum for City Council Sunday sponsored by the Morningside neighborhood. Commissioner Johnson requested that the Commission have access to more detailed crash data than what is currently presented in the monthly Traffic Safety Reports. Commissioner Kane noted that the data included in the monthly Traffic Safety Reports should be used to set City goals and support data-driven decisions. Kane also asked if staff could apply the draft PACS equity criteria to projects currently being proposed or designed. Commissioner Richman expressed interest in applying the draft PACS equity criteria to upcoming projects. Richman also noted that the West 58th Street reconstruction project is still on-going and asked about the City’s level of oversight on the project. Draft Minutes☐ Approved Minutes☒ Approved Date: November 19, 2020 VII. Staff Comments • The 2020 sidewalk projects are substantially completed. • The West 58th Street sidewalks are mostly complete, and the street is paved west of France Avenue. • City ordered new bike racks for Edina Liquor Store at 50th & France, will likely be installed next spring. • Engineering staff will meet with SRF tomorrow to discuss the status of their Safe Routes to School study for Highlands, Cornelia and Creek Valley schools. • Engineering staff intends to apply for grant funding for EV infrastructure through MnDOT’s Clean Transportation Pilot Program. VIII. Schedule of Meeting and Events as of October 16, 2020 For information purposes only, no discussion. Commissioner Lafferty left at 8:05. IX. Adjournment Motion was made by Commissioner Ahler and seconded by Commissioner Plumb-Smith to adjourn the October 22, 2020 meeting at 8:05 p.m. All voted aye. Motion Carried. TRANSPORTATION COMMISSION ATTENDANCE J F M A M J J A S O N D # of Mtgs Attendance % Meetings/Work Sessions 1 1 1 1 1 1 1 1 1 1 10 NAME Ahler, Mindy 1 1 1 1 1 1 1 1 1 9 90% Johnson, Kirk 1 1 1 1 1 1 1 1 8 80% Kane, Bocar 1 1 1 1 1 1 1 1 1 1 10 100% Lafferty, Peter 1 1 1 1 1 5 100% McCarthy, Bruce 1 1 1 1 1 1 1 1 1 9 90% Plumb-Smith, Jill 1 1 1 1 1 1 1 1 1 9 90% Richman, Lori 1 1 1 1 1 1 1 1 1 1 10 100% Scherer, Matthew 1 1 1 1 1 1 1 1 8 80% Atri, Nihar (s) 1 1 2 100% Clark, Anna (s) 1 1 2 100% Khariwala, Anand (s) 1 1 2 100% Olson, Larry 1 1 Term Expired 2 N/A Ruthruff, Erik 1 1 1 1 1 1 1 1 1 Resigned 9 N/A Erickson, Tayden (s) 1 1 1 1 1 1 1 Term Expired 7 N/A Venell, Simon (s) 1 1 1 1 1 Term Expired 5 N/A APPENDIX H Resident Questionnaires 33.93%19 66.07%37 Q1 Does your property have drainage issues the City should know about?Examples: History of flooding/standing water, grading, backyard drain, nuisance sump pump, etc. Answered: 56 Skipped: 0 TOTAL 56 #PLEASE COMMENT ON THE TYPES PROBLEMS YOU HAVE:DATE 1 Our driveway (5616 Melody Lake Drive) has a very low grade from the garage to the street, so low that we worry if the new road is higher water will back up into our house. We've discussed this with street surveyors and via email with Aaron at the city. Also, to complicate matters, several of our neighbor's yards drain significantly into ours and out our driveway in the spring. 8/25/2019 11:14 AM 2 We are concerned about the damage your plan would do to our water & gas mains and the damage to our curbs and the damage to our property generally. I understand that your plan would an assess us with a BIG tax bill for this! 7/27/2019 11:27 AM 3 backyard drain 7/20/2019 4:43 AM 4 Corner of code & MLDR - going into the pond.7/10/2019 9:45 AM 5 I have a flat lot & in ground basement. Sump pump added 30 years ago which keeps house dry.7/10/2019 9:42 AM 6 We have standing water at the end of our driveway that continues to deteriorate our driveway and our front lawn. The water is minimal 6 feet in length each rainfall. 7/4/2019 11:14 AM 7 our property is the lowest in our area, our neighbors rain / snow run into ours - back yard only 7/3/2019 6:21 AM 8 I think the city already knows as it's really a part of the street and not my property. The issue is the snow melt or heavy rain as it drains downward on Melody Lake Drive from Code and the erosion that occurs. 6/25/2019 8:12 AM 9 We have some flooding in our backyard with standing water. The location of our house means that much of the water from the higher elevated homes flow through our yard to get to Melody Lake. This causes issues with standing water in our backyard (our basement has not flooded yet) and severe problems with ice build up in the late winter/ early spring problems. The ice builds up on our driveway and street, making it difficult to drive. 6/17/2019 3:05 AM 10 Sump pump runs constantly in wet weather. The old timers in the neighborhood claim an underground stream runs through the property. 6/16/2019 6:48 PM Yes No 0%10%20%30%40%50%60%70%80%90%100% ANSWER CHOICES RESPONSES Yes No 1 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire 11 Heavy rain down Melody Lake Drive washes out gardens and south side towards lake.6/16/2019 4:58 AM 12 5724 hansen road. water runs down the road but driveway curb isnt tall enough to prevent water from bending into driveway and down side of house to back yard. 6/15/2019 5:02 AM 13 Basement flooded this spring due to grading issues 6/14/2019 7:31 AM 14 We have grading in front & back as well as drain tile all they way down. When it rains heavily &/or for day sump pump runs a lot. 6/13/2019 8:39 AM 15 standing water in the back yard and at the end of the driveway. had water flood into the basement this spring due to grading issues. 6/10/2019 4:32 PM 16 Standing water backyard 6/10/2019 3:50 PM 17 at end of driveway, rain water rushing down the street ... pools on each side of the driveway and kills whatever grass we plant there... 6/10/2019 7:58 AM 18 We had to install a drainage field and French drain system to prevent rain runoff basement flooding. 6/10/2019 6:21 AM 19 When Minnehaha creek floods the water table rises so that I get water in my basement.6/10/2019 4:50 AM 20 During HEAVY rains, we do get a little water in the southwest (front left) corner of our basement.6/10/2019 3:06 AM 2 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire 67.86%38 23.21%13 8.93%5 Q2 How concerned are you with the speed of traffic in your neighborhood or on your street? Answered: 56 Skipped: 0 TOTAL 56 Not Concerned Concerned Very Concerned 0%10%20%30%40%50%60%70%80%90%100% ANSWER CHOICES RESPONSES Not Concerned Concerned Very Concerned 3 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire 100.00%18 100.00%18 Q3 If concerned or very concerned, please enter the location(s) and describe why you feel that way. Answered: 18 Skipped: 38 #LOCATION OF ISSUE:DATE 1 Bernard Place from Benton to West 56th 7/27/2019 11:27 AM 2 5621 Hansen Road 7/20/2019 5:37 AM 3 Grove Street 7/14/2019 7:25 AM 4 c/o West 56th Street and Code Ave.7/14/2019 7:18 AM 5 5604 Code Ave 7/3/2019 6:21 AM 6 Intersection of Melody Lane and Melody Lake Drive 6/29/2019 11:38 AM 7 Hansen Road 6/18/2019 9:16 AM 8 5724 hansen road & grove 6/15/2019 5:02 AM 9 W 56th near Dale 6/13/2019 8:39 AM 10 On Code just past 56th intersection 6/12/2019 6:19 AM 11 code ave between grove and melody lake drive 6/11/2019 5:57 AM 12 Hansen Road between vernon and benton 6/10/2019 4:32 PM 13 Too fast on Hansen 6/10/2019 3:50 PM 14 Grove St. and Code 6/10/2019 11:44 AM 15 56th and Code Avenue 6/10/2019 6:21 AM 16 Melody Lane 6/10/2019 5:28 AM 17 56th St 6/10/2019 4:50 AM 18 In front of my home 6/10/2019 3:06 AM #WHY IS IT AN ISSUE OF CONCERN?DATE 1 See Above!7/27/2019 11:27 AM 2 Hansen road has became a major thoroughfare with huge construction trucks going by all day long. Along with regular traffic that is driving well above the posted 30mph speed limit. Garden park is across the street and many residents walk, bike, jog, skate, etc to and from the park on Hansen road next to the speeding and careless drivers. 7/20/2019 5:37 AM 3 speed of cars 7/14/2019 7:25 AM 4 Cars speed on Code (no stop sign at W. 56th St) and cars something only slow down for stop sign (not full stop) 7/14/2019 7:18 AM 5 Kids playing the yards, people walking & with dogs, curved street 7/3/2019 6:21 AM 6 Three-way intersection with two lanes coming down hills.6/29/2019 11:38 AM 7 Cars tunr off Vernon, speed over tracks up to Benton and vice versa (often well over 40mph)6/18/2019 9:16 AM 8 there should be a stop sign at grove and hansen. every winter i watch dozens of cars slide down grove while cars speed down hansen. difficult to back out of driveway because people are easily going 40mph 6/15/2019 5:02 AM ANSWER CHOICES RESPONSES Location of issue: Why is it an issue of concern? 4 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire 9 too many cars park around corner & no stop sign, people zoom around parked cars & I have little kids. 6/13/2019 8:39 AM 10 That part of code is downhill and cars are often seen speeding down Code and Melody Lake 6/12/2019 6:19 AM 11 cars speed going down hill 6/11/2019 5:57 AM 12 people speed very quickly between these roads and with no sidewalks it can be scary to walk on the road or have my kids play in the front yard 6/10/2019 4:32 PM 13 Kids in and out of park garden 6/10/2019 3:50 PM 14 People drive at a high rate of speed through this area and there is somewhat of a blind hill that has caused cars to come upon pedestrians at a high rate of speed and with little time to slow down. 6/10/2019 11:44 AM 15 Many drivers do not stop at stop sign - cars traveling north on Code up the hill from Melody Lake can not be seen from the intersection. Have seen a number of very near misses. 6/10/2019 6:21 AM 16 Because it’s downhill and cars pick up a lot of speed coming down the hill.6/10/2019 5:28 AM 17 Curve in 56th St & parking for group homes make it hard to see oncoming traffic.6/10/2019 4:50 AM 18 It's the bottom of a slope, we're at the bottom 6/10/2019 3:06 AM 5 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire 83.93%47 12.50%7 3.57%2 Q4 How concerned are you with the volume of traffic or the number of vehicles in your neighborhood or on your street? Answered: 56 Skipped: 0 TOTAL 56 Not Concerned Concerned Very Concerned 0%10%20%30%40%50%60%70%80%90%100% ANSWER CHOICES RESPONSES Not Concerned Concerned Very Concerned 6 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire 88.89%8 77.78%7 Q5 If concerned or very concerned, please enter the location(s) and describe why you feel that way. Answered: 9 Skipped: 47 #LOCATION OF ISSUE:DATE 1 Vernon Avenue 7/29/2019 4:58 AM 2 5621 Hansen Road 7/20/2019 5:44 AM 3 Hansen Rd 6/18/2019 9:17 AM 4 Vernon and Hansen. There is a large amount of volume on Vernon making it difficult to get out on the road when leaving the neighborhood. 6/17/2019 3:07 AM 5 5724 hansen road 6/15/2019 5:03 AM 6 Hansen road between benton and vernon 6/10/2019 4:33 PM 7 Hansen & Vernon 6/10/2019 3:50 PM 8 56th St & Dale Ave 6/10/2019 4:51 AM #WHY IS IT AN ISSUE OF CONCERN?DATE 1 Hard to enter Vernon Ave and Area by Jerry’s is extremely dangerous for walkers. Too much traffic! 7/29/2019 4:58 AM 2 The number of vehicles has definitely increased since I've lived here. During the day, it's large construction or semi trucks or delivery trucks going by. The morning rush and afternoon rush has gotten very heavy with traffic. 7/20/2019 5:44 AM 3 IT is a shortcut to Benton etc, from Vernon 6/18/2019 9:17 AM 4 Would always like less.6/13/2019 8:40 AM 5 very high traffic area with the parks and schools near by. it is a cut through to get to vernon or benton easily not taking the freeway. 6/10/2019 4:33 PM 6 Backups rush hour Vernon east bound 6/10/2019 3:50 PM 7 Group home has multiple cars that park on the street where 56th curves making it hard to see oncoming traffic. 6/10/2019 4:51 AM ANSWER CHOICES RESPONSES Location of issue: Why is it an issue of concern? 7 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire 55.36%31 37.50%21 7.14%4 Q6 How concerned are you with motorist behavior in your neighborhood? (Examples of poor motorist behavior include speeding, rolling through stop signs, failing to yield and driving aggressively.) Answered: 56 Skipped: 0 TOTAL 56 Not Concerned Concerned Very Concerned 0%10%20%30%40%50%60%70%80%90%100% ANSWER CHOICES RESPONSES Not Concerned Concerned Very Concerned 8 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire 92.59%25 85.19%23 Q7 If concerned or very concerned, please enter the location(s) and describe why you feel that way. Answered: 27 Skipped: 29 #LOCATION OF ISSUE:DATE 1 Intersection of Melody Lake Drive and Melody Lane 8/25/2019 11:14 AM 2 corner of 56th and Dale Ave 8/4/2019 3:15 AM 3 See above 7/27/2019 11:30 AM 4 Garden park, intersection of Hansen & Benton, intersection of Hansen & W56th St.7/20/2019 5:58 AM 5 Grove and Dale 7/14/2019 7:26 AM 6 C/o West 56th and Code Ave.7/14/2019 7:19 AM 7 Frontage road & Eden Ave - 4 way stop & Tracy & Benton - Countryside School 7/10/2019 9:46 AM 8 Intersection of W 56th & Dale Streets 7/10/2019 9:38 AM 9 5604 Code Ave 7/3/2019 6:23 AM 10 56th and code 7/1/2019 6:30 AM 11 Intersection Melody Lane and Melody Lake Drive 6/29/2019 11:39 AM 12 Benton & Hansen Rd and Hansen Rd & Vernon Ave 6/21/2019 3:32 AM 13 Hansen Rd 6/18/2019 9:17 AM 14 This happens mostly on Benton. Some motorists drive too fast.6/17/2019 3:07 AM 15 E/W bound on Benton @ Tingdale intersection 6/16/2019 2:51 PM 16 56th & Code inattentive of stop signs. Benton & Tingdale failure to yield at stop signs. Poor visibilty (shrubs) at Bernard & Benton. 6/16/2019 5:07 AM 17 5724 hansen road 6/15/2019 5:04 AM 18 Code and 56th intersection 6/12/2019 6:20 AM 19 Hansen road between benton and vernon 6/10/2019 4:34 PM 20 54th St 6/10/2019 12:06 PM 21 Tingdale and Benton 6/10/2019 11:46 AM 22 see earlier comment about people speeding through the stop sign 6/10/2019 6:22 AM 23 Cars drive fast down the Melody Lane Hill heading north 6/10/2019 5:29 AM 24 56th St & Dale Ave 6/10/2019 4:53 AM 25 In front of my house 6/10/2019 3:07 AM #WHY IS IT AN ISSUE OF CONCERN?DATE 1 The street is curvy and hilly near the junction right in front of our driveway, in the winter it can be hard to stop if driving too fast, etc. 8/25/2019 11:14 AM 2 It is a blind corner when cars are parked too close to the intersection 8/4/2019 3:15 AM 3 see above 7/27/2019 11:30 AM ANSWER CHOICES RESPONSES Location of issue: Why is it an issue of concern? 9 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire 4 People drive thru Hansen & Benton all the time. Or roll thru barely stopping. In Garden Park, young drivers are often doing donuts, goofing off, buying drugs, smoking and drinking in the woods, etc. It gets scary when they get out on Hansen & gun it up to Benton. Also the intersection of Hansen & W56th street is quite scary. Granted it is hard to see from W56th street onto Hansen, but drivers often pull right out onto Hansen. Many drivers going north on Hansen turn right onto W56th without signaling or slowing down. W56th street is very narrow and people drive very fast along there. My biggest concern with that is my son no longer gets picked up by the bus in front of our house. Now he has to walk to W56th street & Bernard place to catch the bus. I'm very concerned a driver won't see him in the early hours or during rain or snow. It seems like an accident waiting to happen. 7/20/2019 5:58 AM 5 rolling through stop signs, speeding 7/14/2019 7:26 AM 6 speeding and rolling through stop signs 7/14/2019 7:19 AM 7 Parking of vehicle at intersection blocks visibility for cars/bikes traveling east on West 56th St.7/10/2019 9:38 AM 8 Previously address in the earlier response 7/3/2019 6:23 AM 9 people drive through stop sign 7/1/2019 6:30 AM 10 Speed of drivers 6/29/2019 11:39 AM 11 Rolling through Stop signs 6/21/2019 3:32 AM 12 Driving fast; failing to yield 6/18/2019 9:17 AM 13 drivers don't stop 6/16/2019 2:51 PM 14 Possible collison thret.6/16/2019 5:07 AM 15 cars speeding on hansen all the time. i get honked at when backing out onto road. if pulling into drive way, cars go in other lane vs slow down 6/15/2019 5:04 AM 16 People zoom down the street, I've literally watched 2 accidents occur on 56th & Dale due to driving too fast and parked cars. 6/13/2019 8:41 AM 17 Speeding down Code and Melody Lake 6/12/2019 6:20 AM 18 People drive poorly all over the city. Hopefully the hands free legislation will change things.6/12/2019 3:53 AM 19 heavy traffic road; inattentive, young drivers; speeding is quite common 6/10/2019 4:34 PM 20 Going too fast with so many people walking/playing in the street 6/10/2019 12:06 PM 21 Almost every car does not stop at this stop sign. We have attempted to cross several times and had cars literally run the stop sign right in front of us 6/10/2019 11:46 AM 22 56th St has a curve plus there are multiple cars parked in front of the group home.6/10/2019 4:53 AM 23 see previous answer 6/10/2019 3:07 AM 10 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire 45.95%17 5.41%2 48.65%18 Q8 In general, these behaviors impact you most when you are: Answered: 37 Skipped: 19 TOTAL 37 Driving Bicycling Walking, jogging or... 0%10%20%30%40%50%60%70%80%90%100% ANSWER CHOICES RESPONSES Driving Bicycling Walking, jogging or running 11 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire 60.38%32 39.62%21 Q9 Do you feel that any intersection in your neighborhood is unsafe? Answered: 53 Skipped: 3 TOTAL 53 #IF YES, WHICH INTERSECTION?DATE 1 56th Street and Code Ave, very top of the hill 8/25/2019 11:14 AM 2 Dale and 56th as noted above, when cars are parked too close to it 8/4/2019 3:16 AM 3 NW Corner of Dale and Grove. Bushes obscure stop sign until you are almost on top of it 8/2/2019 10:28 AM 4 Vernon by Jerry’s Foods 7/29/2019 5:02 AM 5 W56th St. & Hansen Road, Hansen & Vernon Avenue South & Hansen & Benton 7/20/2019 6:01 AM 6 West 56th Street & Code Avenue 7/10/2019 9:39 AM 7 Hansen Road and Vernon Ave. No cars ever pay attention to pedestrians.7/4/2019 11:16 AM 8 Entrance ramp - 50th Street and Hwy 100 going south 7/3/2019 6:24 AM 9 56th + Code, 56th + xxx 6/25/2019 12:45 AM 10 corner of Dale and 56th Street - difficult to see when making a left hand turn from Dale 6/21/2019 8:06 AM 11 Hansen Rd & Vernon Ave 6/21/2019 3:33 AM 12 Vernon and Hansen Rd 6/18/2019 9:18 AM 13 SB entrance to Hwy 100 by OLG sport field 6/17/2019 11:11 AM 14 Intersections between Dale & Grove and Bernard & Grove. Since there is not a 4 way stop sign, many motorists will not pay attention to incoming traffic. 6/17/2019 3:08 AM 15 Benard and Benton (southbound-bushes obstruct view 6/16/2019 6:29 PM 16 benton and Tingdale 6/16/2019 12:35 PM 17 See above listings.6/16/2019 5:11 AM 18 hansen & grove 6/15/2019 5:04 AM 19 Hansen and vernon avenue 6/14/2019 7:32 AM 20 Dale & 56th 6/13/2019 8:41 AM Yes No 0%10%20%30%40%50%60%70%80%90%100% ANSWER CHOICES RESPONSES Yes No 12 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire 21 Code and 56th 6/12/2019 5:09 AM 22 Benton and Bernard 6/11/2019 2:18 PM 23 Bernard Place & Benton Ave 6/11/2019 1:29 PM 24 the west ramp to south bound 100 6/11/2019 5:59 AM 25 Benton and hansen - no sideway on hansen; hansen past garden park after the railroad tracks - there is a hill (visibility is difficult) and no sidewalk 6/10/2019 4:35 PM 26 Need cross walks from Hanton across Vernon. Also by OLG across grand view. Makes no sense to use cross walk at HWY 100 on ramp 6/10/2019 12:09 PM 27 Tingdale and Benton 6/10/2019 11:46 AM 28 56th and Code Ave.6/10/2019 6:23 AM 29 Melody Lane and Melody Lake Drive 6/10/2019 5:30 AM 13 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire 13.89%5 66.67%24 38.89%14 13.89%5 16.67%6 5.56%2 0.00%0 11.11%4 38.89%14 Q10 Which, if any, of the following factors contribute to your feeling that the intersection is unsafe? (select all that apply) Answered: 36 Skipped: 20 Total Respondents: 36 #OTHER (PLEASE SPECIFY)DATE 1 Occasionally people don't stop or pull out when cars are heading up the hill, can be very dangerous, could be they don't see the cars coming up? 8/25/2019 11:14 AM Lack of traffic cont... Issues with sight lines ... Drivers failing to s... Drivers failing to... Drivers turning corn... Lack of marked crosswalk Street(s) too wide Insufficient Lighting Other (please specify) 0%10%20%30%40%50%60%70%80%90%100% ANSWER CHOICES RESPONSES Lack of traffic control (traffic signal, stop sign, yield sign) Issues with sight lines or clear view Drivers failing to stop at stop sign Drivers failing to yield Drivers turning corner too fast Lack of marked crosswalk Street(s) too wide Insufficient Lighting Other (please specify) 14 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire 2 56th is a bit too narrow by the railroad tracks 8/4/2019 3:16 AM 3 Too many cars and everyone is in a hurry 7/29/2019 5:02 AM 4 W56th St. too narrow 7/20/2019 6:01 AM 5 Don't have any concerns 7/12/2019 11:27 AM 6 4-way stop sign would make it unnescessary for vehicles traveling wast on 56th St to advance into the intersection to see vehicles traveling north on Code Avenue. 7/10/2019 9:39 AM 7 Cars are not looking for pedestrians to cross as they are so concerned about turning.7/4/2019 11:16 AM 8 on-street parking in curved road 6/25/2019 12:45 AM 9 Can be difficult to turn on to Vernon during morning and afternoon traffic times.6/21/2019 3:33 AM 10 traffic volumes and speed 6/14/2019 7:32 AM 11 Trees and shrubs block view turning off Bernard onto Benton 6/11/2019 2:18 PM 12 Bushes frequently obstruct view of oncoming traffic 6/11/2019 1:29 PM 13 the sight line is wrong for yield sign, should be on other lane 6/11/2019 5:59 AM 14 tall plants on NW corner of Code and Grove 6/10/2019 8:00 AM 15 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire 75.00%27 2.78%1 22.22%8 Q11 In general, the intersection feels most unsafe when you are: Answered: 36 Skipped: 20 TOTAL 36 Driving Bicycling Walking, jogging,... 0%10%20%30%40%50%60%70%80%90%100% ANSWER CHOICES RESPONSES Driving Bicycling Walking, jogging, running 16 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire 38.89%21 20.37%11 24.07%13 14.81%8 1.85%1 Q12 How frequently do you walk, jog or run in your neighborhood? Answered: 54 Skipped: 2 TOTAL 54 Very frequently... Frequently(2-3 times p... Occasionally (1-4 times p... Rarely (less than once pe... Never 0%10%20%30%40%50%60%70%80%90%100% ANSWER CHOICES RESPONSES Very frequently (daily or near daily) Frequently (2-3 times per week) Occasionally (1-4 times per month) Rarely (less than once per month) Never 17 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire 95.83%46 16.67%8 2.08%1 6.25%3 8.33%4 Q13 If you walk, jog or run in your neighborhood, what are your primary reasons for doing so? (select all that apply) Answered: 48 Skipped: 8 Total Respondents: 48 #OTHER (PLEASE SPECIFY)DATE 1 Visiting our neighbors 7/27/2019 11:36 AM 2 enjoy neighborhood/see neighbors 7/20/2019 4:45 AM 3 Dog 7/4/2019 11:17 AM 4 Walking our dog 6/10/2019 6:23 AM Health/exercise Travel to/from destination... Commute to/from work Access transit Other (please specify) 0%10%20%30%40%50%60%70%80%90%100% ANSWER CHOICES RESPONSES Health/exercise Travel to/from destination (such as store, coffee shop) Commute to/from work Access transit Other (please specify) 18 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire Q14 If you don't walk, jog or run in your neighborhood as often as you would like, what reconstruction improvement might increase your walking, jogging or running? Please list all that you can think of. Answered: 20 Skipped: 36 #RESPONSES DATE 1 None 8/5/2019 3:22 PM 2 Whatever would increase safety. Also trim bushes and vegetation next to sidewalk on Vernon that are taking over the sidewalk and covering sight of signage. 7/29/2019 5:06 AM 3 SEE PREVIOUS 7/27/2019 11:36 AM 4 A sidewalk put in on Hansen Road to give safe access to Garden Park. Same with W56th St.7/20/2019 6:03 AM 5 N/A 7/14/2019 7:20 AM 6 Although I do walk, sidewalks would greatly improve safety.7/10/2019 9:40 AM 7 There are no sidewalks on our road.7/4/2019 11:17 AM 8 Sidewalks 6/25/2019 12:46 AM 9 None - I loath exercise 6/21/2019 8:07 AM 10 street to busy with traffic & speeds. Needs sidewalks for walking ability 6/18/2019 9:19 AM 11 Not an issue for me 6/17/2019 11:12 AM 12 I don't think this is possible, but to have public trash cans through out the Melody Lake neighborhood for doggy bags would be great. Maybe just by Melody Lake, where there is city land. Often, we walk our dog and have to carry doggy bags through the walk. If there were occasional spaces to dispose of the doggy bag that would be great. I often read of neighbors on the Next Door app complaining about other dog walkers disposing of the doggy bags in their waste containers. 6/17/2019 3:12 AM 13 DO NOT NARROW OUR STREETS!!!6/16/2019 2:54 PM 14 the roads are horrible and full of pot holes. let's start there. dont want massive sidewalk that are offset 3-4 feet off street. front yard on hansen is already small and house sits close to road due to year it was build in 1920. sidewalk on west side of hansen is invasion of privacy. 5724 hansen road 6/15/2019 5:07 AM 15 sidewalks and lighting 6/14/2019 7:33 AM 16 No sidewalk on 56th please 6/13/2019 8:42 AM 17 Pavement improvement. My kids can't even ride their bikes on our street because of the condition of the road. Potholes, uneven pavement, debris 6/12/2019 6:21 AM 18 None 6/11/2019 2:19 PM 19 sidewalks; additional street lights 6/10/2019 4:35 PM 20 do not want sidewalks in our neighborhood 6/10/2019 6:23 AM 19 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire 13.46%7 7.69%4 21.15%11 23.08%12 34.62%18 Q15 How frequently do you ride a bicycle in your neighborhood? Answered: 52 Skipped: 4 TOTAL 52 Very frequently... Frequently(2-3 times p... Occasionally (1-4 times p... Rarely (less than once pe... Never 0%10%20%30%40%50%60%70%80%90%100% ANSWER CHOICES RESPONSES Very frequently (daily or near daily) Frequently (2-3 times per week) Occasionally (1-4 times per month) Rarely (less than once per month) Never 20 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire 87.50%28 15.63%5 3.13%1 0.00%0 12.50%4 Q16 If you ride a bicycle in your neighborhood, what are your primary reasons for doing so? (select all that apply) Answered: 32 Skipped: 24 Total Respondents: 32 #OTHER (PLEASE SPECIFY)DATE 1 DOES NOT APPLY 7/27/2019 11:37 AM 2 N/A 7/14/2019 7:21 AM 3 Our kids ride up and down our road almost daily.7/4/2019 11:17 AM 4 Children recreation 6/12/2019 6:22 AM Health/exercise Travel to/from destination... Commute to/from work Access transit Other (please specify) 0%10%20%30%40%50%60%70%80%90%100% ANSWER CHOICES RESPONSES Health/exercise Travel to/from destination (such as store, coffee shop) Commute to/from work Access transit Other (please specify) 21 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire Q17 If you don't ride a bicycle in your neighborhood as often as you would like, what reconstruction improvement might increase your bicycle riding frequency? Please list all that you can think of. Answered: 11 Skipped: 45 #RESPONSES DATE 1 none 8/5/2019 3:22 PM 2 Bike lane, safe traffic control. I don't trust the speeding drivers on Hansen or Vernon Avenue south. 7/20/2019 6:04 AM 3 N/A 7/14/2019 7:21 AM 4 None 7/10/2019 9:46 AM 5 Possible bike lane on Hansen Rd 6/21/2019 3:35 AM 6 DO NOT NARROW THE STREETS!!!6/16/2019 2:55 PM 7 again, the roads are horrible. kids can barely ride bike without wheels getting stuck in massive cracks. 6/15/2019 5:08 AM 8 construction in Edina is pushing traffic into residential neighborhoods causing safety concerns 6/14/2019 8:00 AM 9 Poor condition of roads including potholes, uneven pavement and debris on the road 6/12/2019 6:22 AM 10 None. I am too old 6/11/2019 2:19 PM 11 speed bumps so people slow down; sidewalks; better lighting 6/10/2019 4:36 PM 22 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire 7.55%4 3.77%2 15.09%8 41.51%22 32.08%17 Q18 How frequently do you or a member of your household park on the street? Answered: 53 Skipped: 3 TOTAL 53 Very frequently... Frequently (2-3 times p... Occasionally (1-4 times p... Rarely (less than once pe... Never 0%10%20%30%40%50%60%70%80%90%100% ANSWER CHOICES RESPONSES Very frequently (daily or near daily) Frequently (2-3 times per week) Occasionally (1-4 times per month) Rarely (less than once per month) Never 23 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire 3.77%2 11.32%6 39.62%21 39.62%21 5.66%3 Q19 How frequently do visitors to your household park on the street? Answered: 53 Skipped: 3 TOTAL 53 Very frequently... Frequently(2-3 times p... Occasionally (1-4 times p... Rarely (less than once pe... Never 0%10%20%30%40%50%60%70%80%90%100% ANSWER CHOICES RESPONSES Very frequently (daily or near daily) Frequently (2-3 times per week) Occasionally (1-4 times per month) Rarely (less than once per month) Never 24 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire 49.06%26 35.85%19 11.32%6 1.89%1 0.00%0 Q20 How satisfied are you with the availability of on-street parking in your neighborhood? Answered: 53 Skipped: 3 TOTAL 53 #ANY ADDITIONAL COMMENTS ABOUT PARKING?DATE 1 But I think it should be overnite and not restricted 7/10/2019 9:51 AM 2 Too many cars parked on the street and it narrows the street and obstructs flow of traffic 6/18/2019 9:21 AM 3 If the streets were any more narrow the thru traffic would have problems negotiating parked vehicles and oncoming traffic (vehicles/pedestrians) 6/16/2019 6:34 PM 4 DO NOT NARROW THE STREETS!!!6/16/2019 2:57 PM 5 Our next door neighbor who has a corner lot on Dale & 56th parks in front of our house instead of theirs all the time and never utilizes their driveway. Drives me bonkers! 6/13/2019 8:44 AM 6 No street parking but n Hansen allowed 6/10/2019 3:54 PM Very satisfied Satisfied Neutral Dissatisfied Very dissatisfied 0%10%20%30%40%50%60%70%80%90%100% ANSWER CHOICES RESPONSES Very satisfied Satisfied Neutral Dissatisfied Very dissatisfied 25 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire Q21 Please tell us anything else you would like us to know about existing traffic or street conditions in your neighborhood. Answered: 18 Skipped: 38 #RESPONSES DATE 1 Streets are safe and good as they are except for maintenance of the roadway which is terrible: potholes, irregular pateches, and uneven surfaces. 8/5/2019 3:25 PM 2 Do not want sidewalks 8/2/2019 10:30 AM 3 Large pool of water on 53rd and Windsor stays for days after a rain.7/29/2019 5:09 AM 4 What construction will do to current manholes, I.e. height of manholes--will they stick up above street level? 7/12/2019 11:32 AM 5 Are terrible - need new street.7/10/2019 9:51 AM 6 Drainage is a big issue for all of us.7/4/2019 11:18 AM 7 Love the concrete roadway and don't want a different surface.6/21/2019 8:08 AM 8 Exiting our driveway at 5511 Hansen Rd, it can be difficult to see the north bound traffic on Hansen 6/21/2019 3:38 AM 9 This street is too loaded with traffic and the hill from Benton creates speeding. Way too much street parking in a neighborhood with sufficient driveway space at each house. 6/18/2019 9:21 AM 10 My street (Melody Lake Drive) is very deteriorated 6/17/2019 11:13 AM 11 We don't like curbs 6/16/2019 6:34 PM 12 DO NOT NARROW THE STREETS!!!6/16/2019 2:57 PM 13 stop sign at hansen and grove. dual purpose walking and bike path marked near curb of road but NO SIDEWALKS and NO ADDED Bike lane 6/15/2019 5:10 AM 14 streets are in horrible state in Edina. Pot holes, construction, and the pushing of traffic into neighborhoods is contributing to the deterioration of streets. Even streets that have recently been repaved are in rough shape after just a couple years 6/14/2019 8:03 AM 15 No sidewalk and please don't rip put or ruin plants and trees. It will change neighborhood feel and isn't necessary. 6/13/2019 8:44 AM 16 The house on the SE corner of Code and 56th is a home for handicapped adults. The caregivers park on the street all day everyday and cause an already title intersection more congested. I have often witness close calls with bikers and walkers. 6/12/2019 5:18 AM 17 Dale to Hansen on 56th is very narrow. Just enough width for 2 cars passing. Not enough room to add a sidewalk. Intersection at 56th and Hansen is difficult because of RR crossing. 6/11/2019 2:24 PM 18 Hansen rd is in brutal condition 6/10/2019 3:54 PM 26 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire 28.30%15 71.70%38 Q22 Do you favor improving the streetlights in your neighborhood (residential streetlights are funded by special assessment)? Answered: 53 Skipped: 3 TOTAL 53 #OTHER (PLEASE SPECIFY)DATE 1 Streetlights lave already been improved last year.7/10/2019 9:32 AM 2 I have spoken to the city engineer on this issue and he is supportive of replacing the old, existing pole as it has significantly deteriorated. LED would be superior to existing lamp. 6/17/2019 5:13 AM 3 I think our street lights are adequate.6/17/2019 3:13 AM 4 There was just an upgrade to our streetlights that was a nice improvement.6/16/2019 2:57 PM 5 NO!6/13/2019 8:44 AM 6 Been here 50 years, Never been a problem 6/11/2019 2:24 PM 7 Current light shines on house to much 6/11/2019 6:02 AM 8 Not at this time -- still paying off last special assessment.6/10/2019 6:25 AM 9 We don’t need any more street lights on Melody Lane. The one LED installed is bright enough already 6/10/2019 5:32 AM Yes No 0%10%20%30%40%50%60%70%80%90%100% ANSWER CHOICES RESPONSES Yes No 27 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire 9.62%5 0.00%0 13.46%7 21.15%11 11.54%6 13.46%7 17.31%9 7.69%4 5.77%3 Q23 What is your street name? Answered: 52 Skipped: 4 TOTAL 52 W 56th Street W 57th Street Bernard Place Code Avenue Dale Avenue Hansen Road Melody Lake Drive Melody Lane Windsor Avenue 0%10%20%30%40%50%60%70%80%90%100% ANSWER CHOICES RESPONSES W 56th Street W 57th Street Bernard Place Code Avenue Dale Avenue Hansen Road Melody Lake Drive Melody Lane Windsor Avenue 28 / 28 Melody Lake A/Grandview A Neighborhood Roadway Reconstruction Resident Questionnaire Neighborhood Reconstruction Survey SURVEY RESPONSE REPORT 30 January 2019 - 10 August 2020 PROJECT NAME: Melody Lake A & B, Birchcrest C and Grandview A Neighborhood Roadway Reconstruction SURVEY QUESTIONS Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 1 of 34 Q1 Does you property have drainage issues the City should know about? Examples: History of flooding/standing water, grading, b... 12 (27.9%) 12 (27.9%) 31 (72.1%) 31 (72.1%) Yes No Question options Mandatory Question (43 response(s)) Question type: Radio Button Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 2 of 34 grading issue resulting in standing water in back yard with heavy rains Standing water in my backyard and side yard after major rains & spring snow melt Spring snow melt causes our sump pump to operate heavily each year for 4- 5 weeks Grading isn't great in front of front door, some standing water occasionally on the benton side It's not really an issue and I've never personally had a problem yet (knock on wood) ince a previous owner installed drain tile and sump pump but it is still something that is on my mind. Standing water in a flat area below a hillside whenever there’s a hard rain. Especially bad in the spring. The street area adjacent to edge of our driveway (and into our driveway) always fills with water after a significant rain or snowmelt. We call it "Lake Eastview" as the pool of water collects and has nowhere to drain to. curb is not high enough, so road water flows onto and down our driveway often flooding back yard Winter Thaw drainage issues that happens all along the backyards on my street that have backed up into my basement in the past. drainage plain from homes uphill from us We have a backyard drain. Erosion Q2 Please comment on any drainage issues. Optional question (12 response(s), 31 skipped) Question type: Essay Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 3 of 34 Q3 How concerned are you with the speed of traffic in your neighborhood or on your street? 25 (58.1%) 25 (58.1%) 10 (23.3%) 10 (23.3%) 8 (18.6%) 8 (18.6%) Not Concerned Concerned Very Concerned Question options Optional question (43 response(s), 0 skipped) Question type: Radio Button Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 4 of 34 speeding down W 60th St @ times Very concerned about the speed on Tingdale Ave across from Tingdale Park. You can’t see the park until you too close. The park is very busy with young children. People drive fast on straight roads. It occurs on every straight road in Melody Lakes 5908 Hansen Road- People speed up and down the hill 5300 Benton Ave. Lack of stop signs, wide roads allow for people to accelerate through this area without regard for pedestrian traffic. Grove St. west of Melody Lake park people cut through to Hanson at very high speed. Near Tingdale and Benton, some cars pick up speed after making their turn. We have little kids that play on our driveway sometimes next to the that intersection. Code Ave., between 60th and Benton. We often observe cars roaring up or down the hill in front of our house. Our short 1-block segment of road, Eastview Dr, is used as a cut through. Speeds are frequently higher than appropriate for a purely residential street. Hansen Road near Garden park- motorists go extremely fast, probably because it's a cut through street. My kids walk to that park and the only easy way to get there is on Hansen. There is no sidewalk on portions of Hansen, cars can park on either side of the street and are often not in the middle of the road as well. Roads and rules are not well marked. 5724 hansen road. constantly seeing cars drive 30MPH. Grove street is a T onto Hansen.. all winter we see cars slide down Grove street onto Hansen Road hoping that oncoming traffic on hansen doesnt hit them People coming from the West on Benton Ave go to fast and also the stop sign in both directions at Tingdale and Benton, people fly through it without thinking of stopping. On average, we see probably 30-35% of people stop. Q4 If concerned or very concerned, please enter the location(s) of concern and why you feel that way. Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 5 of 34 Corner of Hansen Rd & Benton Ave. 4-way stop intersection of two fairly busy roadways, however no sidewalks, many drivers blow through stop, and a residential area with yards right up to edge of the street. Since there is no stop sign or speed bump between Benton and Vernon there are an excessive number of speeders (not just cars) going North down the hill from Benton. There are also speeders going South from Vernon to Benton but not quite as frequent. My understanding is that Hansen is a County Road and an alternate emergency route for emergency vehicles but something really needs to be done. Many people speed between On Tingdale ave between Benton and Grove as they perceive there are very few residential driveways on that stretch of road. Tingdale Ave adjacent/along Tingdale Park. Many, many kids and families are present and vehicles frequently drive too fast with no regard to people in or near the park. Grove Street - cars come flying through the intersection of Grove and Dale and there is no stop sign for the Grove traffic. Hanson has no sidewalk - it is also heavily used with lots of fast cars. It needs a sidewalk from Garden Park to Benton Ave so kids can safely traverse the neighborhood. Tingdale & 59th run along the side of Tingdale Park so kids are riding their bikes to/from or running to the park. If either of those streets get narrowed and cars are parked on the curb, it will create a very dangerous situation. Optional question (18 response(s), 25 skipped) Question type: Essay Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 6 of 34 Q5 How concerned are you with the volume of traffic or number of vehicles in your neighborhood or on your street? 34 (79.1%) 34 (79.1%) 5 (11.6%) 5 (11.6%) 4 (9.3%) 4 (9.3%) Not Concerned Concerned Very Concerned Question options Optional question (43 response(s), 0 skipped) Question type: Radio Button Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 7 of 34 A lot of people use our road as a shortcut to 62 Non-residents use this street to cut through our neighborhood for access to major roads. Because they don’t live here, they have little regard for speed limits and pedestrian traffic. 5300 Benton Ave. Lots of cars cutting through from benton to Hanson Too many people cut through neighborhood during rush hour traffic. See response above (Hansen & Benton) - many drivers use these roads as a cut through to avoid traffic on crosstown 62 and hwy 100. The number of waste trucks on garbage day is out of control!!! We need ONE garbage service provider and reduce the dozens of trucks on our streets each week. Ridiculous. Because of the lack of traffic signs or signals I have concerns when I'm walking (daily) and my children biking. See answer to #3 - corner of Benton and Hanson very busy, and no sidewalk on Hanson or Benton make it hard for kids to traverse the neighborhood safely. Volume and Speed apply to this stretch of Hanson between Garden Park and Benton, and the intersection of Benton and Hansen. Tingdale & 59th as both run along side Tingdale Park - see answer above. Q6 If concerned or very concerned, please enter the location(s) of concern and why you feel that way. Optional question (9 response(s), 34 skipped) Question type: Essay Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 8 of 34 Q7 How concerned are you with motorist behavior in your neighborhood? (Examples of poor motorist behavior include speeding, rolling through stop signs, failing to yield, and driving aggressively.) 15 (34.9%) 15 (34.9%) 19 (44.2%) 19 (44.2%) 9 (20.9%) 9 (20.9%) Concerned Not Concerned Very Concerned Question options Mandatory Question (43 response(s)) Question type: Radio Button Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 9 of 34 rolling stops at Benton & Tingdale; some people totally run the stop sign on Benton Lots of people blow through stop sign on Benton at Tingdale. People speed on Tingdale. We’ve always worried about the kids in the park, walkers, joggers etc. People tend to roll through the stop signs at the intersection of Benton and Hansen. Bicyclists also NEVER stop at the stop signs along Benton Ave. See comment above re:speed Benton and Hansen is a pretty busy intersection and people speed through 5300 Benton Ave. speed is the largest issue. People aggressively drive on this street as a short cut to other roads. They speed on our street Above average loud music/honking at the benton/Hansen intersection The intersection of Tingdale Ave & Benton Ave, cars run the stop signs driving along Benton Ave all of the time. Some speed up as they approach the stop sign. Question 8 has an invalid answer. I am NOT concerned with motorist behavior and we drive/walk our neighborhood constantly for the past two decades. However, I had to select an answer to continue so that caused a bad response :( Same as response above: often see motorists speeding in front of our house on Code Ave., between 60th and Benton. Q8 If concerned or very concerned, please enter the location(s) of concern and why you feel that way. Question type: Radio Button Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 10 of 34 Lots of rolling through the stop signs at Benton and Tingdale. Speeding on Hansen, failing to yield to pedestrians or pay attention hansen and grove street Stop signs at Benton and Tingdale (West-East bound Benton traffic) A lot of traffic do not stop at these stop signs. See response above (Hansen & Benton) drivers constantly roll right through the four way stop at Benton and Tingdale. Mainly the cars on Benton. Besides the excessive speed we also see many motorists don't pay much attention to the 4 way stop at Hansen and Benton and we're surprised there hasn't been more accidents there. An additional concern are the bikers who very rarely comply with the stop signs either. I also notice daily people looking at or talking on their phones. The Benton Ave/ Tingdale intersection is notorious for drivers simply rolling through or not slowing down at the stop signs at all!! At the Tingdale/Benton 4 way stop intersection people rarely stop and frequently blow through the intersection. Some hardly even slow down. Drivers roll through the 3-way stop at Normandale Rd & Benton Ave. or do not take turns (the corners at the intersection are so far apart, they don't want to wait for people to go). Drivers also roll through the stop sign at Benton Ave & Tingdale Ave. making exiting off Eastview Dr onto Benton Ave difficult during rush hours. It also makes it hard to walk across Benton Ave. Same issue - speed and no sidewalk in key parts of neighborhood. Excessive speed and rolling through the stop sign at Tingdale and Benton. Optional question (24 response(s), 19 skipped) Question type: Essay Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 11 of 34 Q9 In general, these behaviors impact you most when you are: 14 (32.6%) 14 (32.6%) 2 (4.7%) 2 (4.7%) 27 (62.8%) 27 (62.8%) Driving Bicycling Walking, jogging, or running Question options Mandatory Question (43 response(s)) Question type: Radio Button Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 12 of 34 Q10 Do you feel any intersection in your neighborhood is unsafe? 21 (48.8%) 21 (48.8%) 22 (51.2%) 22 (51.2%) Yes No Question options Mandatory Question (43 response(s)) Question type: Radio Button Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 13 of 34 Benton and Hansen Benton Avenue and Bernard Place Two Different Intersections: Intersection of Benton Ave & Benard Pl. Primarily turning east/left from Benard Place onto Benton (obstruction due to tree and often parked cars and Benton has faster moving vehicles). Intersection of Code Ave & 56th. For those cars at stop sign on 56th facing west, unable to see cars traveling North on Code Ave (due to large hill). Suggestion would be a 4-way stop. The corner of Bernard Place and Benton, heading south on Bernard Place. There is a significant blind spot looking east because of overgrown bushes and a power line pole. Tingdale Ave & Benton Ave Code and Benton for school age kids who catch the bus there. Bernard Place and Benton. Bushes are overgrown. Bernard Place and Benton Avenue hansen and grove Benton and Tingdale Hansen & Benton ALL of Benton Avenue between Hwy 100 and Countryside Elementary WITHOUT sidewalks! You force people to walk on a very busy road. Benton and Tingdale Q11 Which intersection do you feel is unsafe? Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 14 of 34 Hansen and Benton, Hansen and Grove and Hansen and Vernon Tingdale/Benton Normandale Rd & Benton Ave The bridge over Tracy Ave and 62W intersection crossing the road (Hanson Rd) over Tracy Ave. Very busy during school morning and afternoons, especially in the winter, cars sit and create black ice. In normal times it can feel like a very scary place to cross. Hanson/Benton (no sidewalk) Dale/Grove (no stop sign for cars traveling on Grove) Exit off 100 and Benton turning onto Benton from side streets with no stop sign 59th and Code - there are shrubs on the north east corner that make the sight lines difficult. Optional question (21 response(s), 22 skipped) Question type: Essay Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 15 of 34 Q12 Which, if any, of the following factors contribute to your feeling that the intersection is unsafe? (select all that apply) 5 5 8 8 12 12 3 3 4 4 2 2 7 7 0 0 Lack of traffic control (traffic signal, stop sign, yield sign)Issues with sight lines or clear view Drivers failing to stop at stop sign Drivers failing to yield Drivers turning corner too fast Street(s) too wide Other (please specify)Insufficient lighting Question options 1 2 3 4 5 6 7 8 9 10 11 12 13 Optional question (27 response(s), 16 skipped) Question type: Checkbox Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 16 of 34 Q13 In general, the intersection feels most unsafe when you are: 13 (44.8%) 13 (44.8%) 1 (3.4%) 1 (3.4%) 15 (51.7%) 15 (51.7%) Driving Bicycling Walking, jogging, or running Question options Optional question (29 response(s), 14 skipped) Question type: Radio Button Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 17 of 34 Q14 How frequently do you walk, jog, or run in your neighborhood? 28 (65.1%) 28 (65.1%) 11 (25.6%) 11 (25.6%) 4 (9.3%) 4 (9.3%) 0 (0.0%) 0 (0.0%) 0 (0.0%) 0 (0.0%) Very frequently (daily or near daily)Frequently (2-3 times per week)Occasionally (1-4 times per month) Rarely (less than once per month)Never Question options Optional question (43 response(s), 0 skipped) Question type: Radio Button Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 18 of 34 Q15 If you walk, jog, or run in your neighborhood, what are your primary reasons for doing so? (select all that apply) 43 43 7 7 1 1 4 4 0 0 Health/exercise Travel to/from destination (such as store, coffee shop)Access transit Other (please specify) Commute to/from work Question options 5 10 15 20 25 30 35 40 45 50 Optional question (43 response(s), 0 skipped) Question type: Checkbox Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 19 of 34 Sidewalks. Stop signs. Reduced speed limits. Sidewalk on Hansen rd More sidewalks or dedicated trails Sidewalks None. We don't need a sidewalk to exercise. When we want a path, we go to Bredesen. We certainly don't need a sidewalk on Eastview reconstruction projects will not cause us or others to exercise more. Add a sidewalk, but still need to address stop sign at Benton-Tingdale intersection. Change to a lighted stop sign. Something to draw attention to all drivers. More sidewalks! I would LOVE a sidewalk on Benton, so we could walk to school. Lack of sidewalks. Traffic doesn’t slow down. Add sidewalks where ever possible, improve the street in front of my house. Sidewalks along Hanson from Garden Park to Benton Q16 If you don't walk, jog, or run in your neighborhood as often as you would like, what reconstruction improvement might increase your walking, jogging, or running? Please list all that you can think of. Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 20 of 34 Optional question (13 response(s), 30 skipped) Question type: Essay Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 21 of 34 Q17 How frequently do you ride a bicycle in your neighborhood? 6 (14.0%) 6 (14.0%) 11 (25.6%) 11 (25.6%) 10 (23.3%) 10 (23.3%) 9 (20.9%) 9 (20.9%) 7 (16.3%) 7 (16.3%) Very frequently (daily or near daily)Frequently (2-3 times per week)Occasionally (1-4 times per month) Rarely (less than once per month)Never Question options Optional question (43 response(s), 0 skipped) Question type: Radio Button Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 22 of 34 Q18 If you ride a bicycle in your neighborhood, what are your primary reasons for doing so? (select all that apply) 31 31 11 11 3 3 0 0 0 0 Health/exercise Travel to/from destination (such as store, coffee shop)Other (please specify) Commute to/from work Access transit Question options 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 Optional question (34 response(s), 9 skipped) Question type: Checkbox Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 23 of 34 A sidewalk on one side of the street and a bike path on the other for Benton Ave could allow for more bike traffic. Reducing speed limits would also make the area more bike friendly. Smoother roads Bike lanes Our five kids ride/have ridden bikes in the neighborhood for two decades without problems or concerns other than completely avoiding Benton Avenue where there isn't a sidewalk. Safe bike lanes We certainly don't need a bike path on Eastview minimize hills horrible pot holes all over our neighborhood. fix those. No need for millions of dollars for special side walks for bike riding. lets not overcomplicate things and force a hand full of households to have to pay for sidewalks that everyone else uses Add a bike lane. Improved road conditions would make biking easier. There are many cracks in the roads nearby my house. Connection to the bikeway at Bredeson Park. Fear of traffic not seeing me- they drive too fast. Keep roads clear of sand and other debris to avoid slipping on bikes. Q19 If you don't ride a bicycle in your neighborhood as often as you would like, what reconstruction improvement might increase your bicycle riding frequency? Please list all that you can think of. Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 24 of 34 8/05/2020 08:29 AM Personal motivation Optional question (14 response(s), 29 skipped) Question type: Essay Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 25 of 34 Q20 How frequently do you or a member of your household park on the street? 1 (2.3%) 1 (2.3%) 3 (7.0%) 3 (7.0%) 9 (20.9%) 9 (20.9%) 16 (37.2%) 16 (37.2%) 14 (32.6%) 14 (32.6%) Very frequently (daily or near daily)Frequently (2-3 times per week)Occasionally (1-4 times per month) Rarely (less than once per month)Never Question options Optional question (43 response(s), 0 skipped) Question type: Radio Button Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 26 of 34 Q21 How frequently do visitors to your household park on the street? 4 (9.3%) 4 (9.3%) 9 (20.9%) 9 (20.9%) 16 (37.2%) 16 (37.2%) 13 (30.2%) 13 (30.2%) 1 (2.3%) 1 (2.3%) Very frequently (daily or near daily)Frequently (2-3 times per week)Occasionally (1-4 times per month) Rarely (less than once per month)Never Question options Optional question (43 response(s), 0 skipped) Question type: Radio Button Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 27 of 34 Q22 How satisfied are you with the availability of on-street parking in your neighborhood? 17 (39.5%) 17 (39.5%) 15 (34.9%) 15 (34.9%) 8 (18.6%) 8 (18.6%) 2 (4.7%) 2 (4.7%)1 (2.3%) 1 (2.3%) Very Satisfied Satisfied Neutral Dissatisfied Very dissatisfied Question options Optional question (43 response(s), 0 skipped) Question type: Radio Button Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 28 of 34 Since our street is only one-sided parking, it can get congested and on-street parking in front of our home can be unavailable. Traffic speeds on Benton Ave are too high to comfortable park on the street. no I am VERY concerned with the possibility of the streets narrowing. Thankfully our kids are all older now but the reduced visibility around parked cars is significant on the narrower streets, where ours has always felt very open and safe. People can swing around a parked car with lots more margin for safety. We wish on-street parking was not allowed overnight during the whole year. I prefer if people do not park in the street for long periods of time. Visiting is fine but everyday is annoying and over night is annoying. Constant on street parking makes the street too narrow and less safe. please don't create special cut outs for street parking. Street parking is only on the West side of the street but people always park on the East side also but the no parking is never enforced. What is that? some of the neighbors park in the street daily (59th) and if it gets narrowed it could create safety issue for kids going to the park. Not sure street is wide enough House behind us has insufficient space, so they park against pit side yard and sometimes go into the yard. Q23 Any additional comments about parking? Optional question (11 response(s), 32 skipped) Question type: Essay Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 29 of 34 The concrete street in front of house is in good shape. Seems like a waste to tear it up. The streets are in horrible condition. The City should be embarrassed that it let the streets get so bad. Please make better plans for the future! I would love if power/cable lines could be put underground. The households on our street have always been active and have lots of visitors, so even though we are only a block long there are often a lot of cars. We have never felt our kids were unsafe in the front yard or on the street with their bikes and have relatively little thru traffic since there isn't really a reason for it. Our only concern is a narrower road that turns it into a one-lane street that allows little margin for error when passing kids on bikes or going around parked cars. Wyman Ave north of the 62 bridge is terrible with the NB lane turned into a parking space that often has a vehicle in it and only enough room to get one car through. Storm drainage is not a significant issue, and would think a blended concrete apron would be as good as, and cheaper, and more aesthetically pleasing, than curb. fix the curbs and the horrible pavement and everyone will be happy. add a stop sign to grove and hansen road intersecton A sidewalk on our street would be welcome!! Q24 Please tell us anything else you would like us to know about existing traffic or street conditions in your neighborhood. Optional question (7 response(s), 36 skipped) Question type: Essay Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 30 of 34 Q25 Do you favor improving streetlights in your neighborhood? (residential streetlights are funded by special assessment) 8 (19.0%) 8 (19.0%) 33 (78.6%) 33 (78.6%) 1 (2.4%) 1 (2.4%) Yes No Other (please specify) Question options Optional question (42 response(s), 1 skipped) Question type: Radio Button Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 31 of 34 W 60th St TIngdale Ave. Tingdale 59th Street West Hansen Road Grove Hansen Benton Ave Grove St. Benard Place Bernard Place Hansen Rd Grove Tingdale Ave Q26 What is your street name? Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 32 of 34 5100 Block of W 58th St Bernard Place Bernard Place Code Ave. Eastview Dr. Eastview Drive Dale Avenue Dale Ave hansen road Benton Ave Hansen & Benton Tingdale Avenue and 59th Street Bernard Place Grove Street Hansen Rd Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 33 of 34 west 58th St TIngdale Ave Benton Ave Eastview Ave W 60th St Dale Eastview Drive Eastview eastview drive Eastview Dr. west 59th street Hansen Road Grove St and Melody Lane Abbott Place Mandatory Question (43 response(s)) Question type: Single Line Question Neighborhood Reconstruction Survey : Survey Report for 30 January 2019 to 10 August 2020 Page 34 of 34 September 24, 2019 Fraser Community Services 5617 Hansen Road Edina, MN 55436 Dear Property Owner, Please take a moment to complete a Survey relating to parking along West 56th Street between Hansen Road and Dale Street. This survey will assist the City's design of West 56th Street associated with the Melody Lake A & Grandview A 2020 Neighborhood Roadway Reconstruction. Your input is important to us! Please select one of the following two options regarding parking along West 56th Street and return this survey using the return envelope by Oct. 10. )‘(•., Option A — Parking on only, one side of West 56th Street. This option includes a 5' concrete sidewalk and will include removal of trees and landscaping along the residential side of the street. Option B — No parking on either side of West 56th Street. This option includes a 5' concrete sidewalk and will minimize removal of trees and landscaping along the residential side of the street. If you have questions or comments, please feel free to contact me at 952-826-0443 or aditzleria),EdinalVIN.gov. Thank you, Aaron Ditzler Assistant City Engineer Cc: Chad Miliner, Director of Engineering ENGINEERING DEPARTMENT 7450 Metro Boulevard • Edina, Minnesota 55439 www.EdinaMN.gov • 952-826-0371 • Fax 952-826-0392 September 24, 2019 Michael Lund 5608 Dale Avenue Edina, MN 55436 Dear Property Owner, Please take a moment to complete a Survey relating to parking along West 56th Street between Hansen Road and Dale Street. This survey will assist the City's design of West 56th Street associated with the Melody Lake A & Grandview A 2020 Neighborhood Roadway Reconstruction. Your input is important to us! Please select one of the following two options regarding parking along West 56th Street and return this survey using the return envelope by Oct. 10. Option A — Parking on only one side of West 56th Street. This option includes a 5' concrete sidewalk and will include removal of trees and landscaping along the residential side of the street. Option B — No parking on either side of West 56th Street. This option includes a 5' concrete sidewalk and will minimize removal of trees and landscaping along the residential side of the street. If you have questions or comments, please feel free to contact me at 952-826-0443 or aditzler@EdinaMN.gov. Thank you, 42J e Aaron Ditzler Assistant City Engineer Cc: Chad Millner, Director of Engineering ENGINEERING DEPARTMENT 7450 Metro Boulevard • Edina, Minnesota 55439 www.EdinaMN.gov • 952-826-0371 • Fax 952-826-0392 September 24, 2019 Terry & Katherine Lewis 5612 Dale Avenue Edina, MN 55436 Dear Property Owner, Please take a moment to complete a Survey relating to parking along West 56th Street between Hansen Road and Dale Street. This survey will assist the City's design of West 56th Street associated with the Melody Lake A & Grandview A 2020 Neighborhood Roadway Reconstruction. Your input is important to us! Please select one of the following two options regarding parking along West 56th Street and return this survey using the return envelope by Oct. 10. Option A — Parking on only one side of West 56th Street. This option includes a 5' concrete sidewalk and will include removal of trees and landscaping along the residential side of the street. Option B — No parking on either side of West 56th Street. This option includes a 5' concrete sidewalk and will minimize removal of trees and landscaping along the residential side of the street. If you have questions or comments, please feel free to contact me at 952-826-0443 or aditzler@EdinaMN.gov. Thank you, 4zettki# Aaron Ditzler Assistant City Engineer Cc: Chad Millner, Director of Engineering ENGINEERING DEPARTMENT 7450 Metro Boulevard. Edina, Minnesota 55439 www.EdinaMN.gov • 952-826-0371 • Fax 952-826-0392 September 24, 2019 Ruth Ann Metzger 5600 Dale Avenue Edina, MN 55436 Dear Property Owner, Please take a moment to complete a Survey relating to parking along West 56th Street between Hansen Road and Dale Street. This survey will assist the City's design of West 56th Street associated with the Melody Lake A & Grandview A 2020 Neighborhood Roadway Reconstruction. Your input is important to us! Please select one of the following two options regarding parking along West 56th Street and return this survey using the return envelope by Oct. 10. Option A -- Parking on only one side of West 56th Street. This option includes a 5' concrete sidewalk and will include removal of trees and landscaping along the residential side of the street, Option B — No parking on either side of West 56th Street. This option includes a 5' concrete sidewalk and will minimize removal of trees and landscaping along the residential side of the street. If you have questions or comments, please feel free to contact me at 952-826-0443 or aditzler@EdinaMN.gov. Thank you, Aaron Ditzler Assistant City Engineer Cc: Chad Millner, Director of Engineering ENGINEERING DEPARTMENT 7450 Metro Boulevard • Edina, Minnesota 55439 www.EdinaMN.gov • 952-826-0371 • Fax 952-826-0392 APPENDIX I Neighborhood Informational Meeting Materials The CITYofEDINA2021 Neighborhood Roadway ReconstructionInformational Meeting The CITYofEDINAAgenda•Introductions•Why Reconstruct•Project Scopes•What You Can Expect•Funding Sources•Timeline•Communication•How to Prepare•Questionswww.EdinaMN.gov2-A The CITYofEDINAwww.EdinaMN.gov3-AEngineering DepartmentDirector of EngineeringAssistant City EngineerEngineering Services MgrTransp. PlannerSr. Engineering TechnicianSr. Engineering TechnicianProject EngineerChad Millner Aaron Ditzler Ross Bintner Andrew Scipioni Tom Haataja Derek NorthenscoldCharlie GerkEngineering CoordinatorGIS CoordinatorWater Resrc. CoordinatorTraffic Safety CoordinatorSr. Engineering TechnicianEngineering TechnicianGraduate EngineerLiz Moore Rebecca Foster Jessica Wilson Nick Bauler Jon Moore Edinah Machani Zuly Marquez The CITYofEDINA2021 Projects•Melody Lake A & B, Grandview A, Birchrest C –309 properties•Creek Knoll A & B – 113 propertieswww.EdinaMN.gov4-C The CITYofEDINA•Streets grouped into neighborhoods•- Maximizes economics of scale•- Extends pavement life•Proactive Pavement Management Program•Prioritized based on;•- Pavement condition•- Underground utility issues•-Age of original construction5-Cwww.EdinaMN.govWhy My Street? The CITYofEDINAWhy Reconstruct?•Originally constructed in 1940s-1980s (40-80 years old)•Utility issues to address beneath roadway•More cost-effective than other maintenance strategies (mill & overlay, seal coat)www.EdinaMN.gov6-A The CITYofEDINAExisting Conditions - Roadways•Pavement reaching end of useful life•Some streets have curb and gutter, some do not•Some properties already have concrete driveway aprons, some do notwww.EdinaMN.gov7-A The CITYofEDINAExisting Conditions - Utilities•Watermain- Loss in pipe wall thickness- Main and service breaks- Undersized mainswww.EdinaMN.gov8-C•Sanitary Sewer- Cracks, breaks, sags, etc.- Inflow and infiltration•Storm Sewer- Structure deficiencies- Undersized pipes- Curb and gutter failing The CITYofEDINA•Mailboxes•Irrigation systems and pet fences•Landscaping•Outwalks/stepsExisting Conditions – Right-of-Waywww.EdinaMN.gov9-C The CITYofEDINAWhat/Where is the ROW?•Surface and space above and below public roadways used for travel purposes and utilities•Typically 60’ width•(MSA Streets 66’)•Property corners located during surveywww.EdinaMN.gov10-A The CITYofEDINAProposed Improvements - Roadways•Replacement of curb & gutter (all or sections)•Subgrade corrections as needed•New roadbed and pavement surfacewww.EdinaMN.gov11-A The CITYofEDINALiving Streets Plan•Approved by City Council in 2015•Balances needs of motorists, bicyclists, pedestrians and transit riders•Incorporates;•- Minimum roadway design elements•- Pedestrian and Bicycle Master Planwww.EdinaMN.gov12-C The CITYofEDINALiving Streets Classificationswww.EdinaMN.gov13-C The CITYofEDINAProposed Improvements - Driveways•Aprons will be replaced / installed to comply with City standards•Special driveway materials•Reimbursement Policywww.EdinaMN.gov14-A The CITYofEDINAProposed Improvements - Utilities•May include localized watermain and service replacements•New fire hydrants and gate valves•May include localized sanitary sewer repairs and rehabilitation•Storm sewer upgradeswww.EdinaMN.gov15-A The CITYofEDINAProposed Improvements – Sump Drain•Homeowners encouraged to connect to City Sump Drain•Notification will be given when connecting is available•Sump connection permit available thru City websitewww.EdinaMN.gov16-C The CITYofEDINA•Recommend inspecting private services prior to construction•Repairs/upgrades can be coordinated with street work•Associated costs can be added to special assessmentUtility Ownershipwww.EdinaMN.gov17-AResident Owned UtilitiesB –Water ServiceC & D – Sanitary Service The CITYofEDINAProposed Improvements –Ped / Bike•Based on Pedestrian and Bicyclist Master Plan•Final design evaluated based on network consistency and construction conflictswww.EdinaMN.gov19-C The CITYofEDINAPrivate Utilities•Gas, Electric, Telephone, Cable may upgrade or repair their utilities before construction begins•Potential City-required relocations•Goal: streamline projects and minimize neighborhood disturbance•Streetlight upgrades typically not included with projectwww.EdinaMN.gov20-A The CITYofEDINAWhat You Can Expect•Dust, mud, noise, and vibrations•Localized flooding during rainfall•Occasional delays due to inclement weather•Residents will be asked to limit water use occasionally•Homes may be connected to temporary watermainwww.EdinaMN.gov21-A The CITYofEDINAWhat You Can Expect•Construction materials stored temporarily in ROW•5-10 feet of disturbance behind back of curb•Construction equipment stored on streets•Tree removals as necessary (property owners notified)www.EdinaMN.gov22-C The CITYofEDINAWhat You Can Expect•Driveways and roads will be periodically inaccessible•Driveways will be inaccessible for 7 days to allow driveways to curewww.EdinaMN.gov23-C The CITYofEDINAWhat You Can Expect•Items within the City’s right-of-way may be damaged•-You can remove plants and other landscape features before the project•- Irrigation and pet fences will repaired•Disturbed areas will be seededwww.EdinaMN.gov24-A The CITYofEDINAWhat You Can Expect•We will;•- Provide opportunities for input•- Keep you informed•- Do our best to minimize inconveniences•Our contractor will accommodate residents with special access needswww.EdinaMN.gov25-A The CITYofEDINACity Utility Funds•Collection of utility service charges paid to the City•Covers 100% of:•- Storm sewer •(curb and gutter, •driveway aprons, •sump drain pipe) •-Sanitary sewer•-Watermainwww.EdinaMN.gov26-C The CITYofEDINAPedestrian and Cyclist Safety (PACS) Fund•Revenue from Xcel and CenterPoint Energy franchise fees•Promotes non-motorized transportation throughout the City•Covers 100% of:•-Sidewalks /shared-use paths•- Bike lanes•-Associated signage and pavement markingswww.EdinaMN.gov27-C The CITYofEDINADo Taxes Cover Street Projects?•~20% of property taxes go to the City for expenses including Police, Fire, Parks, and Public Works•- Snowplowing•- Pothole repairs•- Other street maintenance (sealcoating, overlays, patch repairs)•Taxes do not pay for street reconstructionwww.EdinaMN.gov28-ASource: Hennepin County website 8/2/2016 The CITYofEDINASpecial Assessments•Assigned to benefitting properties of public improvements•Covers 100% of roadway costs (20% on MSA roadways)•- Roadway and driveway removals•- Subgrade materials•-Asphalt pavement•- Restoration•- Indirect Costs – engineering, finance, soil investigations, mailingswww.EdinaMN.gov29-A The CITYofEDINAResidential Equivalent Units•Assessments distributed based on REUs•- Factor used to compare properties to a single-family residence•Additional factors for commercial, industrial, and public-use propertieswww.EdinaMN.gov30-CScenario Land Use Class REU FactorA Single-Family Residential 1.0B Multi-Family Residential – Duplex 0.8C Multi-Family Residential – Apartment/Condos 0.5I Institutional – Places of Worship 0.2* The CITYofEDINAProject Details – Melody Lake A & B Grandview A, and Birchcrest C•309 properties (303.02 REUs)•3.88 miles of road•Full replacement of watermain, water services•Full replacement/installation of curb & gutter•5’ sidewalk on Hansen Rd and W. 56th St. www.EdinaMN.gov31-A The CITYofEDINAProject Details – Creek Knoll A & B•113 properties (114.60 REUs)•1. 3 miles of road•Full replacement/installation of curb & gutter•Installation of 5’ sidewalk on Beard Avenue•Localized watermain improvementswww.EdinaMN.gov32-C The CITYofEDINAPreliminary Assessments*Residential equivalent unit (1 single-family home = 1 REU)www.EdinaMN.gov33-ANeighborhoodEstimated Assessment Range per REU*#of REUsSquareYards of PavingSquare Yards of Paving per REUMelody Lake A & B Grandview A, and Birchcrest C $17,700 - $24,200 303.02 53,324 176.0Creek Knoll A & B$12,500 - $18,100 114.6 16,163 141.0 The CITYofEDINATypical Project Timelinewww.EdinaMN.gov39-AJuly – September 2020 Engineering studies/estimates providedDecember 2020 Public hearingsJanuary – March 2021 Plan preparation and biddingApril – May 2021 Construction beginsOctober – November 2021 Construction concludesSpring 2022 Warranty workFall 2022 Final assessment hearing The CITYofEDINAAssessment Timingwww.EdinaMN.gov40-CInitial Public Hearings December 2020Project Constructed Summer 2021Final Assessment Hearing October 2022Assessment Filed with County November 2022Assessment on Tax Statement January 2023 The CITYofEDINAPayment Options•Pay entire amount upon receiving bill to avoid interest charges•Pay min. 25% ; balance rolls to property taxes over 15 years •Roll entire amount to property taxes over 15 years•Defer payment if 65 years of age or older and meet specific income requirements•- Finance charges are 1% over City’s borrowing interest rate•- 2019 interest rate was 3.92%•-Assessing Department – 952-826-0365www.EdinaMN.gov41-C The CITYofEDINACommunicationwww.EdinaMN.gov42-A•Regular Mail-All meetings, public hearings, and questionnaires- Final assessment notices (one year after construction)•Door hangers and flyers -Time-sensitive information (water shut-offs, concrete, temporary inaccessibility)•Better Together Edina – City Website Project Page The CITYofEDINABetter Together Edina•Best way to stay informed•www.bettertogetheredina.org/melodybirchcrest•www.bettertogetheredina.org/creekknollab•Free, access to periodic updates on project progress and scheduleswww.EdinaMN.gov43-A The CITYofEDINAProviding Input•Questionnaires mailed to your home, weigh in on;•-Traffic/pedestrian issues•- Street drainage issues•- Streetlight upgrades•Public hearing in December 2020•- Opportunity for residents to voice comments and concernswww.EdinaMN.gov44-C The CITYofEDINAQuestionnaire Resultswww.EdinaMN.gov45-CNeighborhoodResponses Received to DateMelody Lake A & B Grandview A, and Birchcrest C 29% (89/310)Creek Knoll A & B34% (56/154) The CITYofEDINAHow To Prepare•Complete project questionnaire•Begin financial planning•Coordinate home and yard improvement projects around street reconstruction schedule•Review Better Together Edina updates•Ask questions, stay informedwww.EdinaMN.gov46-A The CITYofEDINAEngineering Department7450 Metro BoulevardHours: 7:00 a.m. – 3:30 p.m.952-826-0371Contact Uswww.EdinaMN.gov47-ALiz MooreEngineering Coordinator952-826-0449LMoore@edinamn.govAaron DitzlerAssistant City Engineer952-826-0443ADitzler@edinamn.gov The CITYofEDINAQuestions?www.EdinaMN.gov48-A•Ask questions on Better Together Edina Q&A page•‐www.bettertogetheredina.org/melodybirchcrest•‐www.bettertogetheredina.org/creekknollab•Call or email The CITYofEDINAThank you for your time!www.EdinaMN.gov49-A APPENDIX J Correspondence from Residents From: To:Carter Schulze Cc: Subject:Future Roadway Reconstruction 2019-2020 Date:Friday, September 29, 2017 3:19:37 PM Hello Mr. Schulze I was not able to attend the Monday meeting but wonder if you could respond to some questions. I live on Bernard Pl in Melody Lake Area 1. Am I correct that the Melody Lake project will be in 2020. Any chance that could change? 2.How are the individual property assessments calculated? 3. Some of the existing roadway is concrete and some is asphalt. Will these properties be assesed the same? 4.Do the residents have a choice on contractors or do you just take the lowest bid. ? i.e. the contractor who did the eastern section of Melody Lake (Code to Frontage road) a few years ago did a very poor job and took forever . 5. Some projects seem to take a very long time - i.e. Birchcrest this year. Others that I have seen in past years only take 3 months. Why do some take so long and is there anything residents can do to help speed the process.? 6. How does the city monitor communication between contractor and residents. I have heard some very good reports and some awful situations.? 7. I don't have gutters now. Do I assume gutters will be placed on all streets or is this subject to vote. I have lived at this address for 43 yards and have no problems being gutterless? Thanks in advance for your reply. Patrick Finley 5603 Bernard Pl Edina, MN 55436 From:Jana Hoffmann To:Aaron Ditzler Subject:Melody lake - Birchcrest proposed project Date:Saturday, November 21, 2020 4:51:18 PM EXTERNAL EMAIL ALERT: This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Hi Aaron, I am the home owner at 5127 W. 56th Street. I am 100% strongly opposed the STUPID project being proposed to add a unneeded sidewalk and greatly reduce the width of the roadway. I will stand up to opposed this in every way possible. I sincerely hope the city is actually going to take into account what the homeowners on this street have to say about this… or will it be like everything else that it is just crammed down pocket book and more money wasted by the city? Thank you Jana Hoffmann From:Heather Lund To:James Hovland; Chad Millner; Edina Mail Subject:Melody Lakes road construction proposal Date:Monday, November 4, 2019 12:51:06 PM EXTERNAL EMAIL ALERT: This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Hello- I am an Edina resident and have lived at 5213 Grove Street for 19 years and wanted to reach out regarding the proposed construction project for the Melody Lakes neighborhood. My concern is regarding the split of our neighborhood for the upcoming road construction project that would result in significant construction in our neighborhood for TWO consecutive summers. I live near the corner of Grove & Code and the proposal shows Grove Street as the dividing line so the roads across the street on Code would be under construction in 2020 and Grove Street would be completed in 2021. As a long time Edina resident, I have visited family and friends who live in neighborhoods where this construction has previously been completed and I am well aware of the significant impacts it has on families and day-to-day activities. The construction greatly impacts the qualify of life for families including noise, detours, dust, safety for children riding bikes, walking dogs, parking challenges and enjoying any outdoor activity in our yards or decks during the project. I understand that this project needs to be completed but my concern is regarding the split of the neighborhood and therefore creating significant inconveniences for two summers in a row. Benton Avenue is a much more logical border for this project as Melody Lakes neighborhood is North of Benton and therefore the entire neighborhood could be completed in one summer, not two. As we all know, Minnesota summers are short and we attempt to enjoy our porches, decks, yards, sidewalks, parks and neighborhoods as much as possible. The current proposal will impact a significant number of families from enjoying our beautiful neighborhood for two consecutive years. Please consider revisiting the current proposal and taking into consideration alternative options. I am happy to discuss further if you have time to connect with me. Thank you- Heather Lund From:Andrew Scipioni To:"Jonathan Engman MD" Subject:RE: 56th Street Date:Friday, October 5, 2018 10:21:16 AM Jon, Here is the typical process for determining a project area’s assessment: 1.Calculate the number of Residential Equivalent Units (REUs) within the project limits, taking into account corner lots, non-residential properties and City properties as the Special Assessment Policy describes (in the case of this project, the railroad property would not be included in this calculation). 2.Determine the scope and total cost of roadway improvements based on, among other things, street widths, lengths and existing soil conditions. 3.Divide the total roadway cost by the calculated number of REUs within the project area. At this point, we do not know whether improvements will be made at the railroad crossing or what the scope of those improvements would be; I expect we will be having those conversations with the railroad in the coming years and determining how those improvements would be funded. Staff will be proceeding with the design under the assumption that the railroad property will not be assessed for the roadway improvements, as we have done in other projects. Any direction otherwise would have to come from City Council. If this is a concern of yours, I would recommend reaching out to Council or to City Manager Scott Neal so they can consider and review with our City Attorney. Andrew Scipioni, EIT, Engineering Technician 952-826-0440 | Fax 952-826-0392ascipioni@EdinaMN.gov | EdinaMN.gov Stay informed! Sign up for City Extra emails! From: Jonathan Engman MD [mailto: Sent: Thursday, October 04, 2018 7:03 PMTo: Andrew Scipioni Subject: Re: 56th Street Andrew, Thanks for your speedy reply. Since the policy does not explicitly address who pays for the portion of the railway's property, how can I find out what will happen with our project's assessment? I would argue that in this case the railway should be assessed some portion and the city should be assessed some portion similar to park property. The railway has to cross the road and that portion will cost more to put in I'm sure. It wouldn't be fair, certainly, to increase our assessments to pay for the railway property. I would appreciate a response that clarifies the plan for the portion of the road. If someone else is more appropriate for handling this question, please feel free to forward my email to them. Thanks again! Jon On Thu, Oct 4, 2018 at 9:54 AM Andrew Scipioni <ascipioni@edinamn.gov> wrote: Jon, Attached is the City’s current Special Assessment Policy, which does not explicitly address roadways that are partially fronted by the railroad. Historically, the City has not assessed properties associated with the railroad because it is our position that they do not receive a benefit from the roadway improvements. Andrew Scipioni, EIT, Engineering Technician 952-826-0440 | Fax 952-826-0392ascipioni@EdinaMN.gov | EdinaMN.gov Stay informed! Sign up for City Extra emails! From: Jonathan Engman MD [mailto: Sent: Wednesday, October 03, 2018 3:24 PMTo: Andrew Scipioni Subject: 56th Street Hi Andrew, A question for you. I understand that the railroad isn't typically assessed during street projects. I live on 56th street and a long portion of it is bordered by the railroad. I want to be sure that we as residents in the project area don't end up paying an unfair amount for the railroad's share of the road. Is there a policy in place that the city will be assessed for the railroad's share of the road, like it will for the area bordering Garden Park? Thanks for your help, Jon Engman 5236 W 56th Street From:Andrew Scipioni To:"RuthAnn Metzger" Cc:"Jonathan Engman"; "Kevin Bohrer"; "Michael Lund"; "Kristin Engman"; "Katie Lewis" Subject:RE: 2020 & 2021 Neighborhood Roadway Reconstruction Date:Wednesday, September 26, 2018 11:36:22 AM Attachments:Final Special Assessment Policy.pdf RuthAnn, The City will be assessed for the properties we own within the project limits in accordance with our Special Assessment Policy (attached). Historically, the City has not assessed properties associated with the railroad because it is our position that those properties do not receive a benefit from roadway improvements. The most recent example of this was the Birchcrest A/Countryside B reconstruction project in 2017. For the Melody Lake A/Grandview A project, staff will not be proposing to assess the railroad properties unless directed by City Council. Regarding your concern about heavy equipment being parked along W 56th Street, City Ordinance prohibits on-street parking for more than 6 hours and restrictions vehicle loads on residential streets. If you are concerned about vehicles being parked for more than 6 hours, I’d suggest contacting the Edina Police Department on their non-emergency number (952-826-1600); for concerns about overloaded vehicles, you can contact Edina Public Works (952-826-0376). Andrew Scipioni, EIT, Engineering Technician 952-826-0440 | Fax 952-826-0392ascipioni@EdinaMN.gov | EdinaMN.gov Stay informed! Sign up for City Extra emails! From: RuthAnn Metzger [mailto: Sent: Wednesday, September 26, 2018 9:01 AMTo: Andrew ScipioniCc: Ra; Jonathan Engman; Kevin Bohrer; Michael Lund; Kristin Engman; Katie Lewis Subject: 2020 & 2021 Neighborhood Roadway Reconstruction Andrew, Here is another question/concern from one of my neighbors: Much of the Melody Lake A area is bordered by parks and railroad. That means there are that many fewer residential units to divide the cost. We need to be sure that the city is paying their share for the long section of Hansen and we also want to be sure that the railroad will be assessed. They have to cross the roads and use them at times also so are benefiting from the upgrade like we are. Plus the railroad parks their heavy equipment along 56th St. just east of Hanson Road, Will the City of Edina & the railroad company pay their fair share of the assessments? Thank you for your clarification. RuthAnn Metzger From:Aaron Ditzler To:Pat Finley Subject:RE: 2020 Road Construction W 56th Date:Tuesday, August 20, 2019 2:03:05 PM Pat, I appreciate the input and the current conditions, that helps. If we narrow the street, it may not necessarily mean narrowing the intersection. We’ll look into it. Thank you. Aaron Ditzler, Assistant City Engineer 952-826-0443 | Fax 952-826-0392ADitzler@EdinaMN.gov | EdinaMN.gov Share your thoughts and ideas with the City online! Visit www.BetterTogetherEdina.org. From: Pat Finley <Finbernard@aol.com> Sent: Tuesday, August 20, 2019 1:49 PM To: Aaron Ditzler <ADitzler@EdinaMN.gov> Subject: Re: 2020 Road Construction W 56h EXTERNAL EMAIL ALERT: This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Aaron. Thanks for the reply. I suggest you or someone spend a hour or two watching the turns at the corner of Hanson and 56th. Its a tight turn made difficult by the angle. There are often cars (from the Fraser house) parked on 56th which makes it even more difficult. Often when soccer/football/baseballgames are being played at Garden park cars park on 56th for a quick getaway rather than using the parking lot. Those of us who live close by and make that turn are very cautious. We often have to take turns. If the street is made more narrow because of the sidewalk the turn will become even more hazardous than it is now. I just don’t think a sidewalk that narrows the present width is good plan. Someone from engineering really needs to study what goes on at that corner now before making a final decision. THanks for hearing my input. Pat Finley Sent from my iPad On Aug 20, 2019, at 12:06 PM, Aaron Ditzler <ADitzler@edinamn.gov> wrote: Pat, th Our plan is to install a sidewalk along W. 56 St., including the portion between Hansen and Dale. Our standard street section is 24 feet wide where a 5’ wide sidewalk is proposed to be installed. However, it’s highly unlikely a 24 feet wide street will fit in that narrow corridor. Therefore, we’ll look at a narrower street section (to be determined width) with a 5’ wide sidewalk this fall. Thank you. <image001.gif>Aaron Ditzler, Assistant City Engineer 952-826-0443 | Fax 952-826-0392ADitzler@EdinaMN.gov | EdinaMN.gov Share your thoughts and ideas with the City online! Visit www.BetterTogetherEdina.org. From: < Sent: Tuesday, August 20, 2019 11:45 AM To: Aaron Ditzler <ADitzler@EdinaMN.gov> Subject: 2020 Road Construction W 56h EXTERNAL EMAIL ALERT: This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Hi Aaron. I missed the meeting on the 2020 Road construction but looked at the presentation on Better Together Edina. I notice the plan to add sidewalks on w 56th. The street between Dale and Hansen is already very narrow. To add the sidewalk you will need to take several feet of property from the owners on that stretch. Is that really the plan? or will the sidewalk stop at Dale? I live on Bernard so just wondering how that will play out. Thanks Pat Finley 5603 Bernard From:Aaron Ditzler To:mark razidlo Cc:Jeanne Razidlo Subject:RE: 2020 roadwork questions Date:Thursday, August 22, 2019 10:57:32 AM Mark, Here are the answers to your questions. 1. Questionnaire – Please complete online by 8/30/19 using the link below (one per household) a. https://www.surveymonkey.com/r/MelodyGrandview 2. Utility Services lines – Contractor list for inspecting your services can be found using the link below. This is not required, but recommended since your service lines may be nearing the end of their useful life. Probably best for you to call me if you have specific questions. a. https://www.edinamn.gov/DocumentCenter/View/824/List-of-Plumbers-PDF?bidId= 3. Irrigation Systems – Likely will be damaged during construction. The contractor will repair the systems. Nothing needs to be done prior to or during construction. There will be some property owner coordination immediately after the irrigation repair to confirm the system is functioning appropriately. 4. Concrete work – Bulkhead style curb (Design B618) will be installed as well as aprons as referenced in the links below. Sidewalk is proposed along Hansen Rd and W. 56th St. Sidewalk is not proposed on Melody Lake Drive. The proposed sidewalk locations can be seen in the Pedestrian Master Plan on page 63. a. https://www.edinamn.gov/DocumentCenter/View/854/500---Concrete-Curb-and- Gutter-PDF b. https://www.edinamn.gov/DocumentCenter/View/856/400---Residential-Driveway- Aprons-PDF c. https://www.edinamn.gov/DocumentCenter/View/5433/Final-Master-Plan-Report-PDF 5. Driveway / Road Design – If your driveway has positive drainage from the garage to the street before the project and will have negative slope after the project we would meet with you in Spring 2020 to discuss it and how we would prevent stormwater from drainage into your garage. Having said that, it would be unusual for us to need to design the street that way. Our street design occurs in the winter prior to construction. Thank you. Aaron Ditzler, Assistant City Engineer 952-826-0443 | Fax 952-826-0392ADitzler@EdinaMN.gov | EdinaMN.gov Share your thoughts and ideas with the City online! Visit www.BetterTogetherEdina.org. From: mark razidlo < Sent: Thursday, August 22, 2019 8:41 AM To: Aaron Ditzler <ADitzler@EdinaMN.gov> Cc: Jeanne Razidlo < Subject: 2020 roadwork questions EXTERNAL EMAIL ALERT: This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Hi Aaron- We were out of town for the 8/12 meeting but downloaded the presentation and have a couple questions, please respond with answers or if it's easier just call my cell at and let's talk or leave me a message. Thanks, Mark Razidlo (5616 Melody Lake Drive) -We didn't see/fill out the questionnaire and want to, so can you send one via email or can I pick one one at City Hall? -Your presentation mentions timing services (sewer upgrades, connecting to the city sump drain, etc.), did you get into more detail on that in the meeting? Anything to share, or will that be discussed again in meetings coming in December? -You also mentioned reimbursement for things like damaged irrigation (which we will have), assume that will be discussed/dealt with next year once the work is started and the scope of damage in known, so nothing to worry about now, correct? -Looks like there will be curbs and possibly sidewalks added. Is it a straight or sloped curb? And do you know which side of our street will have the sidewalk added? -Finally, we have a question about the height of the new roadway relative to what it is now. We have a very low grade on our 70-foot driveway from our garage door to the road, so low that if the new road is higher we are concerned that the water might actually flow back from the road and flood our garage. I've talked with the survey guys and they say new roads are usually put in slightly lower than the old surface for exactly that reason, but wondering if you can confirm that. Look forward to hearing from you, thanks, Mark From: To:Aaron Ditzler Subject:Re: Catch Basin on Code Avenue Date:Friday, July 12, 2019 4:34:00 PM Mr. Ditzler, That is such good news. Thank you. Jim Doudiet -----Original Message----- From: Aaron Ditzler <ADitzler@EdinaMN.gov> To: < Sent: Fri, Jul 12, 2019 2:38 pm Subject: RE: Catch Basin on Code Avenue Jim, Our first priority will be to move the storm drain a couple feet away from your driveway. If from some reason the design prevents us from moving the storm drain, we’ll replace the casting with a “drive over” casting that doesn’t have the high back part on it. Thank you. Aaron Ditzler, Assistant City Engineer 952-826-0443 | Fax 952-826-0392ADitzler@EdinaMN.gov | EdinaMN.gov Share your thoughts and ideas with the City online! Visit www.BetterTogetherEdina.org. From: < Sent: Friday, July 12, 2019 11:58 AM To: Aaron Ditzler <ADitzler@EdinaMN.gov> Subject: Catch Basin on Code Avenue Dear Mr. Ditzler, One of your men working this morning on Code Avenue gave me your card and suggested I contact you. Next summer our neighborhood will have the streets redone, and I have a request for your consideration. The catch basin at 57th and Code on the east side of the street is right up against our driveway. I was wondering if it could be moved a few feet north to create more space between the drain and the edge of the driveway? If that is possible to do, we would be most grateful. Thanks. Jim Doudiet From:Aaron Ditzler To:Corey Strickland; Leah Strickland Bcc:Charles Gerk Subject:RE: Hansen Rd - 5325 Benton Ave Date:Monday, August 17, 2020 9:01:05 AM Corey and Leah, 1. We can extend the natural stone retaining wall across your existing Hansen Road driveway during construction. 2. A residential curb cut permit is required. Contact the Engineering Department to schedule a pre-pour inspection at least 24 hours in advance. Additional requirements and the online permit application can be found online a. https://www.edinamn.gov/366/Residential-Curb-Cut-Driveway-Entrance 3. We can discuss the trees during the design phase this winter after we’ve have a chance to look at potential construction impacts on both the east and west sides of Hansen Road. Thank you. Aaron Ditzler, Assistant City Engineer 952-826-0443 | Fax 952-826-03927450 Metro Blvd. | Edina, MN 55439ADitzler@EdinaMN.gov | EdinaMN.gov Stay informed about the City’s response to COVID-19 at EdinaMN.gov/Coronavirus. Need a hand or want to help? VisitBetterTogetherEdina.org/COVID-19. Share your thoughts and ideas with the City online! Visit www.BetterTogetherEdina.org. From: Corey Strickland < Sent: Saturday, August 15, 2020 11:34 AM To: Aaron Ditzler <ADitzler@EdinaMN.gov> Cc: Leah Strickland < Subject: Hansen Rd - 5325 Benton Ave EXTERNAL EMAIL ALERT: This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Aaron, Thank you so much for meeting and discussing the Hansen Rd project with me yesterday morning. I wanted to document a few things from our conversation: 1) As we are closing off the Hansen Rd entrance to our drive this year, we won’t complete all the plantings near the curb, as it’s our understanding the contractors will remove the drive cut in when the road is repaved next year. In addition, we’d like to have the thin stone retaining wall extended across some or much of the drive entrance as far as it makes sense in front of the stop sign. 2) we are still exploring potentially extending the width of the Benton Ave driveway. Our current driveway opening is around 10-12 feet. We are potentially opening it another 2 feet. Based on our conversation this was acceptable. Our driveway contractor will be out this week to assess. As we previously discussed, we will already be doing a new curb cut and apron as the current apron and curb cut are in bad shape. 3) id really like to discuss the need to keep the mature oak trees and sumac that are along side the Hansen Rd portion of our property. These trees provide much shade and privacy for our yard and are extremely mature trees that are healthy and thriving. We’d really like to discuss options here when the paving project gets closer. Thanks again! Corey & Leah Strickland From:Andrew Scipioni To:"Greta Santori" Subject:RE: Melody Lake 2020 Project Date:Wednesday, October 10, 2018 11:08:10 AM Greta, Thank you for the feedback. The best method to express your opposition to the proposed sidewalk is to submit a petition to City Council (https://www.edinamn.gov/367/Petition). This standard form is typically used to ask Council to consider a public improvement project, but can also be used to ask Council not to consider a project. A petition can be submitted at any time; however, because this project is still 2 years away, I would suggest submitting sometime between June and November of 2019. During this time, Engineering staff will be determining the scopes of the 2020 projects in much more detail and will be submitting proposals to the Council in November. If you decide to submit your petition earlier, Council may decide to act on it or they may decide to table it until later in 2019 and discuss along with the project proposals submitted by Engineering. Until such time that Engineering is given explicit direction otherwise from Council, we will proceed with incorporating the West 56th Street sidewalk into the Melody Lake A reconstruction project, as is recommended by the Pedestrian and Bicycle Master Plan (https://www.edinamn.gov/494/Pedestrian-Bicycle-Master-Plan). If you have further questions or concerns about the proposed reconstruction project, feel free to contact me directly or the Engineering Department at 952-826-0371. If you have questions about the petition process, you can contact City Clerk Deb Mangen at 952-826-0408 (I apologize, the second page of the petition form has the wrong phone number). Andrew Scipioni, EIT, Engineering Technician 952-826-0440 | Fax 952-826-0392 ascipioni@EdinaMN.gov | EdinaMN.gov Stay informed! Sign up for City Extra emails! -----Original Message----- From: Greta Santori [mailto Sent: Wednesday, October 10, 2018 5:32 AM To: Andrew Scipioni Subject: Melody Lake 2020 Project Good morning, I live in the melody lake neighborhood and am writing in strong opposition to the sidewalk on 56th from Hanson to code. It is completely against what the neighborhood wants and opinions voiced at previous meetings. It would lead no where and the area would be better served with one on Hanson or Benton. It costs more and takes up more yards. We don’t want it. How do we go about getting it removed?! Thanks Greta Santori From:Aaron Ditzler To:Jen Stack Subject:RE: Melody Lake Project Date:Monday, July 27, 2020 8:14:42 AM Jen, It’s true that Benton Avenue is not included in the proposed 2021 street reconstruction project. Benton Ave is a municipal state aid (higher volume collector) and these are reconstructed separately from local streets. Because Benton Ave was overlayed with new pavement in 2017, it won’t be in the street reconstruction program for at least seven years. Pedestrian or shared use path improvements are proposed along Benton Ave in conjunction with future street reconstruction. Thank you. Aaron Ditzler, Assistant City Engineer 952-826-0443 | Fax 952-826-03927450 Metro Blvd. | Edina, MN 55439 ADitzler@EdinaMN.gov | EdinaMN.gov Stay informed about the City’s response to COVID-19 at EdinaMN.gov/Coronavirus. Need a hand or want to help? VisitBetterTogetherEdina.org/COVID-19. Share your thoughts and ideas with the City online! Visit www.BetterTogetherEdina.org. From: Jen Stack < Sent: Sunday, July 26, 2020 9:44 AM To: Aaron Ditzler <ADitzler@EdinaMN.gov> Subject: Melody Lake Project EXTERNAL EMAIL ALERT:This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Hi Aaron, I hope you are having a good summer. We spoke last winter about the Melody Lake/Grandview/Birchcrest Project. My neighbors and I thought that Benton Ave was included in the project. We thought that a sidewalk was being put in to keep pedestrians and bicyclists safe from Eastview Dr to Hansen Rd From the project map, it looks like Benton Ave is being left out. is this true? If so, when will Benton be repaired? thank you! Jen Stack From: To:Aaron Ditzler Subject:Re: Melody Lake Reconstruction W 56th Sidewalk Date:Tuesday, October 27, 2020 3:21:06 PM EXTERNAL EMAIL ALERT: This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Aaron Thanks. I thought Benton would be reconstructed. If it isn't then I agree with you. That will be the escape route for most people. For me I will still you W 56th St when I can. Patrick Finley In a message dated 10/27/2020 2:40:16 PM Central Standard Time, ADitzler@EdinaMN.gov writes: Patrick, Because Benton Ave will not be reconstructed in 2021, Benton will be a favorable east / west paved access road in and out of the project area. For that reason I’m not concerned about the entire sidewalk being installed in 2021 from Hansen Rd to Normandale Road. Thank you. Aaron Ditzler, Assistant City Engineer 952-826-0443 | Fax 952-826-0392 7450 Metro Blvd.|Edina, MN 55439 ADitzler@EdinaMN.gov | EdinaMN.gov Stay informed about the City’s response to COVID-19 at EdinaMN.gov/Coronavirus. Need a hand or want to help? Visit BetterTogetherEdina.org/COVID-19. Share your thoughts and ideas with the City online! Visit www.BetterTogetherEdina.org. From: < Sent: Tuesday, October 27, 2020 11:42 AM To: Aaron Ditzler <ADitzler@EdinaMN.gov> Subject: Melody Lake Reconstruction W 56th Sidewalk EXTERNAL EMAIL ALERT: This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Hi Aaaron We have communicated about this project earlier. There seems to be much opposition to the sidewalk proposal for W 56th. Earlier the plan was to add the sidewalk from Code to Hansen as part of the 2021 project with the plan to add the sidewalk from Code to Frontage road at a later time. Now apparently that plan has changed so that the complete sidewalk will be installed in 2021. I live at 5603 Bernard Pl. To leave my immediate neighborhood my neighbors use either Hansen or W 56th. to go up to the commercial stores on Vernon or to access Hwy 100. Since Hansen will be under reconstruction if the sidewalk on W 56th is installed simultaneously traffic snarls will be most difficult. Therefore I recommend that the sidewalk (from Code to Frontage) be delayed to another year(This was the original plan). This will allow a much better and safer trafiic flow because most residents will avoid Hansen and use W 56th to exit the area.instead. This will put even more congestion on W 56th.and with the sidewalk installation will make the exit very congested and unsafe. I strongly urge the city to delay the W 56th sidewalk to a later year. Thank you Patrick Finley 5603 Bernard Pl Edina, MN 55436 From:Aaron Ditzler To:finbernard@aol.com Subject:RE: Melody Lake Road reconstruction 2021 Date:Tuesday, September 8, 2020 4:03:08 PM You’re welcome Pat. We appreciate the positive feedback. Aaron Ditzler, Assistant City Engineer 952-826-0443 | Fax 952-826-03927450 Metro Blvd. | Edina, MN 55439 ADitzler@EdinaMN.gov | EdinaMN.gov Stay informed about the City’s response to COVID-19 at EdinaMN.gov/Coronavirus. Need a hand or want to help? VisitBetterTogetherEdina.org/COVID-19. Share your thoughts and ideas with the City online! Visit www.BetterTogetherEdina.org. From: < Sent: Tuesday, September 8, 2020 3:09 PM To: Aaron Ditzler <ADitzler@EdinaMN.gov> Subject: Re: Melody Lake Road reconstruction 2021 EXTERNAL EMAIL ALERT: This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Aaron Thank you for your prompt and complete reply to my questions. The videos are excellent so I think I am well informed on the process and what I need to know.The list of contractors is great to have also. I appreciate all your help and input. Pat Finley In a message dated 9/8/2020 2:17:11 PM Central Standard Time, ADitzler@EdinaMN.gov writes: Pat, Thanks for you questions. 1. It’s optional to insert a liner into your sanitary sewer service line. If you choose to do this, you can reach out to the contractors on the attached list for a quote. 2. If you choose to do the water line, you can reach out to the contractors on the attached list for a quote. They should be able to televise it and share the results with you. Optional water line replacements should be done next spring / early summer before concrete curb and gutter and asphalt paving are complete. 3. Coordinate the work with our street reconstruction project. Don’t do the work before concrete curb and gutter and asphalt paving are complete or we’ll damage the new driveway. You can reach out to the contractors on the attached list for a quote. You should select a contractor to do the work next spring and share with them our schedule. Once the concrete curb has been installed by the City’s contractor, contact your contractor to have your new driveway installed. This way there will be no driveway “seam” between the City’s work and your new driveway. Your contractor may want to remove your existing driveway before or after the new curb has been installed. 4. We’ll mail you a letter before construction begins next spring. That letter will have contact information for the project inspector. Reach out to the inspector regarding access and we can work with your navigation needs. 5. We recommend getting more than one quote for the utility and driveway work. Thank you. Aaron Ditzler, Assistant City Engineer 952-826-0443 | Fax 952-826-0392 7450 Metro Blvd. | Edina, MN 55439 ADitzler@EdinaMN.gov | EdinaMN.gov Stay informed about the City’s response to COVID-19 at EdinaMN.gov/Coronavirus. Need a hand or want to help? VisitBetterTogetherEdina.org/COVID-19. Share your thoughts and ideas with the City online! Visit www.BetterTogetherEdina.org. From: < Sent: Tuesday, September 8, 2020 11:51 AM To: Aaron Ditzler <ADitzler@EdinaMN.gov> Subject: Melody Lake Road reconstruction 2021 EXTERNAL EMAIL ALERT: This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Hello Could you answer a few questions please. 1. My sewer line was inspected and is in good shape. However, I understand that I should insert a liner during the reconstruction. Is this mandatory or optional? Does the city make the arrangements to do this? 2. I am not clear on the water line. I understand the ownership cut-off etc. My house/line is 48 years old. Who /how does the water line inspection and when should it be done? and who do you recommend ? 3. I probably should replace my asphalt driveway. Because the city will be installing a concrete apron should I wait until after the work is complete or would I be better served if I replace it now.? 4. My wife and I are both physically limited with old age and arthritis. Are there special arrangements for help during the days we are unable to navigate the street. Thanks for your reply Pat Finley 5603 Bernard Pl Edina, Mn 55436 From:Chad Millner To: Cc:Aaron Ditzler Subject:RE: Melody Lake Road Date:Thursday, November 21, 2019 5:03:00 PM Attachments:Melody Lake A and Meloday Lake B Petition.pdf Holly, Thanks for the note and comments. We did receive a petition from residents of the neighborhood. The graphic attached shows who signed it. Staff considered budgets, workload, impacts to residents over two years, etc. and recommended to the city council to delay until 2021. This would allow the entire neighborhood to be done in one year and reduce the impacts to the residents along the border streets. The council accepted the recommendation to delay until 2021. Thanks, Chad Chad Millner, Director of Engineering 952-826-0318 | Fax 952-826-0392 cmillner@EdinaMN.gov | EdinaMN.gov Share your thoughts and ideas with the City online! Visit www.BetterTogetherEdina.org. -----Original Message----- From: < Sent: Wednesday, November 20, 2019 3:10 PM To: Chad Millner <cmillner@EdinaMN.gov> Subject: Melody Lake Road EXTERNAL EMAIL ALERT: This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Hello Chad, There is some chatter on Nextdoor.com regarding the road construction in our neighborhood being pushed back to 2021. I hope this is not the case for our street, it’s in very bad shape and my neighbors and I were looking forward to a new street that we can ride our bikes on. Our address is 5724 Melody Lane. I hope the opinions of a few neighbors did not push this project back for everyone. Thank you! Holly Guth Sent from my iPhone From:Aaron Ditzler To:phillip sussman Subject:RE: Melody Lakes Date:Tuesday, November 24, 2020 8:01:51 AM Attachments:Pages from 20190812 Info Meeting 2020 Projects.pdf Phillip, The estimated assessment range at the informational meeting on 8/12/19 was $13,000 to $19,900. See the attached excerpt from the presentation. We did not present one estimated assessment amount because the project was postponed in fall 2019. Below average soil conditions exist under the pavement and gravel base throughout the neighborhood. Estimated assessments include costs for replacement of poor soils with more stable soils. We are estimating a larger volume of soil replacement for streets on the south half of the neighborhood when compared to the north half, hence the primary reason for the increased estimated assessment amount. Thank you. Aaron Ditzler, Assistant City Engineer 952-826-0443 | Fax 952-826-03927450 Metro Blvd. | Edina, MN 55439ADitzler@EdinaMN.gov | EdinaMN.gov Stay informed about the City’s response to COVID-19 at EdinaMN.gov/Coronavirus. Need a hand or want to help? VisitBetterTogetherEdina.org/COVID-19. Share your thoughts and ideas with the City online! Visit www.BetterTogetherEdina.org. From: phillip sussman < Sent: Monday, November 23, 2020 3:57 PM To: Aaron Ditzler <ADitzler@EdinaMN.gov> Subject: Melody Lakes EXTERNAL EMAIL ALERT: This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Hi Arron, I am a resident at 5728 Dale Ave on the corner of Grove and Dale. Regarding the 2021 project, the costs were estimated at $24200 per REU. If memory serves me correctly, when the project was considered for 2020, the estimated cost was $13000-14000. Was that estimate correct? If so why is the projected cost so much higher for 2021? I look forward to your response. Thank you. Phillip Sussman 5728 Dale Ave. From:Andrew Scipioni To:Huppert, Boyd Subject:RE: Monday night meeting Date:Wednesday, August 14, 2019 10:32:47 AM Boyd, Here is the link for the Melody Lake A/Grandview A questionnaire: https://www.surveymonkey.com/r/MelodyGrandview Thanks for sending these photos, as well. Our Traffic Safety Coordinator has forwarded your request to the City Forester to have the vegetation trimmed down to improve sightlines. If this problem persists or you notice it in other areas around the City, you can report it using Edina 311 (https://www.edinamn.gov/891/Report-a-Problem-on- Edina-311). There is a specific category for overgrown vegetation near streets or sidewalks, and you can attach photos. Edina 311 is also available as a mobile app for Apple and Android phones. Let me know if you have any other question. Andrew Scipioni, Transportation Planner 952-826-0440 | Fax 952-826-0392 ascipioni@EdinaMN.gov | EdinaMN.gov Share your thoughts and ideas with the City online! Visit www.BetterTogetherEdina.org. -----Original Message----- From: Huppert, Boyd < Sent: Tuesday, August 13, 2019 11:30 PM To: Andrew Scipioni <ascipioni@EdinaMN.gov> Subject: Monday night meeting EXTERNAL EMAIL ALERT: This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Andrew, We spoke Monday evening at the streets meeting. Two quick things. Could you send me the questionnaire that was sent out earlier? I checked with my wife and she hasn’t seen it either. We’d like to offer our support for the sidewalk that’s been proposed along 56th Street. Also, I mentioned the state of the overgrown vegetation within the spiral of the pedestrian bridge east of highway 100 and north of the community center. I’ve been involved in two near misses while biking since it’s impossible to see bikers or pedestrians rounding the other side. The situation is made worse by tree branches forcing riders and pedestrian into the same path. I’ve attached a few photos. Could you please forward to the appropriate person? I’d hate for someone to get hurt needlessly. Thank you! Boyd Huppert 5600 Bernard Place Edina, MN 55436 From:Andrew Scipioni To:"RuthAnn Metzger" Subject:RE: More questions about the 2020 Roadway Reconstruction for Melody Lake A Date:Friday, October 19, 2018 5:01:29 PM RuthAnn, I apologize for the delay in my response. Here is my answer to your recent question: As you mentioned, this ordinance specifically applies to demolition permits, subdivision applications and building permits. If the trees you mentioned are located entirely on your property, then they are very unlikely to be impacted by our roadway reconstruction. If they are partially or completely located within the right-of-way, then they may be impacted. We won’t know for certain until later next summer when our surveyors perform a topographic survey of the neighborhood. Generally, we try to protect mature trees when we can, but sometimes our proposed improvements require them to be removed. In those cases, we reach out to the property owners to discuss tree replacement options. Here are my responses to your previous questions: Examples of streets that were recently reconstructed to a 24’ width with a 5’ sidewalk (as is currently recommended on W 56th St) are as follows: - W 60th St from School Rd to Concord Ave (Concord neighborhood, reconstructed in 2018) - Valley View Rd from Tracy Ave to Hansen Rd (Birchcrest neighborhood, reconstructed in 2017) - Hansen Rd from Valley View Rd to W 60th St (Birchcrest neighborhood, reconstructed in 2017) - Maddox Ln from Hansen Rd to Mildred Ave (Birchcrest neighborhood, reconstructed in 2017) - Olinger Rd from Vernon Ave to Olinger Blvd (Countryside neighborhood, reconstructed in 2017) - Concord Ave from Southview Ln to Lexington Ave (Golf Terrace neighborhood, reconstructed in 2016) - Beard Ave from W 62nd St to W 60th St (Strachauer Park neighborhood, reconstructed in 2016) Once you have a completed petition, you can either drop it off at City Hall for the City Clerk, mail it to City Hall (c/o City Clerk), or email it to mail@EdinaMN.gov and it will be forwarded to the City Clerk and Council. Since this project will not be considered by City Council until December 2019, I would suggest the best time to submit would be July-October 2019. During this period, Engineering staff will be determining the full scope of the project and preparing cost estimates. Typically, Council will ultimately decide whether or not to proceed with the sidewalk at the Public Improvement Hearing in December. You can certainly submit a petition earlier than the time frame I’ve suggested, but Council may decide not to act on it until the project is officially brought before them in December 2019. We do realize that more sidewalks may result in additional salt usage; however, we attempt to offset this impact by making reductions to the overall roadway surface (narrowing the streets) so as to reduce the City’s total area of impervious surfaces. Unfortunately, this is a situation where two of the City’s long-term objectives are somewhat at odds with each other; we do want to reduce salt usage, but we also want to expand our network of pedestrian facilities to improve mobility for all types of users. Both properties you mentioned are currently zoned as Single-Family Residential, and as such, would be subjected to the same assessment rate as any other single-family home within the project area. The current assessment policy does not factor taxes paid per individual property. Andrew Scipioni, EIT, Engineering Technician 952-826-0440 | Fax 952-826-0392ascipioni@EdinaMN.gov | EdinaMN.gov Stay informed! Sign up for City Extra emails! From: RuthAnn Metzger [mailto: Sent: Friday, October 19, 2018 3:36 PMTo: Andrew ScipioniCc: Ra Subject: Re: More questions about the 2020 Roadway Reconstruction for Melody Lake A Andrew, I hope you are working on getting answers to my 10/13/18 email’s questions below. When can expect to receive answers? This week I read Edina’s tree ordinance which went into effect 7/1/15 for demos & building permits and want to verify that my elm tree in the backyard & locust tree in the front yard will be protected as this ordinance states during the 2020 Roadway Reconstruction. Will they? What about the redbud that I had planted around 2000? Looking forward to your reply with answers to my questions from today & from my 10/13/18 email below. If I have not heard from you by the end of Oct, I will be contacting someone at City Hall to verify that you are still on the Roadway Reconstruction projects. Thanks. RuthAnn Metzger On Oct 13, 2018, at 12:07 PM, RuthAnn Metzger < wrote: Andrew. Could you please tell me a street which has had a sidewalk added to it like we will get along 56th St.? Once I have the signed petitions against the sidewalk being added to 56th St who should I submit them to & by what date? Has anyone at City Hall realized that by adding more sidewalks to Edina, homeowners will be using more salt on the added sidewalks? I thought the City was trying to reduce salt usage. Since I live between two group homes (one on the corner of Hansen Road & 56th St. at 5617 Hanson Road and the other one on the corner of 56th St & Dale Ave at 5313 56th St.), I want to make sure that they are being assessed the same that I will be for the 2020 Roadway Reconstruction — are they? They will get the same benefits that I will plus definitely use the streets more than I do. Plus do they pay the equivalent property taxes like I do? Thank you for your previous answers & hopefully the clarifications on my latest questions. RuthAnn Metzger On Sep 25, 2018, at 3:02 PM, Andrew Scipioni <AScipioni@EdinaMN.gov> wrote: RuthAnn, I’m sorry my last name’s a little difficult, but I’m glad you were able to reach me! Attached is the presentation from last night, as well as the maps that were displayed. To answer your questions below: - As of now, the plan would be to only construct the sidewalk within the project limits (from Hansen Road to Code Avenue). The current Pedestrian Facilities Map shows that this sidewalk will eventually extend all the way to Normandale Road. Since the neighborhood to the east of Code Avenue (Melody Lake C) was reconstructed in 2012, we are not certain when the sidewalk between Code Avenue and Normandale Road would be constructed. Ideally, we would install new pedestrian and bicycle facilities as part of street reconstruction projects; however, since this sidewalk was added to the plan after the neighborhood was reconstructed, that opportunity has passed. At this point, I see three events that could affect the construction of the sidewalk between Code Avenue and Normandale Road: o Council may direct staff to construct all of the W 56th Street sidewalk as part of the Melody Lake A/Grandview A reconstruction project in 2020 (Council made a decision for the Valley View Road sidewalk as part of the Birchcrest A reconstruction project in 2017) o Residents on W 56th Street or in the Melody Lake C neighborhood may petition the City to construct this sidewalk segment o Staff may recommend installing this sidewalk segment as part of a future roadway maintenance project, like a mill and overlay (the tentative maintenance schedule for Melody Lake C is an overlay in 2035) Both the attached Pedestrian Facilities Map and Bicycle Facilities Map are part of the City’s Pedestrian and Bicycle Master Plan (https://www.edinamn.gov/494/Pedestrian-Bicycle- Master-Plan). For more information on this plan and the process that went into creating it, I’d suggest contacting Mark Nolan, who’s contact information can be found in this page. - Here is the link to the City’s official petition form: https://www.edinamn.gov/367/Petition. Generally, this form is used to advocate for a public improvement project, but can certainly be used to advocate against one. One the third page of this form, there are check boxes to indicate which improvement you are petitioning for. There is also a box for “other” which can be used to petition against an improvement. - The same form can be used to petition the City to plow the W 56th Street sidewalk, if the decision is made to proceed with construction (under “other,” I would suggest calling it “sidewalk maintenance” to differentiate it from new sidewalk construction) For all of the 2020 project areas, the next steps in the design process are as follows: - Spring/early summer 2020: Engineering and Public Works staff will evaluate existing infrastructure to determine the scope of improvements - June 2020: resident questionnaire will be mailed to all properties within the project limits - July 2020: Engineering will host an informational meeting to discuss specific scope of each project and provide estimated range of special assessments - July-October 2020: Engineering will prepare an engineering study for each project area, explaining the proposed improvements and funding sources - December 2020: Engineering will hold a Public Hearing before the City Council and recommend approval of the project (all properties within the project area will receive notice of this hearing per state statues) If there’s any other information I can provide, please let me know. Please feel free to share my contact information with your neighbors if they have questions or comments about the project. Andrew Scipioni, EIT, Engineering Technician 952-826-0440 | Fax 952-826-0392ascipioni@EdinaMN.gov | EdinaMN.govStay informed! Sign up for City Extra emails! From: RuthAnn Metzger [mailto: Sent: Tuesday, September 25, 2018 1:46 PMTo: Andrew Scipioni Cc: Ra Subject: Fwd: Powerpoint & maps from 9/24/18 6 PM presentation on 2020 2021 Neighborhood Roadway Reconstruction plus questions Trying this again with all of the “i”’s. Please see my email below. Thanks. RuthAnn Metzger Begin forwarded message: From: RuthAnn Metzger < Subject: Powerpoint & maps from 9/24/18 6 PM presentation on 2020 2021 Neighborhood Roadway Reconstruction plus questions Date: September 25, 2018 at 1:39:09 PM CDT To: asciponi@EdinaMN.gov Cc: Ra < Kevin Bohrer < Katie Lewis < Kristin Engman < Andrew, Please send me the Powerpoint & maps from 9/24/18 6 PM presentation on 2020 2021 Neighborhood Roadway Reconstruction. Also here are some additional questions I would like answered: How far east will the sidewalk on 56th St. go from Hanson Road? Since 56th St. east of Melody Lake A was done several years ago & no sidewalk was added the their portion of 56th St. what is the objective of adding a sidewalk to my portion? Please also include a link to the walkability/bike-ability study referenced last night. I would like the no sidewalk petition format that you mentioned exists. Also if the decision is made to move ahead with a sidewalk along 56th with this project, I want to know how to get the City of Edina to maintain it. There is no way during a typical or bad winter that I will be able to keep a sidewalk clear since I can barely keep my driveway open with these new big & fast snowplows that bury me each time they come thru. Thank you so much for reminding us at the presentation that we can add coverage for service lines in & out of our house to our homeowners insurance. I did that today since my homeowners renewal is on Fri! Please keep me in the loop especially about 56th St since I have a corner lot at 56th & Dale Ave. Thanks. RuthAnn Metzger Kristin — I do not have Jon’s email address so please share this email with him. Since he was at the meeting last night also, I thought he might like to see what my questions are for the presenters. Looks like we have a new battle to fight! <20180924 2020_2021 Open House.pdf> From:Andrew Scipioni To:Alissa Movern Subject:RE: Online Form Submittal: Contact Us Date:Tuesday, October 29, 2019 10:44:11 AM Alissa, The City does have long-term plans to install a sidewalk on W 56th St between Code Ave and Normandale Rd; however, staff is not recommending constructing this segment in 2020. At the time this area was reconstructed (2012), the City was still funding new sidewalks through special assessments to adjacent property owners. Starting in 2013, sidewalks are now entirely funded by the Pedestrian and Cyclist Safety (PACS) Fund, which is generated through private utility franchise fees. With the creation of this fund, and subsequent network planning efforts (such as the Pedestrian and Bicycle Master Plan), the City has decided to take a more proactive approach to improving conditions within the City for those who walk or bike. While I agree that a painted facility on the street would be less costly and easier to maintain, there is no precedent for such a facility in Edina. Our recent engagement efforts indicated a strong desire among those who walk and bike in the City to be more separated from motor vehicle traffic. This sentiment is reflective of the general consensus within the industry; that people feel safer and are more likely to walk or bike when they are provided a facility separated from motor vehicles. In my opinion, a painted lane on the roadway would not be considered sufficiently safe or comfortable to most people who walk or bike. When the City identifies the best opportunity in the future to install this remaining portion of sidewalk (Code to Normandale), staff will reach out to affected property owners to discuss construction limits and impacts. All associated costs at that time will be covered by the PACS Fund. As of now, this segment is not in the City’s 5-year Capital Improvement Plan. Given our other priorities across the City, I would generally place this segment in the 10-15 year timeframe; however, that schedule is purely speculative and subject to change. Thanks, Andrew Scipioni, Transportation Planner 952-826-0440 | Fax 952-826-0392ascipioni@EdinaMN.gov | EdinaMN.gov Share your thoughts and ideas with the City online! Visit www.BetterTogetherEdina.org. From: Alissa Movern < Sent: Monday, October 28, 2019 8:22 PM To: Andrew Scipioni <ascipioni@EdinaMN.gov> Subject: Re: Online Form Submittal: Contact Us EXTERNAL EMAIL ALERT: This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Hi Andrew, Thank you for your email. I just want to clarify that there is not a proposal for a sidewalk from code to the frontage road on west 56th? The map shows that there is. Also are there any instances in Edina where instead of putting a sidewalk in there has been a painted bike lane used instead? This seems like a more cost effective solution that requires less maintenance from the city and home owners? I would also appreciate if the planning committee reviewed the input from the homeowners on w. 56th street when the street reconstruction was originally completed. We were surveyed and there was little interest in sidewalks or street lamps. Thank you! Sent from my iPhone On Oct 28, 2019, at 2:02 PM, Andrew Scipioni <ascipioni@edinamn.gov> wrote: Alissa, Thank you for your email; I’m happy to provide some additional information. At the October 24 meeting, the Transportation Commission was presented the draft engineering studies for the 2020 roadway reconstruction projects. One of these projects is Melody Lake A/Grandview A, which includes a proposed sidewalk on the south side of W 56th St between Hansen Rd and Code Ave. This sidewalk is recommended in the City’s Pedestrian and Bicycle Master Plan (https://www.edinamn.gov/494/Pedestrian- Bicycle-Master-Plan), which was approved by City Council in 2018. The development of this plan included significant public engagement throughout 2017, including online materials and surveys, open houses, meetings with the Transportation and Planning Commissions and finally, a City Council public hearing. In general, the network of sidewalks, trails and bike facilities recommended by this plan is intended to provide connections to schools, parks, between neighborhoods and to other popular amenities and destinations. As the draft engineering study stated, staff is currently only proposing to construct the W 56 St sidewalk between Hansen Rd and Code Ave in 2020 (within the project limits of the roadway reconstruction project). The south side of the street was selected after evaluating impacts within the right-of-way, including trees, landscaping and utility poles. While the Plan ultimately recommends continuing the sidewalk further east to the frontage road, staff understands that retrofitting a sidewalk in an area that was recently reconstructed comes with significant challenges and impacts. If the sidewalk east of Code Ave is not proposed for construction in 2020, it would remain a recommended facility per the Pedestrian and Bicycle Master Plan. This means that staff would consider installing it a later time; most likely, in conjunction with a future overlay project or if the City were to receive a petition from adjacent property owners. The meetings of the Transportation Commission are no longer televised, so there are no videos since October 2016 for you to view. However, the final meeting minutes can be found here - https://edina.novusagenda.com/agendaintranet/. The Commission will meet again Thursday, November 21 at 6:00, but they will not be discussing this project as part of their agenda. You are certainly welcome to attend, however, to voice your comments and concerns, or you could use the online Correspondence Submission form (https://edinadocs.edinamn.gov/Forms/contact) to share your feedback with the entire commission. The next public meeting where the Melody Lake A/Grandview A project will be discussed is at the City Council public hearing on December 9, 2019 at 6:00. At this meeting, staff will present their recommendations, residents will be permitted to provide comments or questions, City Council will discuss and vote to approve the project. If you have additional questions, please let me know. Thanks, <image001.gif>Andrew Scipioni, Transportation Planner 952-826-0440 | Fax 952-826-0392ascipioni@EdinaMN.gov | EdinaMN.gov Share your thoughts and ideas with the City online! Visit www.BetterTogetherEdina.org. From: < Sent: Friday, October 25, 2019 9:59 PM To: Edina Mail < Subject: Online Form Submittal: Contact Us EXTERNAL EMAIL ALERT: This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Contact Us Contact the City of Edina. Messages will be responded to during regular business hours, 8 a.m. to 4:30 p.m. Monday through Friday. You can reach us via phone at 952-927-8861. Police reports are not taken online. Criminal or suspicious activity should be called in to 911 so an officer may be dispatched to assist you and assess the situation. Name Alissa Movern Email Address Address 5005 west 56th street City Edina State Mn Zip Code 55436 Phone Number Fax Number Field not completed. How did you find us?Other Message This is for transportation planning: I looked over the minutes from Oct 24 and was surprised to see that our street (w 56th street) is recommended for sidewalks on the south side. Please give me some background to this decision. Why were homeowners not notified of this proposal prior to the meeting? This decision lacks transparency. I was unable to see any transportation meeting videos (the last one was from Oct 2016). Please include a link so I can watch the meeting. From my prospective it seems inefficient to install sidewalks when the streets were recently reconstructed meaning the aprons will be redone along with sod again. In addition why would the sidewalks be installed on the south side? The snow melts much faster on the north side making them easier to clear in the winter. Would you please include the date of the next meeting that will be discussing this project? Thank you for answering my questions! Alissa Movern Email not displaying correctly? View it in your browser. From:Aaron Ditzler To: Subject:RE: Proposed sidewalk Melody lake Date:Wednesday, October 30, 2019 5:54:02 PM Mary Jo, I wanted to follow up with a couple clarifications. Engineering staff has not recommended a sidewalk be constructed in 2020 between Code Avenue and Normandale Avenue. Engineering staff will recommended a sidewalk be constructed at an opportune time in the future, either as part of a scheduled roadway maintenance or utility project. Thank you. Aaron Ditzler, Assistant City Engineer 952-826-0443 | Fax 952-826-0392ADitzler@EdinaMN.gov | EdinaMN.gov Share your thoughts and ideas with the City online! Visit www.BetterTogetherEdina.org. From: Aaron Ditzler Sent: Monday, October 28, 2019 9:49 AM To: < Subject: RE: Proposed sidewalk Melody lake Mary Jo, Thanks for your input. The best way to provide feedback on the Pedestrian and Bicycle Master Plan is to reach out to the City Council. The next decision point for the W. 56th Street sidewalk will be at the Public Improvement Hearing in the Council Chambers on December 9, 2019 at 6 PM. Historically sidewalks and shared use paths are separate from the roadway per the referenced Living Streets Plan. https://www.edinamn.gov/DocumentCenter/View/1199 Thank you. Aaron Ditzler, Assistant City Engineer 952-826-0443 | Fax 952-826-0392 ADitzler@EdinaMN.gov | EdinaMN.gov Share your thoughts and ideas with the City online! Visit www.BetterTogetherEdina.org. From: Mary Jo Palmer < Sent: Monday, October 28, 2019 5:59 AM To: Lisa Schaefer <LSchaefer@EdinaMN.gov> Subject: Proposed sidewalk Melody lake EXTERNAL EMAIL ALERT: This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Hi there,I see there is a proposed sidewalk on W. 56th street from thefrontage road to Hansen Rd. Part of the streets from the frontageroad to Code Ave. had new streets installed seven years ago. CodeAve. to Hansen road will be getting new streets next year. I propose that instead of sidewalks being installed an upgrade to a"shared use path/bike lane" would be a better option. Our streetsare wide enough to accommodate this. Installing sidewalks in thearea that had the new streets installed already would be a costlyoption. Sidewalks were decided against at the time of the streetinstallation. The use of a "shared use path/bike lane" would avoidthe costs of ripping up and repairing the driveways, sod,irrigation systems, and curbs again. Another advantage would bethat the street department would be plowing the road curb to curbin the winter so they would always be maintained. Additionallythere are two houses close to Hansen road that have their backyardsback up to W. 56th street. They actually live on Dale Ave. I'mguessing they will not walk through their backyard or down thestreet and around the corner to maintain the sidewalk. If the city feels a need to install sidewalks with the area gettingnew streets next year I suggest a "shared use path/bike lane" fromthe frontage road to Code Ave. and sidewalks from Code Ave toHansen road. That would avoid all the costs mentioned above andany potential damage to the streets that were already installedfrom the heavy equipment needed. A "shared use path/bike lane"would be a very cost effective option. Thank you,Mary Jo Palmer From:Andrew Scipioni To: Bcc:Aaron Ditzler; Chad Millner Subject:RE: Question Melody Lake Reconstruction Date:Tuesday, November 5, 2019 12:32:33 PM Patrick, To clarify, the dividing line between the 2020 and 2021 project areas is Grove St between Hansen Rd and Tingdale Ave (see image below from the City’s Anticipated Roadway Reconstruction map, 2019- 2024). Benton Ave lies between Melody Lake B and Birchcrest C, which are both proposed for 2021 reconstruction. Benton Ave itself will not be included in either of these projects as it was resurfaced in 2017, but it may be subjected to short-term closures in 2021 for watermain or other improvements at the intersections. No additional work on Benton Ave is anticipated in the City’s 5-year Capital Improvement Plan. Andrew Scipioni, Transportation Planner 952-826-0440 | Fax 952-826-0392ascipioni@EdinaMN.gov | EdinaMN.gov Share your thoughts and ideas with the City online! Visit www.BetterTogetherEdina.org. From: < Sent: Tuesday, November 5, 2019 11:49 AM To: Andrew Scipioni <ascipioni@EdinaMN.gov> Subject: Re: Question Melody Lake Reconstruction EXTERNAL EMAIL ALERT: This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Andrew Earlier you responded to my question about W 56th St. Now another question. Some residents are concerned about the back to back projects 2020 and 2021 which will impact travel for 2 years in Melody Lake area. My question: BentonAve. has recently been resurfaced. It is the dividing line for the two projects. Will it be open ( Frontage road to Tracy) during the whole 2 year period or is more work scheduled. If so which year? Thanks in advance for your reply. Patrick Finley 5603 Bernard Pl In a message dated 10/30/2019 4:26:27 PM Central Standard Time, ascipioni@EdinaMN.gov writes: Patrick, Yes, the sidewalk on W 56th St between Hansen Rd and Code Ave is still being recommended for construction in 2020. The roadway between Hansen Rd and Dale Ave is proposed to be reconstructed to 20’ wide with a 5’ sidewalk on the south side. Staff has asked the adjacent properties along this segment about the need for on-street parking and will be recommending no on-street parking between Hansen Rd and Dale Ave. This will allow for adequate space for traveling vehicles and allow the City to construct the roadway and sidewalk within the existing 40’ public right-of-way. From staff’s perspective, this roadway reconstruction project is the appropriate opportunity to construct the sidewalk between Hansen Rd and Code Ave. Combining these projects allows the City to minimize property impacts and reduce costs compared to installing the sidewalk by itself. The 2020 project gives the City the opportunity to install about half (1,400’ of 2,725’) of the total proposed sidewalk on W 56th St, which we feel is a worthwhile investment into the City’s sidewalk network. The remaining length will be installed at an opportune time in the future, either as part of a scheduled roadway maintenance or utility project or if petitioned by the adjacent property owners. Andrew Scipioni, Transportation Planner 952-826-0440 | Fax 952-826-0392 ascipioni@EdinaMN.gov | EdinaMN.gov Share your thoughts and ideas with the City online! Visit www.BetterTogetherEdina.org. From: < Sent: Wednesday, October 30, 2019 2:52 PM To: Andrew Scipioni <ascipioni@EdinaMN.gov> Subject: Question W 56th St Sidewalk EXTERNAL EMAIL ALERT: This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Andrew I understand that the sidewalk on W 56th east from Code to frontage road is now deferred to later date. However the sidewalk from Code to Hansen will be installed as part of the 2020 project. Is this correct.? As you know the roadway from Dale to Hansen is very narrow and is restricted by the RR tracks. I have seen several survey crews in that area and I am wondering if in fact the plan will include sidewalk for that block? If so how? Proper street width is more important for traffic safety and should be paramount over sidewalk. If not, does it really make sense just to do the two blocks from Code to Dale? Why not wait and do the whole sidewalk from the frontage road to the west when the time is right.? I wonder if you could comment and enlighten me on the sidewalk plan. I know several neighbors are confused also. Thank you Patrick Finley 5603 Bernard Pl From: To:Andrew Scipioni Cc:Aaron Ditzler Subject:Re: Question W 56th St Sidewalk Date:Wednesday, October 30, 2019 7:17:46 PM EXTERNAL EMAIL ALERT: This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Andrew Thanks for the prompt reply and clarification on the issue. That one block will be narrow. The City will need to bring in some fill because there is a low spot that floods about the middle of the block. The other issue is that visitors to the Fraser house on the corner often park on 56th. The no parking is a good solution but visitors will need to now park on Hansen. The other concern is the visitor parking on 56th at the corner of Dale(The South- East corner). A second Fraser house is there. The street curves and the cars parked on 56th are a hazard..Cars are parked there most of the day . Cars traveling East cannot see around parked cars. So if a car is coming down 56th traveling west the east bound car can't see it Adding the sidewalk and narrowing the street will make it more dangerous. You might consider no parking there as well. Fraser visitors and workers would be required to park on Dale or in the house driveway. I hope it all works out I will share the information with neighbors. Thanks again. Patrick Finley In a message dated 10/30/2019 4:26:27 PM Central Standard Time, ascipioni@EdinaMN.gov writes: Patrick, Yes, the sidewalk on W 56th St between Hansen Rd and Code Ave is still being recommended for construction in 2020. The roadway between Hansen Rd and Dale Ave is proposed to be reconstructed to 20’ wide with a 5’ sidewalk on the south side. Staff has asked the adjacent properties along this segment about the need for on-street parking and will be recommending no on-street parking between Hansen Rd and Dale Ave. This will allow for adequate space for traveling vehicles and allow the City to construct the roadway and sidewalk within the existing 40’ public right-of-way. From staff’s perspective, this roadway reconstruction project is the appropriate opportunity to construct the sidewalk between Hansen Rd and Code Ave. Combining these projects allows the City to minimize property impacts and reduce costs compared to installing the sidewalk by itself. The 2020 project gives the City the opportunity to install about half (1,400’ of 2,725’) of the total proposed sidewalk on W 56th St, which we feel is a worthwhile investment into the City’s sidewalk network. The remaining length will be installed at an opportune time in the future, either as part of a scheduled roadway maintenance or utility project or if petitioned by the adjacent property owners. Andrew Scipioni, Transportation Planner 952-826-0440 | Fax 952-826-0392 ascipioni@EdinaMN.gov | EdinaMN.gov Share your thoughts and ideas with the City online! Visit www.BetterTogetherEdina.org. From: < Sent: Wednesday, October 30, 2019 2:52 PM To: Andrew Scipioni <ascipioni@EdinaMN.gov> Subject: Question W 56th St Sidewalk EXTERNAL EMAIL ALERT: This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Andrew I understand that the sidewalk on W 56th east from Code to frontage road is now deferred to later date. However the sidewalk from Code to Hansen will be installed as part of the 2020 project. Is this correct.? As you know the roadway from Dale to Hansen is very narrow and is restricted by the RR tracks. I have seen several survey crews in that area and I am wondering if in fact the plan will include sidewalk for that block? If so how? Proper street width is more important for traffic safety and should be paramount over sidewalk. If not, does it really make sense just to do the two blocks from Code to Dale? Why not wait and do the whole sidewalk from the frontage road to the west when the time is right.? I wonder if you could comment and enlighten me on the sidewalk plan. I know several neighbors are confused also. Thank you Patrick Finley 5603 Bernard Pl From:Aaron Ditzler To: Subject:RE: Question Re: Melody Lake A & B, Birchcrest Roadway Reconstruction Date:Monday, September 14, 2020 11:52:21 AM John, The project will likely begin in April 2021, but not on every street. Some streets may not be started until August / September. We won’t know the sequence of construction until next spring, since that’s up to the contractor. Generally local low volume streets are not closed during construction. Generally, you can get in and out of your driveway each morning and evening during construction with some exceptions like concrete installation. There may be instances during the day that you will be asked to park on an adjacent street for the day while they work in front of your driveway. It’s important that you contact our construction inspector when you know your private contractors schedule so coordination can occur with the City’s contractor. Thank you for the positive feedback. Aaron Ditzler, Assistant City Engineer 952-826-0443 | Fax 952-826-03927450 Metro Blvd. | Edina, MN 55439 ADitzler@EdinaMN.gov | EdinaMN.gov Stay informed about the City’s response to COVID-19 at EdinaMN.gov/Coronavirus. Need a hand or want to help? VisitBetterTogetherEdina.org/COVID-19. Share your thoughts and ideas with the City online! Visit www.BetterTogetherEdina.org. From: < Sent: Saturday, September 12, 2020 10:56 AM To: Aaron Ditzler <ADitzler@EdinaMN.gov> Subject: Question Re: Melody Lake A & B, Birchcrest Roadway Reconstruction EXTERNAL EMAIL ALERT:This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Hello Aaron, First, I want to thank you and your department for doing what I consider to be an excellent job of communicating and updating the residents regarding the upcoming road reconstruction. I attended two of the meetings and I thought the presentation was well done. Here is my question: Several of us experienced hail damage a few weeks ago and need our roofs replaced. I would like to have my chimney repaired before I have the roof re- shingled, and the soonest I can get that done would be early next spring (temperatures permitting). Do you have an approximate idea of when access to our homes by contractors would be restricted? I see that construction will begin sometime in April, but I don’t know how that would affect my situation. At what point would our street actually be closed? Thank You, John Gaughan 5112 W 58th St. (between Code and Tingdale) From:Andrew Scipioni To:Lucinda Winter Subject:RE: Request for notification regarding location of sidewalks on W. 56th Date:Monday, September 30, 2019 4:25:22 PM Lucinda, You’re very welcome. I agree that there will be some challenges as the project moves forward, but we sincerely hope the sidewalks are seen as a benefit to everyone in the neighborhood; improved access to Garden Park, more connections between neighborhoods, and better opportunities for active living. Of course, we are always open to hear the perspectives of the residents and take that into consideration. In the end, each of these projects is a balancing act between the desires of the current residents and the visions Council has for the future of Edina. Andrew Scipioni, Transportation Planner 952-826-0440 | Fax 952-826-0392ascipioni@EdinaMN.gov | EdinaMN.gov Share your thoughts and ideas with the City online! Visit www.BetterTogetherEdina.org. From: Lucinda Winter < Sent: Saturday, September 28, 2019 5:26 PM To: Andrew Scipioni <ascipioni@EdinaMN.gov> Subject: Re: Request for notification regarding location of sidewalks on W. 56th EXTERNAL EMAIL ALERT: This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Thanks Andrew. I appreciate that you took the time to get back to me. Good news for us — lots of challenges for you in trying to retrofit sidewalks and curb into a ’50’s neighborhood with many long- time residents. Lucinda Anne Winterm e On Sep 27, 2019, at 2:23 PM, Andrew Scipioni <ascipioni@EdinaMN.gov> wrote: Lucinda, I wanted to update you on the status of the proposed sidewalk on W 56th St. At this time, Engineering will be recommending constructing the sidewalk on the south side between Hansen Rd and Code Ave. Staff will present this recommendation, along with other proposed components of the roadway reconstruction project to City Council at the public hearing on December 9. <image001.gif>Andrew Scipioni, Transportation Planner 952-826-0440 | Fax 952-826-0392ascipioni@EdinaMN.gov | EdinaMN.gov Share your thoughts and ideas with the City online! Visit www.BetterTogetherEdina.org. From: Lucinda Winter < Sent: Monday, August 19, 2019 11:28 AM To: Andrew Scipioni <ascipioni@EdinaMN.gov> Cc: James Ankeny < Subject: Request for notification regarding location of sidewalks on W. 56th EXTERNAL EMAIL ALERT: This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Hi Andrew — we spoke briefly after last week’s 2020 roadway construction meeting. Please notify me when Public Works has made a final decision regarding the location of sidewalks (north side or south side) of W. 56th St. We reside at 5532 Code Ave., at the intersection of W. 56th and Code Ave. (northwest corner). Thank you. <image002.jpg> Lucinda Anne Winterm e and down 56th upwards of 50mph. I believe a sidewalk, which invariably narrows the street also engenders a stronger sense of community. For me, it has many more positive externalities than negative, especially as the neighborhood appears to have an uptick in young children. I’m an advocate for collaboration, so I want to keep an open mind. I’m not necessarily saying “no” to a petition regarding maintenance and repair but I would hate to see the sidewalk initiative be derailed entirely. Do you know if city maintained repairs of sidewalks is a common request from neighbors / neighborhoods in general? Thank you, Jeff Waychoff On Fri, Oct 30, 2020 at 6:48 AM Chad Millner <cmillner@edinamn.gov> wrote: Jeff, Appreciate the supportive comments. I’ve copied the team working on that project. We typically include comments into our preliminary engineering reports that are presented to council. I assume your neighbors know your views and your fine with this. Technically anything you send to us is public data but I thought I would ask to see where you stand. Thanks, Chad Chad Millner, Director of Engineering 952-826-0318 | Fax 952-826-0392 7450 Metro Blvd. | Edina, MN 55439 cmillner@EdinaMN.gov | EdinaMN.gov Stay informed about the City’s response to COVID-19 at EdinaMN.gov/Coronavirus. Need a hand or want to help? VisitBetterTogetherEdina.org/COVID-19. Share your thoughts and ideas with the City online! Visit www.BetterTogetherEdina.org. From: J S W < Sent: Thursday, October 29, 2020 4:10 PM To: Chad Millner <cmillner@EdinaMN.gov> Subject: W 56th St - Sidwalks EXTERNAL EMAIL ALERT: This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Hi Chad, I'm reaching out as a courtesy to commend you and your team for addressing the lack of walkability / sense of community in the Melody Lake neighborhood. I understand a few of my neighbors have expressed their disdain for the idea of sidewalks, so I wanted to make-a- point by reaching out in support of the sidewalk effort and thank you for addressing this issue! Keep up the great work and I look forward to having a safe place to walk now, I know the kids will too! All the best, Jeff Waychoff 5041 W 56th St, Edina, MN 55436 From:Aaron Ditzler To:Chris Rofidal Subject:RE: West 56th side walks Date:Tuesday, September 8, 2020 5:48:27 PM Chris, The pedestrian and bicycle master plan was updated in 2018 and does include a proposed sidewalk for West 56th Street between Code Ave and Normandale Road. Once we know for certain which year the sidewalk is scheduled for construction we will mail letters to residents on both sides of the road. If the sidewalk is scheduled for 2021, expect to see a letter before November 2020. Thank you. Aaron Ditzler, Assistant City Engineer 952-826-0443 | Fax 952-826-03927450 Metro Blvd. | Edina, MN 55439 ADitzler@EdinaMN.gov | EdinaMN.gov Stay informed about the City’s response to COVID-19 at EdinaMN.gov/Coronavirus. Need a hand or want to help? VisitBetterTogetherEdina.org/COVID-19. Share your thoughts and ideas with the City online! Visit www.BetterTogetherEdina.org. From: Chris Rofidal < Sent: Monday, September 7, 2020 8:54 AM To: Aaron Ditzler <ADitzler@EdinaMN.gov> Subject: West 56th side walks EXTERNAL EMAIL ALERT:This email originated from outside the City of Edina. Do not click links or open attachments unless you recognize the sender and know the content is safe. Hi Aaron I was recently informed by a neighbor that there’s a proposed plan for a sidewalk on the south side of West 56th. Our street was reconstructed several years ago so we have not been noticed about the upcoming project. Just a friendly piece of advice...if you are going to build the sidewalk on the entire street I would suggest you notice the whole street. I could be wrong but I don’t think we have ever received anything and if a sidewalk through my front yard is part of the plan I would strongly encourage you to publicly notify the whole street. I follow City issues pretty close so if I have been noticed I apologize. Thanks Chris 5037 West 56th Edina MN 55436 Chris Rofidal APPENDIX K Hansen Road Wall Engineering Report GALE-TEC ENGINEERING, INC. 801 TWELVE OAKS CENTER DRIVE, SUITE 832 WAYZATA, MN 55391 TELEPHONE (952) 473-7193 FAX (952) 473-1492 www.gale-tec.com September 24, 2020 Mr. Aaron Ditzler Assistant City Engineer City of Edina 4801 West 50th Street Edina, MN 55424 GTE Project No. 95571 Re: Retaining Wall Options for Replacement of Timber Wall along Hansen Road South of the CP Railroad Crossing in Edina, MN Dear Mr. Ditzler: We are pleased to provide you with our report of potential wall reconstruction options regarding the above referenced project. If you have any questions concerning the report, please do not hesitate to contact us. Respectfully, GALE-TEC ENGINEERING, INC. Stephan M. Gale, P.E. Nathan M. Lichty, P.E. Principal Engineer Project Engineer SMG/NML/pjk REPORT/ Edina, City of, Hansen Road Wall Option Report, Edina, MN City of Edina Hansen Road Retaining Wall Replacement Gale-Tec Engineering, Inc., SEPTEMBER, 2020 1 1.0 INTRODUCTION We understand that the City of Edina is planning to reconstruct Hansen Rd. adjacent to Garden Park and the CP railroad tracks as part of an area wide street reconstruction plan. The proposed project includes replacement of an existing retaining wall that supports the roadway along approximately 350ft of the alignment south of the at-grade CP rail crossing. According to the City’s survey files and the original roadway construction plans, the existing wall contains both a single and two (2) tier timber faced retaining structure with tie-back timber anchors. The wall is shown to have a maximum height of approximately 8ft. An approximately 2H:1V, 15ft tall, heavily wooded slope exists below a portion of the wall base, including where it is at its maximum height of 8ft. The wall also serves as the grade separator between Hansen Road and a driveway for the residence at 5700 Hansen Road. At this location, the wall contains two tiers with landscaping. The City survey drawings indicate that the retaining wall face is approximately 8-12ft back from the Hansen Rd curb and that existing underground utilities (water main and fiber optic) run along the curbline. Where the wall contains a single tier, it is located approximately 12ft from the Hansen Rd curb. Where the wall contains two (2) tiers, it is located 8ft back from the curbline with a 4ft wide bench between wall tiers. The base of the wall is located approximately 12ft back from the Hansen Rd curbline along the entirety of the wall alignment. The City has indicated that the timber wall is scheduled to be replaced as part of a Hansen Road improvement project scheduled for the 2021 construction season. The City has requested that we evaluate wall reconstruction options that would reduce disturbance to the existing utilities, the adjacent residences and the wooded hillside slope at the bottom of the existing wall. This report was prepared in substantial accordance with our agreement dated September 3, 2020. 2.0 SUBSURFACE CONDITIONS Subsurface Investigation Procedure Two (2) soil borings were drilled from the level bench area adjacent to Hansen Rd along the retaining wall alignment. The soil boring locations were located in the field by Gale- Tec Engineering, Inc. The approximate locations are shown on the Soil Boring Location Diagram included in the Appendix. The subsurface exploration was performed on September 16, 2020. Soil borings were advanced with a truck-mounted CME 75 drill rig. Gopher State One Call was contacted prior to drilling for utility clearance. The two (2) soil borings were drilled to a depth of 25 ft. Soil borings were advanced with a hollow stem auger. Soil samples were collected at 2-1/2 ft. intervals using the split-spoon sampling procedure to a depth of 10 ft and then at 5 ft. intervals to a depth of 30 ft. In the split spoon method the number of blows required to drive the sampler into the ground in 6-inch increments is recorded. The sampling spoon is driven into the ground with a 140- City of Edina Hansen Road Retaining Wall Replacement Gale-Tec Engineering, Inc., SEPTEMBER, 2020 2 pound hammer falling a distance of 30 inches. Soil samples were placed in glass jars and delivered to our office for examination and classification. The depth to groundwater and any aggregate base thicknesses were recorded during drilling operations. The borings were backfilled with grout upon completion. As required by State of Minnesota – Department of Health, a sealing record of the two boreholes was prepared (Record No. 373870) and submitted to the Department of Health. A copy of the record is included in the Appendix. The surface elevations at the two (2) boring locations were not obtained at the time of drilling. Based on the survey files obtained from the City, we estimate soil boring ground surface elevations of approximately 939ft. 2.1 Soil and Groundwater Conditions At both boring locations an approximately 6 inch thick layer of clayey sand topsoil was encountered at the ground surface. Beneath the topsoil layer an approximately 8ft thick layer of loose to medium dense silty sand to silty clayey sand fill layer was encountered that was likely placed when the retaining wall was initially constructed. The bottom of fill elevation, approximately ele. 931ft, corresponds to the bottom of the retaining wall elevation along the majority of the wall alignment. Beneath the fill layer, native soils consisted of a stiff to very stiff sandy to silty clay soil layer. This soil layer contained a penetrometer estimated undrained shear strength of 2.0 – 3.0 tons per square foot (tsf). This stiff clay layer was encountered to the termination depth at both boring locations. This stiff layer, if undisturbed, would be an adequate base for the new retaining wall. Groundwater was not encountered in the boreholes either while drilling (WD) or after the boring was completed (AB). Boreholes were backfilled with grout shortly after boring completion. Given the clay type soils present at this location, an extended period of time is required for ground water to seep and equilibrate in the boreholes. The installation and monitoring of a piezometer would be required to identify the long term ground water table, though the indications are that the groundwater table was below a depth of 25ft at the time of the exploration. 3.0 POTENTIAL WALL RECONSTRUCTION OPTIONS The City has indicated that the proposed retaining wall would be constructed along approximately the same alignment as the existing timber wall alignment. The City has also indicated that a replacement retaining wall type should: reduce impacts to the adjacent residence, reduce impacts to the existing utilities beneath the Hansen Road curbline and reduce impacts to the existing trees and vegetation along the hillside slope. Our preliminary analysis indicates that a fill type retaining structure containing geogrid reinforcement, or another type of tieback reinforcement, will be required to maintain retaining wall stability due to the steep sloping toe at the base of the retaining wall along a City of Edina Hansen Road Retaining Wall Replacement Gale-Tec Engineering, Inc., SEPTEMBER, 2020 3 portion of its alignment. Along the portion of the wall alignment where a sloping toe is not present, such as the wall alignment adjacent to the residential property, a gravity wall type could be considered. Cut type retaining structures, such as a sheet pile wall, or soldier pile wall would require either a vibratory hammer to install sheeting or pile driving for soldier pile installation. Construction of these wall types would likely cause significant vibrations and potential structural distress to the adjacent residential structures and adjacent underground utilities. These wall types would also likely be more expensive than other fill type wall options due to the amount of steel materials required. Fill wall types containing geogrid reinforcement could be economical wall options that could be designed to reduce the impacts to adjacent residence and the downslope hillside. Wall types that could be considered include: 1) Precast Modular Block wall with geogrid reinforcement (PMBW or Big Blocks), 2) “dry cast” Modular Block Wall (MBW) and 3) 1H:2.75V (70 deg.) Reinforced Soil Slope (RSS). Option 1 – Gravity/Geogrid Reinforced Big Block Wall One potential wall type could be a precast modular blocks (Big Blocks) that could be constructed as a gravity type wall along a portion of the wall alignment where no sloping toe is present. At locations where a sloping toe exists at the retaining wall base, geogrid reinforcement would be required. At the sloping toe location, preliminary global stability analyses indicate that the geogrid reinforcement length would need to extend approximately 10ft back from the block face, which is approximately 100% of the PMBW wall height. Also, it is recommended that the PMBW be embedded approximately 3-4ft at the sloping toe locations. Normally a 2ft embedment is recommended. At locations where geogrid reinforcement will be required behind the block wall face, 24 inch wide retaining wall blocks could be utilized along with geogrid reinforcement extending approximately 10ft back from the front face of the wall. At locations outside of the sloping toe area, such as where the wall is located adjacent to the existing residence, a preliminary wall stability analysis indicates that a 60 inch wide retaining wall block with no geogrid reinforcement will be required. At both wall locations and assuming a 1H – 1.5H:1V excavation backslope, the wall excavation limits will likely expose the existing water main and fiber optic utilities located beneath the Hansen Road curbline. These utilities would likely need to be relocated prior to wall reconstruction. A portion of the Hansen Road driving lane pavement section would also need to be removed and replaced as part of wall excavation. Most of the “Big Block” manufacturers have several options for facing textures that have been approved by MnDOT for applications adjacent to roadways where salt spray can occur. However, MnDOT has special PMBW requirements where these walls can only support CSAH or TH roadways if geogrid reinforcement is included. Since this is NOT a CSAH or TH roadway, MnDOT standards would not need to be followed, though they are good practice. Plans and Specifications would need to be created such that a salt resistant concrete block product is specified. Several similar gravity Big Block retaining walls have City of Edina Hansen Road Retaining Wall Replacement Gale-Tec Engineering, Inc., SEPTEMBER, 2020 4 been constructed for recent City of Edina projects, including: W. 70th St, Garden Park, and Interlachen Blvd. GTE has previously designed this wall type on projects throughout Minnesota and the Upper Midwest. The top wall course would be 24 inches in depth and a rail or fence could be installed on this block at the top of the wall. Internal and external retaining wall stability analyses should be performed as part of retaining wall final design to determine the required block widths for the gravity structure and the geogrid reinforcement strength and run-out lengths for the reinforced section. The PMBW geogrid reinforced section will require a granular reinforced fill material (the fill material placed behind the wall within the reinforcement zone) that meets the requirements of a MnDOT Select Granular Material (Spec. 3149.2B). This material should contain a friction angle of at least 35 degrees. This material would need to be imported as the soil borings indiate clay soils on-site. The wall would need to be supported on a leveling pad that would need to extend approximately ½ to 1 foot beyond the front and back of the block. The leveling pad should consist of a MnDOT Spec. 3138 Class 5 or Class 6, virgin or recycled material, supported over a recompacted subgrade. Additionally, a one (1) foot thick gravel drainage layer would need to be placed between the back of the block and the wall backfill. The drainage rock should consist of a ¾ inch clear crushed rock and include a filter fabric wrap. A drainage pipe that includes several outlets through the wall should also be placed at the wall base. We estimate the installed cost of a Big Block wall to be approximately $60/SF of wall face. A more accurate construction cost could be estimated by reviewing the recent past City of Edina wall projects mentioned previously. We estimate the reconstructed retaining wall (350ft long by 8ft tall) to be approximately 2,800 SF of wall facing. For comparison purposes only, a wall reconstruction cost of $170,000 is estimated at this time. This cost does not include removal of the existing wall, importing granular fill, pavement replacement or guardrail replacement. We estimate an approximately six (6) week Big Block retaining wall construction time. This would include two (2) weeks for deconstruction and excavation of the existing timber wall and four (4) weeks for wall construction, fence/guardrail placement and pavement reconstruction. Option 2 – Modular Block Wall (MBW) with Geogrid Reinforcement A second wall type that could be considered would be a “dry cast” modular block wall with geogrid reinforcement placed along the entirety of the wall alignment. A “standard” modular block unit weighs approximately 80 lbs, is 1ft in depth and covers one (1) square foot of wall face. City of Edina Hansen Road Retaining Wall Replacement Gale-Tec Engineering, Inc., SEPTEMBER, 2020 5 Commercial dry cast modular blocks can be susceptible to degradation from salt and freeze-thaw cycles. Several block manufacturers have developed more durable modular block units that are resistant to this degradation. MnDOT has developed a block resistance test and has a prequalified list of block types/manufacturers that can provide the salt tolerant blocks. We recommend that this type of block be used for this project, if an MBW is selected. A current MnDOT Technical Memo (14-03-MAT-01) includes design guidance that does not allow for dry cast modular block walls to support CSAH or TH roadways. The City would not have to follow this guidance, as previously discussed in the PMBW wall section. Preliminary stability analyses indicate that a 8 foot exposed MBW with an additional 1-2ft embedment depth would require geogrid reinforcement that would need to extend into the wall backfill a length of approximately 8-10ft. Where the wall is less than 8ft in total height, then the geogrid reinforcement would need to extend approximately 6ft back behind the wall face. The stability analysis indicates that the geogrid reinforcement would need an allowable tensile strength (Tal) of at least 2500 lb/ft and be placed at a maximum of 2ft vertical intervals along the height of the wall. Modular block wall internal and external stability analysis would need to be performed as part of the retaining wall final design. Similar to the geogrid reinforced PMBW wall section, the modular block wall reinforced fill (the fill material placed behind the wall within the reinforcement zone) would need to consist of a granular fill material that meets the requirements of a MnDOT Select Granular Material (Spec. 3149.2B). This material should contain a friction angle of at least 35 degrees. This material would need to be imported or the existing retaining wall backfill material could be reused if it meets the requirements of a MnDOT Select Granular Material. For a modular block wall with a total height of 8-10ft, we estimate a total excavation width of approximately 22ft behind the wall face will be required. This excavation width assumes an 10ft wide geogrid length and an 1H:1V excavation backslope, which is a typical backslope angle as required by OSHA for cohesive soils. Similar to the Big Block wall option, we estimate that this wall excavation will expose the exiting utilities located beneath the Hansen Road curbline and they will likely need to be relocated. A portion of the Hansen Road driving lane pavement section would also need to be removed and replaced as part of wall excavation. We estimate the installed cost of a modular block wall to be approximately $45/SF of wall face. For comparison purposes only, we estimate a 350ft long by 8-10ft high MBW would cost $140,000. This price would not include the demolition of the existing timber wall, importing granular fill or pavement, utility and guard rail construction. The modular block wall construction time would be similar to that of the Big Block Wall. Option 3 – 1H:2.75V (70 Deg.) RSS A third cost effective wall type that could be considered would be a vegetated face 1H:2.75V Reinforced Soil Slope (RSS). This type of grade separation structure is allowed City of Edina Hansen Road Retaining Wall Replacement Gale-Tec Engineering, Inc., SEPTEMBER, 2020 6 by MnDOT to support roadways. Unlike concrete walls, RSSs, are “flexible” structures which can tolerate some settlement without suffering a loss of structural capacity. MnDOT has a standard template for a 70° (1H:2.75V) RSS, however this template could not be used for this project due to the 2H:1V sloping toe that would be present at the wall base. An actual RSS design would be required. 1H:2.75V RSSs consist of Select Granular backfill and multiple layers of geogrid reinforcement, typically installed at 2-3ft vertical increments at horizontal lengths typically equal to 80 – 120% of the RSS height. Similar to the other wall options, the geogrid length requirement would likely require encroachment and relocation of the existing utilities and removing and then replacing the pavement section. The face of a 1H:2.75V RSS is formed using a tiered face, which typically consists of a series of vertical elements, successively stacked at a given horizontal offset to form tiers. The vertical elements typically consist of geocells or geotextile mesh/turf reinforcement mat wrap within metal wire basket forms. The wire basket face approach is shown in Figure No.1, while the geocell face approach is show in Figure No. 2. Vegetation establishment along the horizontal tiers is important to reduce slope face erosion potential over the long term. Figure No. 1: RSS Facing Constructed using Geogrid Wrap and Wire Baskets City of Edina Hansen Road Retaining Wall Replacement Gale-Tec Engineering, Inc., SEPTEMBER, 2020 7 Figure No. 2: RSS Facing Constructed using Geogrid and Geocells Vegetation establishment on the RSS slope face is a critical component of the RSS design and construction. A specialty topsoil, seed and fertilizer mix that promotes rapid, thorough vegetation establishment should be used. On past projects, GTE has required that the seed and fertilizer be pre-mixed prior to installation along the slope face. Frequent watering and potentially hydroseeding or re-seeding during and post construction will also be required to promote vegetation establishment. We estimate the installed cost of a 1H:2.75V RSS to be approximately $20/SF of face. For comparison purposes only, we estimate a 350ft long by 10ft high RSS to cost about $70,000. This price would not include the demolition of the existing timber wall. The RSS construction time would be similar to that of Options 1 and 2 with additional long term maintenance potentially required to maintain vegetation. City of Edina Hansen Road Retaining Wall Replacement Gale-Tec Engineering, Inc., SEPTEMBER, 2020 8 4.0 SUMMARY We believe that there are several types of grade separation structures that could be used for this project. Each wall type would require geogrid reinforcement along at least a portion wall alignment where the sloping toe is located at the wall base. An RSS or Modular Block Wall (MBW) would require geogrid reinforcement along the entirety of the wall alignment. Regardless of the wall type selected, the existing fiber optic and water main located beneath the Hansen Rd curbline will be exposed by the wall excavation and would either need to be relocated prior to construction or continually supported in the open excavation. A cost effective wall option could be a 1H:2.75V RSS. This wall type may require additional maintenance beyond initial construction, in the form of watering and seeding for vegetation establishment. The construction time for all wall types should be similar. Once a wall reconstruction option has been determined, then we can work with the City to develop a final design including plans and specifications. 5.0 GENERAL QUALIFICATIONS This report has been prepared in order to aid in the evaluation of proposed retaining wall reconstruction project and assist the City of Edina in the design of this project. The scope is limited to the specific project and location described herein, and our description of the project represents our understanding of the significant aspects relevant to soil and foundation characteristics. In the event that any changes in the design, as outlined in this report, are planned, we should be informed so that changes can be reviewed and the conclusion of this report modified or approved in writing. As a check, we recommend that we be authorized to review project plans and specifications to confirm that our report recommendations have been interpreted in accordance with our intent. Without this review, we will not be responsible for misinterpretations of our data, or analysis and/or our recommendations nor how these are incorporated into the final design. The analysis and recommendations are based on the data obtained from soil borings performed at the locations indicated in this report. This report does not reflect any variations which may occur between these borings. In the performance of subsurface explorations, specific information is obtained at specific locations and at specific times. It is a well-known fact that variations in soil conditions occur in most sites between boring locations. The nature and extent of the variation may not become evident until the course of construction. If variations appear event during foundation installation or RSS construction, it will be necessary for a re-evaluation of the recommendations of this report after performing on-site observations during the construction period and noting the characteristics of any variations. Gale-Tec Engineering, Inc. SEPTEMBER, 2020 2 APPENDIX 1. Soil Boring Location Diagram 2. Soil Boring Logs 3. MnDOH Sealing Record 4. General Notes Classification of Soils for Engineering Purposes 1. Soil Boring Location Diagram GALE-TEC ENGINEERING, INC. Consulting Geotechnical Engineers 801 Twelve Oaks Center Drive, Suite 832 Wayzata, MN 55391 (952) 473-7193 FAX 952-473-1492 Soil Boring Location Diagram Site Location Page 1 of 2 NORTH Garden Park Site Location Hansen Rd Vernon Ave GALE-TEC ENGINEERING, INC. Consulting Geotechnical Engineers 801 Twelve Oaks Center Drive, Suite 832 Wayzata, MN 55391 (952) 473-7193 FAX 952-473-1492 Soil Boring Location Diagram Soil Boring Locations Page 2 of 2 NORTH B-1 B-2 RR Tracks Garden Park 2. Soil Boring Logs 72 72 67 72 78 83 89 89 SS SS SS SS SS SS SS SS Clayey Sand, fine grained, black-brown, slighlty organic, Topsoil (SC)Silty Sand, fine to medium grained, medium dense, light brown, moist, Fill (SM) Silty Clayey Sand, fine to medium grained, medium dense,dark brown, Fill (SC) Silty Clayey Sand, loose, light brown, moist, Fill (SC) Silty Clay with some sand, stiff, light brown (CL) Clayey Sand with trace gravel, fine grained, medium dense,brown, moist (SC) Clayey Sand, very fine to fine grained, medium dense, brown,moist (SC) Soil Boring Termination Depth = 24.5ftSoil Boring Drilled with Hollow Stem Auger Soil Boring Backfilled with Grout upon Completion 2.0 3.0 3.0 10 10 13 7 6 16 25 24 9 10 11 12 13 14 15 16 WL WL CAVE IN DEPTH WATER LEVEL OBSERVATIONS Dry, WD Dry, AD Grout %REC. Hansen Road Retaining Wall at Garden Park DEPTH INFEET NO. BORING STARTED 9-16-20 BORING COMPLETED 9-16-20 RIG CME 750 DRAWN nl City of Edina, MN Gale-Tec Engineering, Inc. CLIENT: BORING NO. B-1 ARCHITECT - ENGINEER: 5 10 15 20 25 PROJECT: LOCATION: LABORATORY TESTSSAMPLESOIL DESCRIPTION N-VALUE INBLOWS/FT. The stratification lines represent the approximate boundary lines between soil and rock types: in-situ the transition may be gradual. TYPE LOCATION: Edina, MN FOREMAN br JOB# 95571 Qp(tsf)BORING LOG W/P200 CITY OF EDINA, HANSEN RD RETAINING WALL.GPJ UNITWT.GDT 9/17/20 72 56 56 78 78 83 89 89 SS SS SS SS SS SS SS SS Clayey Sand, fine grained, black-brown, slighlty organic, Topsoil (SC) Sand with trace silt, fine to medium grained, loose to mediumdense, dark brown, moist, Fill (SP-SM) Clayey Silty Sand, fine grained, loose, dark brown, moist, Fill(SC) Clayey Silt Sand, fine grained, medium dense, light brown,moist (SM-SC) Sandy Clay to Clayey Sand, stiff, light brown (CL-SC) Clayey Sand, very fine to fine grained, medium dense, brown,moist (SC) Soil Boring Termination Depth = 24.5ftSoil Boring Drilled wtih Hollow Stem Auger Soil Boring Backfilled wtih Grout upon Completion 10 6 4 11 15 22 22 28 1 2 3 4 5 6 7 8 WL WL CAVE IN DEPTH WATER LEVEL OBSERVATIONS Dry, WD Dry, AD Grout %REC. Hansen Road Retaining Wall at Garden Park DEPTH INFEET NO. BORING STARTED 9-16-20 BORING COMPLETED 9-16-20 RIG CME 750 DRAWN nl City of Edina, MN Gale-Tec Engineering, Inc. CLIENT: BORING NO. B-2 ARCHITECT - ENGINEER: 5 10 15 20 25 PROJECT: LOCATION: LABORATORY TESTSSAMPLESOIL DESCRIPTION N-VALUE INBLOWS/FT. The stratification lines represent the approximate boundary lines between soil and rock types: in-situ the transition may be gradual. TYPE LOCATION: Edina, MN FOREMAN br JOB# 95571 Qp(tsf)BORING LOG W/P200 CITY OF EDINA, HANSEN RD RETAINING WALL.GPJ UNITWT.GDT 9/17/20 3. MDH Sealing Record 4. General Notes Classification of Soils for Engineering Purposes Typical Names Well-graded gravels, gravel- sand mixtures, little or no fines Poorly graded gravels, gravel- sand mixtures, little or no fines d u Clayey gravels, gravel-sand-silt mixtures Atterberg Limits below "A" line or P.I. greater than 7 Well-graded sands, gravelly sands, little or no fines Poorly graded sands, gravelly sands, little or no fines d u Clayey sands, sand-clay mixtures Atterberg Limits below "A" line or P.I. greater than 7 Inorganic silts and very fine sands, rock flour, silty or clayey fine sands or slayey silts with slight plasticity Inorganic clays of low to medium plasticity, gravelly clays, sandy clays, silty clays, lean clays Organic silts and organic silty clays of low plasticity Inorganic silts, micaceous or diatomaceous fine sandy or silty soils, elastic soils Inorganic clays of high plasticity, fat clay Organic clays of medium to high plasticity, organic silts GALE-TEC ENGINEERING, INC. Pt Peat and other highly organic soils For classification of fine-grained soils and fine fraction of coarse-grained soils. Atterberg Limits plotting in (CL+ML) area are borderline classifications requiring use of dual symbols.Determine percentages of sand and gravel from grain-size cuve. Depending on percentage of lines (fraction smaller than No. 200 sieve size), coarse-grained soils are classified as follows: Less than 5% -------------GW,GP,SW,SP More than 12%------------GM,MG,SM,SC 5 to 12%--------------------Borderline cases requiring dual symbols greater than 4; between 1 and 3 Not meeting all gradation requirements for GW Atterberg Limits below "A" line or P.I. less than 4 Above "A" line with P.I. between 4 and 7 are borderline cases requiring use of dual symbols greater than 4; between 1 and 3 Not meeting all gradation requirements for SW Silty gravels, gravel-sand-silt mixtures Atterberg Limits below "A" line or P.I. less than 4 Limits plotting in hatched zone with P.I. between 4 and 7 are borderline cases requiring use of dual symbolsSC Silty sands, sand-silt mixtures Silts and Clays (Liquid limit less than 50)Silts and Clays (Liquid limit greater than 50)ML CL OL MH CH OHGravels w/ Fines (Appreciable amount of fines)Coarse-grained soils (More than half of material is larger than No. 200 sleve size)GW GP GC GM SW SP Sands w/ Fines (Appreciable amount of fines)SM CLASSIFICATION OF SOILS FOR ENGINEERING PURPOSES (ASTM: D 2487 and 2488) Major Divisions Group Symbols Laboratory Classification Criteria Fine-grained soils (More than half of material is smaller than No. 200 sieve size)Gravels (More than half of coarse fraction is larger than No. 4 sieve size)Sands (More than half of coarse fraction is smaller than No. 4 sieve size)Higly Organic SoilsClean Gravels (Little or no fines)Clean Sands (Little or no fines)6010 230 DD DCc 10 60 D DCu 6010 230 DD DCc 10 60D DCu GENERAL NOTES DRILLING & SAMPLING SYMBOLS: SL : SS with Liner OS : Osterberg Sampler – 3” Shelby Tube SS : Split Spoon – 1 3/8” I.D., 2” O.D., unless otherwise noted HS : Hollow Stem Auger ST : Shelby Tube – 2” O.D., unless otherwise noted WS : Wash Sample PA : Power Auger FT : Fish Trail DB : Diamond Bit – NX: BX: AX RB : Rock Bit AS : Auger Sample BS : Bulk Sample JS : Jar Sample PM : Pressuremeter test – in situ VS : Vane Shear Standard “N” Penetration: Blows per foot of a 140 pound hammer falling 30 inches on a 2 inch OD split spoon, except where noted. WATER LEVEL MEASUREMENT SYMBOLS: WL : Water Level WCL : Wet Cave In DCL : Dry Cave In WS : While Sampling WD : While Drilling BCR : Before Casing Removal ACR : After Casing Removal AB : After Boring Water levels indicated on the boring logs are the levels measured in the boring at the times indicated. In pervious soils, the indicated elevations are considered reliable ground water levels. In impervious soils, the accurate determination of ground water elevations is not possible in even several days of observation, and additional evidence of ground water elevations must be sought. GRADATION DESCRIPTION & TERMINOLOGY Coarse Grained or Granular Soils have more than 50% of their dry weight retained on a #200 sieve; they are described as: clays or clayey silts if they are cohesive, and silts if they are non-cohesive. In addition to gradation, granular soils are defined on the basis of their relative in-place density and fine-grained soils on the basis of their strength or consistency, and their plasticity. Major Component of Sample Size Range Descriptive Term(s) (Of Components Also Present in Sample) Percent Dry Weight Boulders Over 8” (200mm) Trace 1 – 9 Cobbles 8” to 3” (200mm to 75mm) Little 10 – 19 Gravel 3” to #4 sieve (75mm to 2mm) Some 20 – 34 Sand #4 to #200 sieve (2mm to 0.074mm) And 35 – 50 Silt Passing #200 sieve (0.074mm to 0.005mm) Clay Smaller than 0.005mm CONSISTENCY OF COHESIVE SOILS: RELATIVE DENSITY OF GRANULAR SOILS: Unconfined Comp. Strength, Qu, tsf Consistency N – Blows / ft. Relative Density <0.25 Very Soft 0 – 3 Very Loose 0.25 – 0.49 Soft 4 – 9 Loose 0.50 – 0.99 Medium (Firm) 10 – 29 Medium Dense 1.00 – 1.99 Stiff 30 – 49 Dense 2.00 – 3.99 Very Stiff 50 – 80 Very Dense 4.00 – 8.00 Hard 80+ Extremely Dense >8.00 Very Hard GALE-TEC ENGINEERING, INC. APPENDIX L Preliminary Assessment Roll MELODY LAKE A/B, GRANDVIEW A, BIRCHCREST C NEIGHBORHOOD ROADWAY RECONSTRUCTION IMPROVEMENT NO. BA‐457 PRELIMINARY ASSESSMENT ROLL PID Owner House No. Street Assessable REU Assessable Amount 1 3311721240043 JUDITH & THOMAS FORKER 5109 56TH ST W0 ‐$ 2 3311721230001 RICHARD P GRIFFITH & PATRICIA A GRIFFITH 5201 W 56TH ST 1 24,200.00$ 3 3311721220045 PATRICK J & SHARON M RUANE 5208 W 56TH ST 1 24,200.00$ 4 3311721230006 RICHARD HERMAN 5209 W 56TH ST 1 24,200.00$ 5 3311721220046 JEANNE A MOYNIHAN MYERS 5212 W 56TH ST 1 24,200.00$ 6 3311721230005 JACQUELINE GRIFFITH CROWLEY 5213 W 56TH ST 1 24,200.00$ 7 3311721220047 BEVERLY A BEIN 5216 W 56TH ST 1 24,200.00$ 8 3311721230050 JANA M HOFFMANN 5217 W 56TH ST 1 24,200.00$ 9 3311721220048 MARY A LOHMANN 5220 W 56TH ST 1 24,200.00$ 10 3311721230094 SARAH BELLIS 5221 W 56TH ST 1 24,200.00$ 11 3311721220049 CARL DAVID CROSBY LEHMANN & KATIE CROSBY LEHMANN 5224 W 56TH ST 1 24,200.00$ 12 3311721220083 NATHAN J PETERSON 5228 W 56TH ST 1 24,200.00$ 13 3311721220084 DARLENE SHOLTIS & HEINO A BECKMANN 5232 W 56TH ST 1 24,200.00$ 14 3311721220087 JONATHAN H ENGMAN 5236 W 56TH ST 1 24,200.00$ 15 3311721230045 BRIAN SANTORI & GRETA SANTORI 5309 W 56TH ST 1 24,200.00$ 16 3311721230046 CARE PROPERTIES LLC 5313 W 56TH ST 1 24,200.00$ 17 3311721230060 BOYD A & SHERI L HUPPERT 5600 BERNARD PL 1 24,200.00$ 18 3311721230093 MARCIA KOESTER 5601 BERNARD PL 1 24,200.00$ 19 3311721230095 PATRICK M FINLEY 5603 BERNARD PL 1 24,200.00$ 20 3311721230061 NICHOLAS STENSON & LACEY STENSON 5604 BERNARD PL 1 24,200.00$ 21 3311721230096 PATRICIA C WREDE 5605 BERNARD PL 1 24,200.00$ 22 3311721230062 CHRISTOPHER REA & VICTORIA REA 5608 BERNARD PL 1 24,200.00$ 23 3311721230018 THOMAS E & ROXANNE S REESE 5609 BERNARD PL 1 24,200.00$ 24 3311721230063 LINDA M PETERSEN 5612 BERNARD PL 1 24,200.00$ 25 3311721230019 DONALD F RAHE 5613 BERNARD PL 1 24,200.00$ 26 3311721230042 EMILY S ALDRICH & BENJAMIN R EVERS 5616 BERNARD PL 1 24,200.00$ 27 3311721230020 SCOT WAGGONER 5617 BERNARD PL 1 24,200.00$ 28 3311721230043 AMY SANFILIPPO DEMAREST 5620 BERNARD PL 1 24,200.00$ 29 3311721230044 CHRISTOPHER HOLT/ANNE E HOLT 5624 BERNARD PL 1 24,200.00$ 30 3311721230035 TIMOTHY GERARD HEALY & KRISTI KAY HEALY 5700 BERNARD PL 1 24,200.00$ 31 3311721230034 THOMAS A LANDVIK 5701 BERNARD PL 1 24,200.00$ 32 3311721230036 ALYSSA & JON MARKER 5704 BERNARD PL 1 24,200.00$ 33 3311721230033 RICHARD E DOYLE & TRACI M DOYLE 5705 BERNARD PL 1 24,200.00$ 34 3311721230037 KATHLEEN A GLASER 5708 BERNARD PL 1 24,200.00$ 35 3311721230032 MEGAN ANDERSON 5709 BERNARD PL 1 24,200.00$ 36 3311721230038 R R DEBATES & J A GRZYBOWSKI 5712 BERNARD PL 1 24,200.00$ 37 3311721230031 MICHAEL H CREEVY 5713 BERNARD PL 1 24,200.00$ 38 3311721230039 WILLIAM D CLYNES & DAVID W CLYNES 5716 BERNARD PL 1 24,200.00$ 39 3311721230030 CHADD L MOSER & STACI MOSER 5717 BERNARD PL 1 24,200.00$ 40 3311721230040 STEVEN F & ROXANNE KRIZ 5720 BERNARD PL 1 24,200.00$ 41 3311721230029 DOUGLAS M DEGROOD & MICHAELANNE G DEGROOD 5721 BERNARD PL 1 24,200.00$ 42 3311721230041 WILLIAM JANOUSEK & SARA ANN JANOUSEK 5724 BERNARD PL 1 24,200.00$ 43 3311721230028 DAVID A & PATRICIA A DRONEN 5725 BERNARD PL 1 24,200.00$ 44 3311721220002 JAMES ANKENY/LUCINDA WINTER 5532 CODE AVE 0 ‐$ 45 3311721230047 MARK BIEDENFELD & MOLLY BIEDENFELD 5600 CODE AVE 1 24,200.00$ 46 3311721230048 MARK M & MARGARET S WATT 5604 CODE AVE 1 24,200.00$ 47 3311721230059 THOMAS PEDERSON & BARBARA RIECHMANN‐ PEDERSON 5605 CODE AVE 1 24,200.00$ 48 3311721230049 ROGER GARY NUNN & LYNN DAGGETT NUNN 5608 CODE AVE 1 24,200.00$ 49 3311721230051 MARTIN A MIKUS 5612 CODE AVE 1 24,200.00$ 50 3311721230052 JAMES & SHARYN DOLL 5616 CODE AVE 1 24,200.00$ 51 3311721230058 JAMES & ELIZABETH WILLIAMS 5617 CODE AVE 1 24,200.00$ 52 3311721230053 ROBERT & BETTY FULGENCY 5620 CODE AVE 1 24,200.00$ 53 3311721230057 JERALD R KNOX 5621 CODE AVE 1 24,200.00$ 54 3311721230021 JOAN F LUNDBERG 5700 CODE AVE 1 24,200.00$ 55 3311721230017 JAMES T DOUDIET & JANET S DOUDIET 5701 CODE AVE 1 24,200.00$ 56 3311721230022 PATRICIA JORDAN TENNYSON 5704 CODE AVE 1 24,200.00$ 57 3311721230016 PAUL STARK & JULIA STARK 5705 CODE AVE 1 24,200.00$ 58 3311721230023 JAMES M KEGANS & KELLY R KEGANS 5708 CODE AVE 1 24,200.00$ 59 3311721230024 THOMAS CARTER 5712 CODE AVE 1 24,200.00$ 60 3311721230015 MITCHELL LEE PAGE & LINDA MARIE PAGE 5713 CODE AVE 1 24,200.00$ MELODY LAKE A/B, GRANDVIEW A, BIRCHCREST C NEIGHBORHOOD ROADWAY RECONSTRUCTION IMPROVEMENT NO. BA‐457 PRELIMINARY ASSESSMENT ROLL PID Owner House No. Street Assessable REU Assessable Amount 61 3311721230025 GAVIN M LEE & ANGELA P NELSON 5716 CODE AVE 1 24,200.00$ 62 3311721230026 BRAD D & VICKI C HARVEY 5720 CODE AVE 1 24,200.00$ 63 3311721230027 2222 N 7TH LLC 5724 CODE AVE 1 24,200.00$ 64 3311721230076 RUTH A METZGER 5600 DALE AVE 1 24,200.00$ 65 3311721230064 KEVIN BOHRER & KRISTINA K WESTPHAL BOHRER 5605 DALE AVE 1 24,200.00$ 66 3311721230077 MICHAEL T LUND 5608 DALE AVE 1 24,200.00$ 67 3311721230065 GEORGE R BARD 5609 DALE AVE 1 24,200.00$ 68 3311721230078 TERRY K & KATHERINE K LEWIS 5612 DALE AVE 1 24,200.00$ 69 3311721230066 EVELYN M COFFEY 5615 DALE AVE 1 24,200.00$ 70 3311721230079 RYAN & AUTUMN MULDOWNEY 5616 DALE AVE 1 24,200.00$ 71 3311721230067 ALEC S JOHNSON & HEATHER D BERAN 5617 DALE AVE 1 24,200.00$ 72 3311721230080 CARRIE RYDER DECKER 5620 DALE AVE 1 24,200.00$ 73 3311721230068 AKKIREDDY GUTHIKONDA & VIJAYALAKSHMI GUTHIKONDA 5621 DALE AVE 1 24,200.00$ 74 3311721230081 DENISE M NELSON 5624 DALE AVE 1 24,200.00$ 75 3311721230082 KEITH WITHERSPOON & WENDY WITHERSPOON 5700 DALE AVE 1 24,200.00$ 76 3311721230069 MEGAN D GRANDE 5701 DALE AVE 1 24,200.00$ 77 3311721230083 JAMES R & JUDITH A MAXA 5704 DALE AVE 1 24,200.00$ 78 3311721230070 ROGER T SORENSEN & STEPHANIE R BOAEUF 5705 DALE AVE 1 24,200.00$ 79 3311721230084 DANIELLE D SMITH & FABIEN PONSON 5708 DALE AVE 1 24,200.00$ 80 3311721230071 KELLY LAURSEN & NATHAN BLAKE LAURSEN 5709 DALE AVE 1 24,200.00$ 81 3311721230085 STAMATIA G MUCHULAS 5712 DALE AVE 1 24,200.00$ 82 3311721230072 JAMES A CASPAR 5713 DALE AVE 1 24,200.00$ 83 3311721230097 ELLEN DAHLQUIST 5716 DALE AVE 1 24,200.00$ 84 3311721230073 JAKUB JEZ & RANDEE C JEZ 5717 DALE AVE 1 24,200.00$ 85 3311721230098 TIMOTHY A BLAKESLEY & SUN M BLAKESLEY 5720 DALE AVE 1 24,200.00$ 86 3311721230074 ERIK G JOHNSON 5721 DALE AVE 1 24,200.00$ 87 3311721230099 JEFFREY THOMAS MAY 5724 DALE AVE 1 24,200.00$ 88 3311721230075 SHAWN P GAITHER & RACHELLE J BAKER 5725 DALE AVE 1 24,200.00$ 89 3311721230100 PHILLIP R & MARSHA J SUSSMAN 5728 DALE AVE 1 24,200.00$ 90 3311721240003 RICHARD BRADLEY FOX 5114 GROVE ST 1 24,200.00$ 91 3311721240015 JOHN R & JOANNE R BENTLEY 5120 GROVE ST 1 24,200.00$ 92 3311721230008 MS CATHRYN M BALEK 5208 GROVE ST 1 24,200.00$ 93 3311721220005 PAULA S OGG/K A MCARRON 5405 HANSEN RD 0.5 12,100.00$ 94 3311721220082 SUANNE D HIBBS 5501 HANSEN RD 1 24,200.00$ 95 3311721220081 MURIEL A BURSH 5509 HANSEN RD 1 24,200.00$ 96 3311721220057 RICHARD R & MARY J KVANBECK 5511 HANSEN RD 1 24,200.00$ 97 3311721220056 CHRISTOPHER REEVES 5515 HANSEN RD 1 24,200.00$ 98 3211721140055 CITY OF EDINA 5520 HANSEN RD 8 193,600.00$ 99 3311721220055 WESTCHESTER PROPERTIES LLC 5525 HANSEN RD 12 290,400.00$ 100 3311721230092 FRASER COMMUNITY SERVICES 5617 HANSEN RD 1 24,200.00$ 101 3311721230091 SARA M WAKEFIELD 5621 HANSEN RD 1 24,200.00$ 102 3311721230090 PATRICIA A PALECEK 5625 HANSEN RD 1 24,200.00$ 103 3211721140053 5700 HANSEN LLC 5700 HANSEN RD 1.6 38,720.00$ 104 3311721230089 RYAN SAILER & MIRANDA B JOHNSON 5701 HANSEN RD 1 24,200.00$ 105 3311721230088 DANIEL J & CAROL L FERTIG 5705 HANSEN RD 1 24,200.00$ 106 3311721230087 DERRONG IRENE LIN 5709 HANSEN RD 1 24,200.00$ 107 3211721140074 JEFFREY M & MARY L DYRHAUG 5710 HANSEN RD 0.8 19,360.00$ 108 3311721230086 IH2 PROPERTY ILLINOIS LP C/O INVITATION HOMES 5713 HANSEN RD 1 24,200.00$ 109 3211721140073 PATRICIA ANN MALIN 5714 HANSEN RD 0.8 19,360.00$ 110 3211721140044 THOMAS C MORGAN 5716 HANSEN RD 1 24,200.00$ 111 3311721230104 WENDELL R & DORTHY A MALIN 5717 HANSEN RD 1 24,200.00$ 112 3211721140043 CLAUDIA L ROGAT 5720 HANSEN RD 1 24,200.00$ 113 3311721230103 BROOKE & RICK ORR 5721 HANSEN RD 1 24,200.00$ 114 3211721140042 ROBERT BUNCHEK 5724 HANSEN RD 1 24,200.00$ 115 3311721230102 HEMANT NARASIMHAN & ROHINI V KUMAR 5725 HANSEN RD 1 24,200.00$ 116 3311721230101 ORVILLE C HOGNANDER JR 5729 HANSEN RD 1 24,200.00$ 117 3311721240018 TODD & KELLY SCHNELL 5712 MELODY LA 1 24,200.00$ 118 3311721240011 JEFFREY A AUSTIN & ROBIN R AUSTIN 5713 MELODY LA 1 24,200.00$ 119 3311721240013 IH2 PROPERTY ILLINOIS LP C/O INVITATION HOMES 5716 MELODY LA 1 24,200.00$ 120 3311721240005 KEVIN MARTIN & TY JAMES TONANDER 5717 MELODY LA 1 24,200.00$ MELODY LAKE A/B, GRANDVIEW A, BIRCHCREST C NEIGHBORHOOD ROADWAY RECONSTRUCTION IMPROVEMENT NO. BA‐457 PRELIMINARY ASSESSMENT ROLL PID Owner House No. Street Assessable REU Assessable Amount 121 3311721240006 MARK OEHLKE & LYNN M OEHLKE 5721 MELODY LA 1 24,200.00$ 122 3311721240010 BENJAMIN GUTH & HOLLY GUTH 5724 MELODY LA 1 24,200.00$ 123 3311721240007 KENNETH A DREWELOW C/O MARY A DREWELOW 5725 MELODY LA 1 24,200.00$ 124 3311721240014 WAYNE W & KATHLEEN M ELLIOTT 5728 MELODY LA 1 24,200.00$ 125 3311721240008 JEFFREY A STEVENS & NICOLE M STEVENS 5729 MELODY LA 1 24,200.00$ 126 3311721240009 JOHN M CONWAY 5733 MELODY LA 1 24,200.00$ 127 3311721240077 CITY OF EDINA Unassigned MELODY LAKE DR 0 ‐$ 128 3311721240020 CITY OF EDINA Unassigned MELODY LAKE DR 0 ‐$ 129 3311721230054 BRIAN PAGE 5604 MELODY LAKE DR 1 24,200.00$ 130 3311721240019 CURT SCHAEFER 5605 MELODY LAKE DR 1 24,200.00$ 131 3311721230055 PATRICIA L DAWSON 5608 MELODY LAKE DR 1 24,200.00$ 132 3311721240012 MARK J ELLINGSON 5609 MELODY LAKE DR 1 24,200.00$ 133 3311721230056 MARTA H GUZMAN/ANDREW MAIDEN 5612 MELODY LAKE DR 1 24,200.00$ 134 3311721230012 MARK J & JEANNE M RAZIDLO 5616 MELODY LAKE DR 1 24,200.00$ 135 3311721230013 SCOTT J PASCOE 5620 MELODY LAKE DR 1 24,200.00$ 136 3311721240017 KATHLEEN A TALBOTT 5621 MELODY LAKE DR 1 24,200.00$ 137 3311721230014 LAIRD W BEAVER 5624 MELODY LAKE DR 1 24,200.00$ 138 3311721240016 DEAN SCOTT NEWINS & MARY QUIST‐NEWINS 5625 MELODY LAKE DR 1 24,200.00$ 139 3311721230011 DEAN S NEWINS 5629 MELODY LAKE DR 1 24,200.00$ 140 3311721230010 WILLIAM MAX NEWSOME 5633 MELODY LAKE DR 1 24,200.00$ 141 3311721230009 VALERIE PEDERSON 5637 MELODY LAKE DR 1 24,200.00$ 142 3311721220066 CHARLES R GJOVIG & JAMES M GUENTHNER 5300 WINDSOR AVE 1 24,200.00$ 143 3311721220075 RICHARD A SCARLETT 5301 WINDSOR AVE 1 24,200.00$ 144 3311721220068 PAUL W VANPUTTEN & & SUSAN J VAN PUTTEN 5304 WINDSOR AVE 1 24,200.00$ 145 3311721220076 PAUL S & LISA D JOHNSON 5305 WINDSOR AVE 1 24,200.00$ 146 3311721220069 ANDREW J RICHTER & GWENDOLYN L RICHTER 5308 WINDSOR AVE 1 24,200.00$ 147 3311721220077 RICHARD & PATRICIA SANDVIK 5309 WINDSOR AVE 1 24,200.00$ 148 3311721220070 JONATHAN N SEMBRANO & SHARON C YSON 5312 WINDSOR AVE 1 24,200.00$ 149 3311721220078 GARY TEGAN 5313 WINDSOR AVE 1 24,200.00$ 150 3311721220071 MICHAEL LEVY & MELISSA UNGERMAN‐LEVY 5316 WINDSOR AVE 1 24,200.00$ 151 3311721220079 BALDUS PROPERTIES LLC 5317 WINDSOR AVE 1 24,200.00$ 152 3311721220072 JAMES R KORIN 5320 WINDSOR AVE 1 24,200.00$ 153 3311721220080 FAN FAN RENT LLC 5321 WINDSOR AVE 1 24,200.00$ 154 3311721220073 KAROLINE SPERLING & CHARLES SPERLING 5324 WINDSOR AVE 1 24,200.00$ 155 3311721220074 DOUGLAS R JOHNSON 5328 WINDSOR AVE 1 24,200.00$ 1 3311721310045 J R HENSLEY & K HENSLEY 5100 58TH ST W 1 24,200.00$ 2 3311721310046 P J & K D SEMENKEWITZ 5101 58TH ST W 1 24,200.00$ 3 3311721310044 S J & K J BOWER 5104 58TH ST W 1 24,200.00$ 4 3311721310047 ELSIE P SEMENKEWITZ 5105 58TH ST W 1 24,200.00$ 5 3311721310043 ROBERT R ROOS/MARCELA ROOS 5108 58TH ST W 1 24,200.00$ 6 3311721310048 MICHAEL SHEA 5109 58TH ST W 1 24,200.00$ 7 3311721310042 JOHN GAUGHAN ET AL 5112 58TH ST W 1 24,200.00$ 8 3311721310049 ALEKSEY & ANDREZA DEREVYANKO 5113 58TH ST W 1 24,200.00$ 9 3311721310041 KATHLEEN L & PAUL FINK 5116 58TH ST W 1 24,200.00$ 10 3311721310050 JOSIE L FIX & JEFFREY A FIX 5117 58TH ST W 1 24,200.00$ 11 3311721310040 B H HANSEN ETAL 5120 58TH ST W 1 24,200.00$ 12 3311721310051 SCOTT R & LAURA A DAVIDSON 5121 58TH ST W 1 24,200.00$ 13 3311721310012 J CHOJOR & Y D GONGPATSANG 5105 59TH ST W 1 24,200.00$ 14 3311721310010 M G HEWITT & M E HEWITT 5108 59TH ST W 1 24,200.00$ 15 3311721310013 JAMES A & VIKKI L GILLIGAN 5109 59TH ST W 1 24,200.00$ 16 3311721310009 BRIAN KOVALCHUK 5112 59TH ST W 1 24,200.00$ 17 3311721310014 JON & JENNIFER MARKET TRUST 5113 59TH ST W 1 24,200.00$ 18 3311721310008 ADAM D PLOTTS/STACY M PLOTTS 5116 59TH ST W 1 24,200.00$ 19 3311721310007 M & M OVIKIAN 5120 59TH ST W 1 24,200.00$ 20 3311721310015 BILAL S ALI & ZUJAJA SADIQ 5121 59TH ST W 1 24,200.00$ 21 3311721310016 ALAN DUANE REITZ/HEIDI REITZ 5125 59TH ST W 1 24,200.00$ 22 3311721310028 CAROLYN J OWEN 5044 60TH ST W0 ‐$ 23 3311721310023 MIKE WOKAL & CINDY TIMMINS 5100 60TH ST W0 ‐$ 24 3311721310017 SUSAN K HAFFIELD 5124 60TH ST W0 ‐$ 25 3311721320018 MARK O'CONNELL 5200 60TH ST W 0.5 12,100.00$ 26 3311721320063 K A & T G ANDERSON 5300 60TH ST W 0.5 12,100.00$ 27 3311721320080 MARY MCNIFF 5324 60TH ST W 0.5 12,100.00$ MELODY LAKE A/B, GRANDVIEW A, BIRCHCREST C NEIGHBORHOOD ROADWAY RECONSTRUCTION IMPROVEMENT NO. BA‐457 PRELIMINARY ASSESSMENT ROLL PID Owner House No. Street Assessable REU Assessable Amount 28 3311721310029 VILLAGE OF EDINA 24 ADDRESS UNASSIGNED 2 48,400.00$ 29 3311721310057 J M TERSECK & J TERSECK 5100 BENTON AVE 0.5 12,100.00$ 30 3311721310001 H D CATRON & C D CATRON 5101 BENTON AVE 0.5 12,100.00$ 31 3311721310052 ROBERT A SCHOENBAUM ET AL 5120 BENTON AVE 0.5 12,100.00$ 32 3311721310006 AMY B MEYERS 5121 BENTON AVE 0.5 12,100.00$ 33 3311721320073 MARY ANN STONE 5200 BENTON AVE 0.5 12,100.00$ 34 3311721320013 ANNE M ERICSON TRUSTEE 5201 BENTON AVE 0.5 12,100.00$ 35 3311721320024 D H KNUTSON & J F KNUTSON 5215 BENTON AVE 0.5 12,100.00$ 36 3311721320026 DONNA JOAN WEBB 5216 BENTON AVE 0.5 12,100.00$ 37 3311721320038 MATHIEU SELLS & RENEE SELLS 5300 BENTON AVE 0.5 12,100.00$ 38 3311721320069 COREY M STRICKLAND 5325 BENTON AVE 0.5 12,100.00$ 39 3311721320033 GREGORY M NATIONS 5800 BERNARD PL 1 24,200.00$ 40 3311721320031 M J HAUTLA & H S HAUTLA 5801 BERNARD PL 1 24,200.00$ 41 3311721320034 WHITNEY BLAKE WALDEN 5804 BERNARD PL 1 24,200.00$ 42 3311721320030 R & E PRESTRUD 5805 BERNARD PL 1 24,200.00$ 43 3311721320029 S AUBITZ & S B AUBITZ TRSTES 5807 BERNARD PL 1 24,200.00$ 44 3311721320035 M L & M J DESLAURIERS 5808 BERNARD PL 1 24,200.00$ 45 3311721320036 CHRISTOPHER CHOW/JUNQING XIN 5812 BERNARD PL 1 24,200.00$ 47 3311721320028 A C PETERSON & J R PETERSON 5813 BERNARD PL 1 24,200.00$ 48 3311721320037 J M FINLEY & J K FINLEY 5816 BERNARD PL 1 24,200.00$ 49 3311721320027 P J & J C HENNESSY 5817 BERNARD PL 1 24,200.00$ 51 3311721320057 RUTH MAATZ 5900 BERNARD PL 0.5 12,100.00$ 52 3311721320059 ABRAHAM PARK & MINHEE CHO 5904 BERNARD PL 1 24,200.00$ 53 3311721320066 O S & H HAKIMI 5905 BERNARD PL 1 24,200.00$ 54 3311721320060 PERKINS COVE VENTURES LLC 5908 BERNARD PL 1 24,200.00$ 55 3311721320023 C & G MEITZ 5909 BERNARD PL 1 24,200.00$ 56 3311721320061 DAVID W SARP/PAULETTE S SARP 5912 BERNARD PL 1 24,200.00$ 57 3311721320022 L D PETERSON & H A PETERSON 5913 BERNARD PL 1 24,200.00$ 58 3311721320062 FLORA E DELANEY 5916 BERNARD PL 1 24,200.00$ 59 3311721320021 D HUSTRULID & R HUSTRULID 5917 BERNARD PL 1 24,200.00$ 60 3311721320020 R E RATLIFF & S L RATLIFF 5921 BERNARD PL 0.5 12,100.00$ 61 3311721320007 A R THELEMANN III ET AL TR 5804 CODE AVE 1 24,200.00$ 62 3311721320008 GERALD F BOGDA & WIFE 5808 CODE AVE 1 24,200.00$ 63 3311721320009 RICHARD Y BAE/LAUREN KIM BAE 5812 CODE AVE 1 24,200.00$ 64 3311721320010 JOAN M OLSON 5816 CODE AVE 1 24,200.00$ 66 3311721320014 R BARIBAULT/S BARIBAULTTR 5904 CODE AVE 1 24,200.00$ 67 3311721320015 JODI P YOUNGREV TRUST 5908 CODE AVE 1 24,200.00$ 68 3311721320016 SCOTT J & MARA J PETERSEN 5912 CODE AVE 1 24,200.00$ 69 3311721320017 D & L HOENE 5916 CODE AVE 1 24,200.00$ 70 3311721320045 JEFFREY O SKINNER 5800 DALE AVE 1 24,200.00$ 71 3311721320044 MICHAEL OLSON & TARA FALSANI 5801 DALE AVE 1 24,200.00$ 72 3311721320046 P C BIEWEN & A E BIEWEN 5804 DALE AVE 1 24,200.00$ 73 3311721320043 LAURETTE A BLAKE 5805 DALE AVE 1 24,200.00$ 74 3311721320047 M M MODARES & M MODARES 5808 DALE AVE 1 24,200.00$ 75 3311721320042 THOMAS C & CHRISTINE D EVANS 5809 DALE AVE 1 24,200.00$ 77 3311721320048 JEFFREY JOHNSON/RITA JOHNSON 5812 DALE AVE 1 24,200.00$ 78 3311721320041 D F GRAFT & B K GRAFT 5813 DALE AVE 1 24,200.00$ 79 3311721320049 DAVID W & KRISTINE M WETMORE 5816 DALE AVE 1 24,200.00$ 81 3311721320040 BENJAMIN T BERCAW 5817 DALE AVE 1 24,200.00$ 82 3311721320050 NORDEEN GANGANI & S GANGANI 5820 DALE AVE 0.5 12,100.00$ 83 3311721320039 SIRILUCK PHONORTHONG 5821 DALE AVE 0.5 12,100.00$ 84 3311721310075 L H HEGG & M S HEGG 5800 EASTVIEW DR 1 24,200.00$ 85 3311721310068 M R YEAGER & J M YEAGER 5801 EASTVIEW DR 1 24,200.00$ 86 3311721310067 S W JEPSEN & R E JEPSEN 5805 EASTVIEW DR 1 24,200.00$ 87 3311721310066 J A DOLPHIN & M C DOLPHIN 5809 EASTVIEW DR 1 24,200.00$ 88 3311721310074 JENNIFER S STACK/C T GORNEY 5812 EASTVIEW DR 1 24,200.00$ 89 3311721310065 P G SANDA & S C SANDA 5813 EASTVIEW DR 1 24,200.00$ 90 3311721310076 TREVOR & DANIELLE BUSBY 5816 EASTVIEW DR 1 24,200.00$ 91 3311721310064 R J V VOSE & A M H VOSE 5817 EASTVIEW DR 1 24,200.00$ 92 3311721310077 J C SELLE & J R SELLE 5820 EASTVIEW DR 1 24,200.00$ 93 3311721310063 DAVID C SANDA/SUSAN W SANDA 5821 EASTVIEW DR 1 24,200.00$ 94 3311721310062 R H LUEDTKE & V A LUEDTKE 5825 EASTVIEW DR 1 24,200.00$ MELODY LAKE A/B, GRANDVIEW A, BIRCHCREST C NEIGHBORHOOD ROADWAY RECONSTRUCTION IMPROVEMENT NO. BA‐457 PRELIMINARY ASSESSMENT ROLL PID Owner House No. Street Assessable REU Assessable Amount 95 3311721310069 HUSSEIN W EGAL & LUL G DURIE 5828 EASTVIEW DR 0.5 12,100.00$ 96 3311721310061 J HESSENIUS & J PANNING 5829 EASTVIEW DR 1 24,200.00$ 97 3311721310060 RACHEL OWEN & SION OWEN 5833 EASTVIEW DR 0.5 12,100.00$ 98 3311721240001 CITY OF EDINA 5100 GROVE ST 2 48,400.00$ 100 3311721310034 J H HARTWELL & C HARTWELL 5101 GROVE ST 1 24,200.00$ 102 3311721310035 BARBARA L PELAK 5105 GROVE ST 1 24,200.00$ 103 3311721310036 JOHN W OIEN & SHEILA A OIEN 5109 GROVE ST 1 24,200.00$ 104 3311721240002 BRETT & THERESA HALVERSON 5110 GROVE ST 1 24,200.00$ 105 3311721310037 M W TRUMAN & J E TRUMAN 5113 GROVE ST 1 24,200.00$ 106 3311721310038 T J SCHILLING/A C SCHILLING 5117 GROVE ST 1 24,200.00$ 107 3311721310039 T P UNDERDAHL/A M UNDERDAHL 5121 GROVE ST 1 24,200.00$ 108 3311721240004 M G MESSNER & KARI G MESSNER 5124 GROVE ST 1 24,200.00$ 109 3311721230007 BRADLEY D RHOADES 5200 GROVE ST 1 24,200.00$ 111 3311721320003 STEPHEN P & TERRI O MENKE 5201 GROVE ST 1 24,200.00$ 112 3311721230002 J M CRIST & J H CRIST 5204 GROVE ST 1 24,200.00$ 113 3311721320004 LARRY J MAY/SANDRA A MAY TRS 5205 GROVE ST 1 24,200.00$ 114 3311721320082 KARI KOUATLI 5209 GROVE ST 1 24,200.00$ 115 3311721320032 R S LUND & H A LUND 5213 GROVE ST 1 24,200.00$ 116 3211721410030 ELIZABETH HOPF & ERIC HOPF 5800 HANSEN RD 1 24,200.00$ 117 3311721320056 JAY R ADDY & KARIN E R ADDY 5801 HANSEN RD 1 24,200.00$ 118 3211721410031 S A LEVIN & J A LEVIN 5804 HANSEN RD 1 24,200.00$ 121 3311721320055 ROBERT & AUDREY ROGNESS TRST 5805 HANSEN RD 1 24,200.00$ 122 3211721410032 B C & J A VANHOVE 5808 HANSEN RD 1 24,200.00$ 123 3311721320054 M KNOBEN & R VARGHESE 5809 HANSEN RD 1 24,200.00$ 124 3211721410068 A M ZHURAVEL & M R ZHURAVEL 5812 HANSEN RD 1 24,200.00$ 125 3311721320053 LUCAS HAAPAPURO 5813 HANSEN RD 1 24,200.00$ 126 3211721410066 K J VARGO/D F PREIS TRUSTEES 5816 HANSEN RD 1 24,200.00$ 127 3311721320052 R C & L D LARSON 5817 HANSEN RD 1 24,200.00$ 128 3311721320051 BENJAMIN E FOOTE 5821 HANSEN RD 0.5 12,100.00$ 129 3211721410110 ERIC WALKER & CLAIRE WALKER 5824 HANSEN RD 0.5 12,100.00$ 130 3211721410038 JOHN JORAN & SHANNON JORAN 5900 HANSEN RD 0.5 12,100.00$ 131 3211721410039 VIL OF EDINA 5904 HANSEN RD 0 ‐$ 132 3211721410040 J S FINZEN & K SLATER FINZEN 5908 HANSEN RD 1 24,200.00$ 133 3311721320001 A B W ANDREWS ET AL SUBJ/LE 5909 HANSEN RD 1 24,200.00$ 134 3211721410041 J V NELSON & J M NELSON 5912 HANSEN RD 1 24,200.00$ 135 3311721320076 J K NEWBURG & E T NEWBURG 5913 HANSEN RD 1 24,200.00$ 136 3211721410036 JOHN H WARD 5916 HANSEN RD 1 24,200.00$ 137 3311721320077 S & L POLLMANN 5917 HANSEN RD 1 24,200.00$ 138 3211721410037 CAREY PROPERTIES LLC 5920 HANSEN RD 1 24,200.00$ 139 3311721310078 NIPA PATEL 5900 JOSEPHINE AVE 0.5 12,100.00$ 140 3311721310087 W E AVERY & R V AVERY 5901 JOSEPHINE AVE 0.5 12,100.00$ 141 3311721310079 P B HEIM & S L D HEIM 5904 JOSEPHINE AVE 1 24,200.00$ 142 3311721310086 DANIEL A KING/KRISTIN R KING 5905 JOSEPHINE AVE 1 24,200.00$ 143 3311721310080 TOMMY S PHILL ETAL 5908 JOSEPHINE AVE 1 24,200.00$ 144 3311721310085 S M SOLAKIAN/SARKIS SOLAKIAN 5909 JOSEPHINE AVE 1 24,200.00$ 145 3311721310082 CARTER BEBENSEE 5912 JOSEPHINE AVE 0.67 16,214.00$ 146 3311721310084 SAMUEL P & BARBARA A VERDUCI 5913 JOSEPHINE AVE 0.67 16,214.00$ 147 3311721310091 H J MEEKER JR & H MEEKER 5809 TINGDALE AVE 1 24,200.00$ 148 3311721310090 MARY V & JAY A KOSTERS 5813 TINGDALE AVE 1 24,200.00$ 149 3311721310030 CRAIG M OLDAKOWSKI 5821 TINGDALE AVE 0.5 12,100.00$ 150 3311721310031 M FIOL/A FIOL/M FIOL 5825 TINGDALE AVE 1 24,200.00$ 151 3311721310032 MICHAEL J CHAPURAN 5829 TINGDALE AVE 1 24,200.00$ 152 3311721310011 L J BECKER & M D SANDLER 5900 TINGDALE AVE 1 24,200.00$ 153 3311721310024 T M & M A LAFORCE 5901 TINGDALE AVE 1 24,200.00$ 154 3311721310025 R C SMITH & D J SMITH 5905 TINGDALE AVE 1 24,200.00$ Total 297.54 7,200,468.00$ STATE OF MINNESOTA ) COUNTY OF HENNEPIN) SS CERTIFICATE OF MAILING NOTICE CITY OF EDINA ) I, the undersigned, being the duly qualified acting City Clerk of the City of Edina, Minnesota, hereby certify that on the following date November 20, 2020, acting on behalf of said City, I deposited in the United States mail copies of the attached Notice of Public Hearing for Melody Lake A & B / Grandview A / Birchcrest C Neighborhood Roadway Reconstruction (Exhibit A), enclosed in sealed envelopes, with postage thereon duly prepaid, addressed to the persons at the addresses as shown on the mailing list (Exhibit B), attached to the original hereof, which list is on file in my office, said persons being those appearing on the records of the County Auditor as owners of the property listed opposite their respective names, as of a date 17 days prior to the date of the hearing; and that I also sent said notice to the following corporations at the indicated addresses whose property is exempt from taxation and is therefore not carried on the records of said County Auditor. NAME ADDRESS WITNESS my hand and the seal of said City this 20th day of November, 2020. ________________________________ Edina City Clerk November 20, 2020 NOTICE OF PUBLIC HEARING ROADWAY IMPROVEMENTS PROPOSED IMPROVEMENT NO. BA-457 MELODY LAKE A & B, BIRCHCREST C AND GRANDVIEW A NEIGHBORHOOD ROADWAY RECONSTRUCTION The Edina City Council will meet virtually, on Monday, Dec. 7, 2020, at 6:00 p.m., to consider the public hearing on roadway improvements for Melody Lake A & B, Birchcrest C and Grandview A Neighborhood Roadway Reconstruction. This hearing is being conducted under the authority granted by Minnesota Statutes, Chapter 429. This hearing has been called as a recommendation from staff. The proposed project would be constructed in the summer of 2021 with the assessment hearing occurring in the fall of 2021. The estimated cost is $7,214,575.00 and is funded by special assessment. The estimated cost per assessable lot is $24,200.00 per residential equivalent unit. The assessment can be divided over a fifteen-year period with interest accumulating on the unpaid balance. The area proposed to be assessed the cost of the proposed improvement includes the following: 5109 to 5313 West 56th Street, 5100 to 5121 West 58th Street, 5105 to 5125 West 59th Street, 5044, 5100, 5124, 5200, 5300 and 5324 West 60th Street, 5100, 5101, 5120, 5121, 5200, 5201, 5215, 5216, 5300 and 5325 Benton Avenue, 5600 to 5921 Bernard Place, 5600 to 5916 Code Avenue, 5600 to 5821 Dale Avenue, 5800 to 5833 Eastview Drive, 5114 to 5213 Grove Street, 5405 to 5920 Hansen Road, 5900 to 5913 Josephine Avenue 5712 to 5733 Melody Lane, 5604 to 5637 Melody Lake Drive, 5809 to 5905 Tingdale Avenue, 5300 to 5328 Windsor Avenue. Your receipt of this notice is an indication that property whose ownership is listed to you is among those properties which are considered to be benefited by the improvement. The City Council can authorize the proposed project immediately upon the close of the hearing. Staff’s recommendations to City Council are: •New 5-foot concrete sidewalk on the west side of Hansen Road and the south side of West 56th Street •Hansen Road reconstructed to 24-feet wide south of CP Railroad crossing •West 56th Street reconstructed to 24-feet wide; all other streets reconstructed to 27-feet wide •One-sided parking on the west side of Hansen Road south of the railroad tracks and on the south side of West 56th Street east of Dale Avenue. No parking on West 56th Street between Hansen Road and Dale Avenue •New concrete curb and gutter on all streets •New bituminous pavement on all streets. •Full replacement of underground watermain, water services, hydrants and valves •Construction of a new retaining wall along the west side of Hansen Road. •Spot repairs of the sanitary sewer main •Storm sewer improvements to resolve local drainages issues and installation of sump drains where feasible Page 1 of 3 The Engineering Study will be available online as part of the Dec. 7 City Council meeting agenda at http://bit.ly/2y3wCOo; under Meeting Type select City Council Meeting, click Search and you will see the Dec. 7 Agenda. To comment, you may: •Write to City of Edina, Attention Engineering, 7450 Metro Boulevard, Edina, MN 55439. •Email to CityCouncil@EdinaMN.gov, Attention City Council and Engineering. •Watch the virtual public hearing online or on Edina TV and call in to offer comments, leave a voicemail in advance or submit your comments online. Ways to participate are included in this mailing. Page 2 of 3 How to Participate in a Public Hearing MEETING PROCEDURE: The Mayor of Edina has determined that an in-person meeting is not practical or prudent because of the COVD-19 health pandemic. Because of the health pandemic, it has been determined that physical presence at the regular meeting location by members of the public is not feasible. Because of the health pandemic, it has been determined that physical presence at the regular meeting location by at least one member of the body, chief legal counsel or chief administrative officer is not feasible. Therefore, the City Council will be participating in the meeting remotely. HOW TO PARTICIPATE: Public hearing input can be provided in a variety of ways to the City Council. Options 1 & 2 are available now: 1)Better Together Edina Website (www.BetterTogetherEdina.org/public-hearings) 2) Phone (952-826-0377) Options 3 & 4 are available the night of the meeting: 3)Watch the meeting a.Edina TV (Comcast Channels 813 or 16) b. Facebook.com/EdinaMN c.EdinaMN.gov/LiveMeetings 4)Call in to provide live testimony at 1-800-374-0221. The conference ID number for the City Council meeting will be posted online closer to the public hearing date. FURTHER INFORMATION: City of Edina Engineering Department, 7450 Metro Boulevard, Edina, MN 55439, 952-826-0371 Page 3 of 3 3311721240043 JUDITH & THOMAS FORKER 5109 56TH ST W EDINA MN 55436 3311721230001 RICHARD P GRIFFITH & PATRICIA A GRIFFITH 5201 56TH ST W EDINA MN 55436 3311721220045 ALEX BLYAKHMAN & ANGELINA KALAYTOWICZ 5208 56TH ST W EDINA MN 55436 3311721230006 RICHARD HERMAN 5209 56TH ST W EDINA MN 55436 3311721220046 JEANNE A MOYNIHAN MYERS 5212 56TH ST W EDINA MN 55436 3311721230005 JACQUELINE GRIFFITH CROWLEY 5213 56TH ST W EDINA MN 55436 3311721220047 BEVERLY A BEIN 5216 56TH ST W EDINA MN 55436 3311721230050 JANA M HOFFMANN 5217 56TH ST W EDINA MN 55436 3311721220048 MARY A LOHMANN 5220 56TH ST W EDINA MN 55436 3311721230094 ANDREW BOWEN & DANIELA BOWEN 5221 56TH ST W EDINA MN 55436 3311721220049 CARL DAVID CROSBY LEHMANN & KATIE CROSBY LEHMANN 5224 56TH ST W EDINA MN 55436 3311721220083 NATHAN J PETERSON 5228 56TH ST W EDINA MN 55436 3311721220084 DARLENE SHOLTIS & HEINO A BECKMANN 5232 56TH ST W EDINA MN 55436 3311721220087 JONATHAN H ENGMAN 5236 56TH ST W EDINA MN 55436 3311721230045 BRIAN SANTORI & GRETA SANTORI 5309 56TH ST W EDINA MN 55436 3311721230046 CARE PROPERTIES LLC 18986 LAKE DR E CHANHASSEN MN 55317 3311721230060 BOYD A & SHERI L HUPPERT 5600 BERNARD PL EDINA MN 55436 3311721230093 MARCIA KOESTER 5601 BERNARD PL EDINA MN 55436 3311721230095 PATRICK M FINLEY 5603 BERNARD EDINA MN 55436 3311721230061 LAURA KNUTSON & FREDERICK SEMMER 5604 BERNARD PL EDINA MN 55436 3311721230096 PATRICIA C WREDE 5605 BERNARD PL EDINA MN 55436 3311721230062 CHRISTOPHER REA & VICTORIA REA 5608 BERNARD PL EDINA MN 55436 3311721230018 THOMAS E & ROXANNE S REESE 5609 BERNARD PL EDINA MN 55436 3311721230063 MARY K CASHMAN 5612 BERNARD PL EDINA MN 55436 3311721230019 DONALD & JEANNE RAHE 5613 BERNARD PL EDINA MN 55436 3311721230042 JERMAINE L BROWN & ELIZABETH A MACLEAN BROWN 5616 BERNARD PL EDINA MN 55436 3311721230020 SCOT WAGGONER 5617 BERNARD PL EDINA MN 55436 3311721230043 AMY SANFILIPPO DEMAREST 5620 BERNARD PL EDINA MN 55436 3311721230044 CHRISTOPHER HOLT/ANNE E HOLT 5624 BERNARD PL EDINA MN 55436 3311721230035 TIMOTHY GERARD HEALY & KRISTI KAY HEALY 5700 BERNARD PL EDINA MN 55436 3311721230034 THOMAS A LANDVIK 5701 BERNARD PLACE EDINA MN 55436 3311721230036 ALYSSA & JON MARKER 5704 BERNARD PL EDINA MN 55436 3311721230033 COURTLAND HALE LUKENS 5705 BERNARD PL EDINA MN 55436 3311721230037 KATHLEEN A GLASER 5708 BERNARD PL EDINA MN 55436 3311721230032 MEGAN ANDERSON 5709 BERNARD PL EDINA MN 55436 3311721230038 R R DEBATES & J A GRZYBOWSKI 5712 BERNARD PL EDINA MN 55436 3311721230031 MICHAEL H CREEVY 5713 BERNARD PL EDINA MN 55436 3311721230039 WILLIAM D CLYNES & DAVID W CLYNES 5716 BERNARD PL EDINA MN 55436 3311721230030 CHADD L MOSER STACI MOSER 5717 BERNARD PL EDINA MN 55436 3311721230040 STEVEN F & ROXANNE KRIZ 5720 BERNARD PL EDINA MN 55436 3311721230029 ZULEGER LIVING TRUST 5721 BERNARD PL EDINA MN 55436 3311721230041 WILLIAM JANOUSEK & SARA ANN JANOUSEK 5724 BERNARD PL EDINA MN 55436 3311721230028 CLARE ELIZABETH HAHNEMAN & BRADLEY ALLEN LIFFORD 5725 BERNARD PL EDINA MN 55436 3311721220002 JAMES ANKENY/LUCINDA WINTER 5532 CODE AVE EDINA MN 55436 3311721230047 MARK BIEDENFELD & MOLLY BIEDENFELD 5600 CODE AVE EDINA MN 55436 3311721230048 MARK M & MARGARET S WATT 5604 CODE AVE EDINA MN 55436 3311721230059 THOMAS PEDERSON & BARBARA RIECHMANN-PEDERSON 5605 CODE AVE EDINA MN 55436 3311721230049 ROGER GARY NUNN & LYNN DAGGETT NUNN 5608 CODE AVE EDINA MN 55436 3311721230051 MARTIN A MIKUS 5612 CODE AVE EDINA MN 55436 3311721230052 JAMES & SHARYN DOLL 5616 CODE AVE EDINA MN 55436 3311721230058 THUNDER PROP SOLUTIONS LLC PO BOX 27740 LAS VEGAS NV 89126 3311721230053 ROBERT & BETTY FULGENCY 5620 CODE AVE EDINA MN 55436 3311721230057 JERALD R KNOX 5621 CODE AVE EDINA MN 55436 3311721230021 JOAN F LUNDBERG 5700 CODE AVE EDINA MN 55436 3311721230017 JAMES T DOUDIET & JANET S DOUDIET EDINA MN 55436 3311721230022 PATRICIA JORDAN TENNYSON 5704 CODE AVE EDINA MN 55436 3311721230016 PAUL STARK & JULIA STARK 5705 CODE AVE EDINA MN 55436 3311721230023 JAMES M KEGANS & KELLY R KEGANS 5708 CODE AVE EDINA MN 55436 3311721230024 THOMAS CARTER 5712 CODE AVE EDINA MN 55436 3311721230015 MITCHELL LEE PAGE & LINDA MARIE PAGE 5713 CODE AVE EDINA MN 55436 3311721230025 GAVIN M LEE & ANGELA P NELSON 5716 CODE AVE EDINA MN 55436 3311721230026 BRAD D HARVEY 5720 CODE AVE EDINA MN 55436 3311721230027 2222 N 7TH LLC 4710 GOLF TER EDINA MN 55424 3311721230076 RUTH A METZGER 5600 DALE AVE EDINA MN 55436 3311721230064 KEVIN BOHRERV & KRISTINA K WESTPHAL BOHRER 5605 DALE AVE EDINA MN 55436 3311721230077 MICHAEL T LUND & MADELINE ROSE TOMPKINS 5608 DALE AVE EDINA MN 55436 3311721230065 GEORGE R BARD 5609 DALE AVE EDINA MN 55436 3311721230078 TERRY K & KATHERINE K LEWIS 5612 DALE AVE EDINA MN 55436 3311721230066 EVELYN M COFFEY 5615 DALE AVE EDINA MN 55436 3311721230079 RYAN & AUTUMN MULDOWNEY 5616 DALE AVE EDINA MN 55436 3311721230067 ALEC S JOHNSON & HEATHER D BERAN 5617 DALE AVE EDINA MN 55436 3311721230080 CARRIE RYDER DECKER 5620 DALE AVE EDINA MN 55436 3311721230068 AKKIREDDY GUTHIKONDA & VIJAYALAKSHMI GUTHIKONDA 5621 DALE AVE EDINA MN 55436 3311721230081 DENISE M NELSON 5624 DALE AVE EDINA MN 55436 3311721230082 KEITH WITHERSPOON & WENDY WITHERSPOON 5700 DALE AVE EDINA MN 55436 3311721230069 MEGAN D GRANDE 5701 DALE AVE EDINA MN 55436 3311721230083 JAMES R & JUDITH A MAXA 5704 DALE AVE EDINA MN 55436 3311721230070 ROGER T SORENSEN & STEPHANIE R BOAEUF 5705 DALE AVE EDINA MN 55436 3311721230084 DANIELLE D SMITH & FABIEN PONSON 5708 DALE AVE EDINA MN 55436 3311721230071 KELLY LAURSEN & NATHAN BLAKE LAURSEN 5709 DALE AVE EDINA MN 55436 3311721230085 STAMATIA G MUCHULAS 5712 DALE AVE EDINA MN 55436 3311721230072 JAMES A CASPAR 5713 DALE AVE EDINA MN 55436 3311721230097 MARK WILLIAM BOYSEN 5716 DALE AVE EDINA MN 55436 3311721230073 JAKUB JEZ & RANDEE C JEZ 5717 DALE AVE EDINA MN 55436 3311721230098 TIMOTHY A BLAKESLEY & SUN M BLAKESLEY 5720 DALE AVE EDINA MN 55436 3311721230074 ERIK G JOHNSON 5721 DALE AVE EDINA MN 55436 3311721230099 MICHAEL DIXON & CAROLINE DIXON 5724 DALE AVE EDINA MN 55436 3311721230075 SHAWN P GAITHER & RACHELLE J BAKER 5725 DALE AVE EDINA MN 55436 3311721230100 PHILLIP R & MARSHA J SUSSMAN 5728 DALE AVE EDINA MN 55436 3311721240003 RICHARD BRADLEY FOX 5114 GROVE ST EDINA MN 55436 3311721240015 JOHN R & JOANNE R BENTLEY 5120 GROVE ST EDINA MN 55436 3311721230008 MS CATHRYN M BALEK 5208 GROVE ST EDINA MN 55436 3311721220005 PAULA S OGG & KATHARINE A MCARRON 5405 HANSEN RD EDINA MN 55436 3311721220082 SUANNE D HIBBS 5501 HANSEN RD EDINA MN 55436 3311721220081 MURIEL A BURSH 300 21ST AVE N HOPKINS MN 55343 3311721220057 RICHARD R & MARY J KVANBECK 5511 HANSEN RD EDINA MN 55436 3311721220056 CHRISTOPHER REEVES 5515 HANSEN RD EDINA MN 55436 3211721140055 VILLAGE OF EDINA 4801 WEST 50TH ST EDINA MN 55424 3311721220055 WESTCHESTER PROPERTIES LLC 4915 W 35TH ST STE 103 ST LOUIS PARK MN 55416 3311721230092 FRASER COMMUNITY SERVICES 2400 64TH ST W RICHFIELD MN 55423 3311721230091 SARA M WAKEFIELD 5621 HANSEN RD EDINA MN 55436 3311721230090 DANIEL LINDER/AMANDA LINDER 5625 HANSEN RD EDINA MN 55436 3211721140053 5700 HANSEN LLC P O BOX 505 SAVAGE MN 55378 3311721230089 DUSTIN BILLE & LEIGHLIN BILLE 5701 HANSEN RD EDINA MN 55436 3311721230088 DANIEL J & CAROL L FERTIG 5705 HANSEN RD EDINA MN 55436 3311721230087 DERRONG IRENE LIN 5709 HANSEN RD EDINA MN 55436 3211721140074 JEFFREY M & MARY L DYRHAUG 6613 GLEASON RD EDINA MN 55439 3311721230086 IH2 PROPERTY ILLINOIS LP C/O INVITATION HOMES 1717 MAIN ST STE 2000 DALLAS TX 75201 3211721140073 PATRICIA ANN MALIN 5714 HANSEN RD EDINA MN 55436 3211721140044 THOMAS C MORGAN 5716 HANSEN ROAD EDINA MN 55436 3311721230104 WENDELL R & DORTHY A MALIN 5717 HANSEN RD EDINA MN 55436 3211721140043 CLAUDIA L ROGAT 5720 HANSEN ROAD EDINA MN 55436 3311721230103 BROOKE M HANSSEN 5721 HANSEN RD EDINA MN 55436 3211721140042 ROBERT BUNCHEK 5724 HANSEN RD EDINA MN 55436 3311721230102 HEMANT NARASIMHAN & ROHINI V KUMAR 5725 HANSEN RD EDINA MN 55436 3311721230101 ORVILLE C HOGNANDER JR 10 CIRCLE EAST EDINA MN 55436 3311721240018 TODD & KELLY SCHNELL 5712 MELODY LA EDINA MN 55436 3311721240011 JEFFREY A AUSTIN & ROBIN R AUSTIN 5713 MELODY LA EDINA MN 55436 3311721240013 IH2 PROPERTY ILLINOIS LP C/O INVITATION HOMES 1717 MAIN ST STE 2000 DALLAS TX 75201 3311721240005 KEVIN MARTIN & TY JAMES TONANDER 5717 MELODY LA EDINA MN 55436 3311721240006 MARK OEHLKE & LYNN M OEHLKE 5721 MELODY LA EDINA MN 55436 3311721240010 BENJAMIN GUTH & HOLLY GUTH 5724 MELODY LA EDINA MN 55436 3311721240007 KENNETH A DREWELOW C/O MARY A DREWELOW 5725 MELODY LA EDINA MN 55436 3311721240014 WAYNE & KATHLEEN ELLIOTT 5728 MELODY LA EDINA MN 55436 3311721240008 JEFFREY A STEVENS & NICOLE M STEVENS 5729 MELODY LA EDINA MN 55436 3311721240009 JOHN M CONWAY 5733 MELODY LA EDINA MN 55436 3311721240077 CITY OF EDINA 4801 W 50TH ST EDINA MN 55424 3311721240020 CITY OF EDINA 4801 W 50TH ST EDINA MN 55424 3311721230054 BRIAN PAGE 5604 MELODY LAKE DR EDINA MN 55436 3311721240019 CURT SCHAEFER 5605 MELODY LAKE DR EDINA MN 55436 3311721230055 PATRICIA L DAWSON 5608 MELODY LAKE DR EDINA MN 55436 3311721240012 MARK J ELLINGSON 5609 MELODY LAKE DR EDINA MN 55436 3311721230056 MARTA H GUZMAN/ANDREW MAIDEN 5612 MELODY LAKE DR EDINA MN 55436 3311721230012 MARK J & JEANNE M RAZIDLO 5616 MELODY LAKE DR EDINA MN 55436 3311721230013 SCOTT J PASCOE 5620 MELODY LAKE DR EDINA MN 55436 3311721240017 KATHLEEN A TALBOTT 5621 MELODY LAKE DR EDINA MN 55436 3311721230014 LAIRD W BEAVER 5624 MELODY LAKE DR EDINA MN 55436 3311721240016 ANDREW JAMES ELTON KUDERER & SARAH MORGAN NEWINS KUDERER 5625 MELODY LAKE DR EDINA MN 55436 3311721230011 DEAN S NEWINS 5629 MELODY LAKE DR EDINA MN 55436 3311721230010 JOAN M NEWSOME 5633 MELODY LAKE DR EDINA MN 55436 3311721230009 VALERIE PEDERSON 5637 MELODY LAKE DR EDINA MN 55436 3311721220066 JOSEPH LOFTUS & KATHLEEN LOFTUS 5300 WINDSOR AVE EDINA MN 55436 3311721220075 RICHARD A SCARLETT 5301 WINDSOR AVE EDINA MN 55436 3311721220068 PAUL W VANPUTTEN & SUSAN J VAN PUTTEN 5304 WINDSOR AVE EDINA MN 55436 3311721220076 PAUL S & LISA D JOHNSON 5305 WINDSOR AVE EDINA MN 55436 3311721220069 KENNETH KOSKI 5308 WINDSOR AVE EDINA MN 55436 3311721220077 RICHARD & PATRICIA SANDVIK 5309 WINDSOR AVE EDINA MN 55436 3311721220070 JONATHAN N SEMBRANO & SHARON C YSON 5312 WINDSOR AVE EDINA MN 55436 3311721220078 BENNETT JOHNSON & MARY-KATHRYN JOHNSON 5313 WINDSOR AVE EDINA MN 55436 3311721220071 MICHAEL LEVY & MELISSA UNGERMAN- LEVY 5316 WINDSOR AVE EDINA MN 55436 3311721220079 BALDUS PROPERTIES LLC 3009 CENTRAL AVE N E MINNEAPOLIS MN 55418 3311721220072 JAMES R KORIN 7938 MAPLE HILL ROAD CORCORAN MN 55340 3311721220080 FAN FAN RENT LLC 10449 PURDEY RD EDEN PRAIRIE MN 55347 3311721220073 KAROLINE SPERLING & CHARLES SPERLING 5324 WINDSOR AVE EDINA MN 55436 3311721220074 DOUGLAS R JOHNSON 5328 WINDSOR AVE EDINA MN 55436 3311721310045 JOSEPH R HENSLEY & KATHRYN HENSLEY 5100 58TH ST W EDINA MN 55436 3311721310046 PETER JOSEPH SEMENKEWITZ 5101 W 58TH ST EDINA MN 55436 3311721310044 STEVEN J & KARIN J BOWER 5104 58TH ST W EDINA MN 55436 3311721310047 ELSIE SEMENKEWITZ 5105 58TH ST W EDINA MN 55436 3311721310043 ROBERT R & MARCELA R ROOS 5108 58TH ST W EDINA MN 55436 3311721310048 MICHAEL SHEA 5109 W 58TH ST EDINA MN 55436 3311721310042 JOHN GAUGHAN 5112 58TH ST W EDINA MN 55436 3311721310049 ALEKSEY DEREVYANKO & ANDREZA DEREVYANKO 5113 58TH ST W EDINA MN 55436 3311721310041 PAUL A & KATHLEEN L FINK 5116 58TH ST W EDINA MN 55436 3311721310050 JOSIE LYNN FIX & JEFFREY ALAN FIX 5117 58TH ST W EDINA MN 55436 3311721310040 BERGE H HANSEN 5120 58TH ST W EDINA MN 55436 3311721310051 SCOTT R DAVIDSON 5121 58TH ST W EDINA MN 55436 3311721310012 JAMYANG CHOJOR & YESHI D GONGPATSANG 5105 59TH ST W EDINA MN 55436 3311721310010 MATTHEW G HEWITT & MOLLY E HEWITT 5108 W 59TH ST EDINA MN 55436 3311721310013 JAMES A & VIKKI L GILLIGAN 5109 59TH ST W EDINA MN 55436 3311721310009 BRIAN KOVALCHUK 4741 THOMAS AVE S MINNEAPOLIS MN 55410 3311721310014 JON & JENNIFER MARKET TRUST 5113 59TH ST W EDINA MN 55436 3311721310008 ADAM DEAN PLOTTS/STACY MARCEL PLOTTS 5116 59TH ST W EDINA MN 55436 3311721310007 MARIELUISE OVIKIAN 5120 59TH ST W EDINA MN 55436 3311721310015 BILAL S ALI & ZUJAJA SADIQ 5121 59TH ST W EDINA MN 55436 3311721310016 ALAN DUANE REITZ/HEIDI REITZ 5125 59TH ST W EDINA MN 55436 3311721310028 CAROLYN J OWEN 5044 60TH ST W EDINA MN 55436 3311721310023 MIKE WOKAL 5100 60TH ST W EDINA MN 55436 3311721310017 SUSAN K HAFFIELD 5124 W 60TH STREET EDINA MN 55436 3311721320018 MARK O'CONNELL 5200 60TH ST W EDINA MN 55436 3311721320063 KATHERINE/THOMAS ANDERSON 5300 60TH ST W EDINA MN 55436 3311721320080 MARY MCNIFF 5324 60TH ST W EDINA MN 55436 3311721310029 VILLAGE OF EDINA 4801 W 50TH ST EDINA MN 55424 3311721310057 JOHN & JENNIFER TERSECK 5100 BENTON AVE EDINA MN 55436 3311721310001 HEIDI & CHRISTIAN CATRON 5101 BENTON AVE EDINA MN 55436 3311721310052 ROBERT A SCHOENBAUM & ANGELA R SURPRENANT 5120 BENTON AVE EDINA MN 55436 3311721310006 AMY B MEYERS 5121 BENTON AVE EDINA MN 55436 3311721320073 MARY ANN STONE 5200 BENTON AVE EDINA MN 55436 3311721320013 ANNE M ERICSON 5201 BENTON AVE EDINA MN 55436 3311721320024 DAVID H KNUTSON 5215 BENTON AVE S EDINA MN 55436 3311721320026 DONNA JOAN WEBB 5216 BENTON AVE EDINA MN 55436 3311721320038 MATHIEU SELLS & RENEE SELLS 5300 BENTON AVE EDINA MN 55436 3311721320069 COREY M STRICKLAND 5325 BENTON AVE EDINA MN 55436 3311721320033 GREGORY M NATIONS 5800 BERNARD PL EDINA MN 55436 3311721320031 MARCUS JOHN HAUTLA & HEATHER SCHWAB HAUTLA 5801 BERNARD PL EDINA MN 55436 3311721320034 WHITNEY BLAKE WALDEN 5804 BERNARD PL EDINA MN 55436 3311721320030 ROBERT W & EVA E PRESTRUD 5805 BERNARD PL EDINA MN 55436 3311721320029 SCOTT & SARA AUBITZ 5807 BERNARD PL EDINA MN 55436 3311721320035 MEGHAN & MICHAEL DESLAURIERS 5808 BERNARD PL EDINA MN 55436 3311721320036 CHRISTOPHER CHOW/JUNQING XIN 5812 BERNARD PL EDINA MN 55436 3311721320028 ANDREW C PETERSON 5813 BERNARD PL EDINA MN 55436 3311721320037 JEFFREY M FINLEY 5816 BERNARD PL EDINA MN 55436 3311721320027 PATRICK J HENNESSY 5817 BERNARD PL EDINA MN 55436 3311721320057 RUTH MAATZ 5900 BERNARD PL EDINA MN 55436 3311721320059 ALEXANDRA STEPHANY & JACOB STEPHANY 5904 BERNARD PL EDINA MN 55436 3311721320066 OSCAR S & HOURI HAKIMI 5905 BERNARD PL EDINA MN 55436 3311721320060 PERKINS COVE VENTURES LLC 5904 CODE AVE EDINA MN 55436 3311721320023 GREGORY J & CARREN E MEITZ 5909 BERNARD PL EDINA MN 55436 3311721320061 DAVID W SARP/PAULETTE S SARP 5912 BERNARD PL EDINA MN 55436 3311721320022 LEROY D & HARRIET A PETERSON 5913 BERNARD PL EDINA MN 55436 3311721320062 FLORA E DELANEY 5916 BERNARD PL EDINA MN 55436 3311721320021 DAVID L HUSTRULID & ROBYN K HUSTRULID 5917 BERNARD PL EDINA MN 55436 3311721320020 R E RATLIFF & S L RATLIFF 5921 BERNARD PL EDINA MN 55436 3311721320007 ARTHUR R THELEMANN/ANNABELLE C THELEMANN 5804 CODE AVE EDINA MN 55436 3311721320008 GERALD F BOGDA 5808 CODE AVE S EDINA MN 55436 3311721320009 RICHARD Y BAE 5812 CODE AVE EDINA MN 55436 3311721320010 JOAN M OLSON 5816 CODE AVE EDINA MN 55436 3311721320014 REYNALD A BARIBAULT/SALLY K BARIBAULT 5904 CODE AVE EDINA MN 55436 3311721320015 JAMES N YOUNG & JODI P YOUNG 5908 CODE AVE EDINA MN 55436 3311721320016 SCOTT J & MARA J PETERSEN 5912 CODE AVE EDINA MN 55436 3311721320017 DANIEL J & LISA M HOENE 5916 CODE AVE EDINA MN 55436 3311721320045 JEFFREY O SKINNER 5800 DALE AVE EDINA MN 55436 3311721320044 MICHAEL OLSON & TARA FALSANI 5801 DALE AVE EDINA MN 55436 3311721320046 PAUL C BIEWEN 5804 DALE AVE EDINA MN 55436 3311721320043 LAURETTE A BLAKE 5805 DALE AVE EDINA MN 55436 3311721320047 MICHAEL M MODARES & MARYAM MODARES 5808 DALE AVE EDINA MN 55436 3311721320042 THOMAS C & CHRISTINE D EVANS 5809 DALE AVE EDINA MN 55436 3311721320048 JEFFREY JOHNSON/RITA JOHNSON 5812 DALE AVE EDINA MN 55436 3311721320041 DAVID F & BONNIE K GRAFT 5813 DALE AVE EDINA MN 55436 3311721320049 DAVID W WETMORE 5816 DALE AVE EDINA MN 55436 3311721320040 BENJAMIN T BERCAW 5817 DALE AVE EDINA MN 55436 3311721320050 NORDEEN GANGANI & SALIMA GANGANI 5820 DALE AVE EDINA MN 55436 3311721320039 SIRILUCK PHONORTHONG 5821 DALE AVE EDINA MN 55436 3311721310075 LOWELL H & MAXINE S HEGG 5800 EASTVIEW DR EDINA MN 55436 3311721310068 MATTHEW R & JILL M YEAGER 5801 EASTVIEW DR EDINA MN 55436 3311721310067 ROBERT & SUSAN JEPSEN 5805 EASTVIEW DRIVE EDINA MN 55436 3311721310066 JOHN & MARCIA DOLPHIN 5809 EASTVIEW DR EDINA MN 55436 3311721310074 JENNIFER S STACK/CHRISTOPHER T GORNEY 5812 EASTVIEW DR EDINA MN 55436 3311721310065 PAUL G SANDA & SONJA C SANDA 5813 EASTVIEW DR EDINA MN 55436 3311721310076 TREVOR & DANIELLE BUSBY 5816 EASTVIEW DR EDINA MN 55436 3311721310064 ROBERT & AMY VOSE 5817 EASTVIEW DR EDINA MN 55436 3311721310077 JOHN C SELLE 5820 EASTVIEW DR EDINA MN 55436 3311721310063 DAVID C SANDA/SUSAN W SANDA 5821 EASTVIEW DR EDINA MN 55436 3311721310062 ROBERT H LUEDTKE 5825 EASTVIEW DR EDINA MN 55436 3311721310069 HUSSEIN W EGAL 5828 EASTVIEW DR EDINA MN 55436 3311721310061 JORDAN HESSENIUS & JEFFREY PANNING 5829 EASTVIEW DR EDINA MN 55436 3311721310060 RACHEL OWEN & SION OWEN 5833 EASTVIEW DR EDINA MN 55436 3311721240001 CITY OF EDINA 4801 50TH ST W EDINA MN 55424 3311721310034 JOANNA HJELMELAND HARTWELL & CHARLES HARTWELL 5101 GROVE ST EDINA MN 55436 3311721310035 BARBARA PELAK 5105 GROVE ST EDINA MN 55436 3311721310036 JOHN W OIEN & SHEILA A OIEN 5109 GROVE ST EDINA MN 55436 3311721240002 BRETT & THERESA HALVERSON 5110 GROVE ST EDINA MN 55436 3311721310037 MICHAEL W/JENNIFER E TRUMAN 5113 GROVE ST EDINA MN 55436 3311721310038 TODD & ANNEMARIE SCHILLING 5117 GROVE ST EDINA MN 55436 3311721310039 THOMAS P UNDERDAHL 5121 GROVE ST EDINA MN 55436 3311721240004 MICHAEL G MESSNER & KARI G MESSNER 5124 GROVE ST EDINA MN 55436 3311721230007 BRADLEY D RHOADES 5200 GROVE ST EDINA MN 55436 3311721320003 STEPHEN P & TERRI O MENKE 5201 GROVE ST EDINA MN 55436 3311721230002 JAMES M CRIST & JODIE HAGSTROM CRIST 5204 GROVE ST EDINA MN 55436 3311721320004 LARRY J MAY 5205 GROVE ST EDINA MN 55436 3311721320082 KARI KOUATLI 5209 GROVE ST EDINA MN 55436 3311721320032 RYAN S & HEATHER A LUND 5213 GROVE ST EDINA MN 55436 3211721410030 ELIZABETH HOPF 5800 HANSEN RD EDINA MN 55436 3311721320056 JAY R ADDY & KARIN E R ADDY 5801 HANSEN ROAD EDINA MN 55436 3211721410031 SCOTT A LEVIN 5804 HANSEN RD EDINA MN 55436 3311721320055 ROBERT & AUDREY ROGNESS 2508 LEE AVE N GOLDEN VALLEY MN 554212 3211721410032 BRADLEY C & JULIE A VANHOVE 5808 HANSEN RD EDINA MN 55436 3311721320054 MICHELLE KNOBEN & RANJI VARGHESE 5809 HANSEN RD EDINA MN 55436 3211721410068 ALEX ZHURAVEL & RITA ZHURAVEL 5812 HANSEN RD EDINA MN 55436 3311721320053 LUCAS HAAPAPURO 5813 HANSEN RD EDINA MN 55436 3211721410066 KEITH J VARGO/DAVID F PREIS 5816 HANSEN RD EDINA MN 55436 3311721320052 RONALD C & LINDA D LARSON 5817 HANSEN RD EDINA MN 55436 3311721320051 BENJAMIN E FOOTE 5821 HANSEN RD EDINA MN 55436 3211721410110 ERIC T WALKER & CLAIRE WALKER 5824 HANSEN RD EDINA MN 55436 3211721410038 JOHN JORAN & SHANNON JORAN 5900 HANSEN RD EDINA MN 55436 3211721410039 CITY OF EDINA 4801 W 50TH ST EDINA MN 55424 3211721410040 JEFFREY S FINZEN & KATHRYN A SLATER FINZEN 5908 HANSEN RD EDINA MN 55436 3311721320001 ALLAN ANDREWS 5909 HANSEN RD EDINA MN 55436 3211721410041 JOHN V NELSON/JEAN M NELSON 5912 HANSEN RD EDINA MN 55436 3311721320076 JONATHAN K NEWBURG 5913 HANSEN RD EDINA MN 55436 3211721410036 JOHN H WARD 5916 HANSEN RD EDINA MN 55436 3311721320077 STEVEN T & LINDA L POLLMANN 5917 HANSEN RD EDINA MN 55436 3211721410037 CAREY PROPERTIES LLC 5916 HANSEN RD MINNEAPOLIS MN 55436 3311721310078 NIPA PATEL 5900 JOSEPHINE AVE EDINA MN 55436 3311721310087 WILLIAM E & RALUCA V AVERY 5901 JOSEPHINE AVE EDINA MN 55436 3311721310079 PETER B HEIM & SARAH L D HEIM 5904 JOSEPHINE AVE EDINA MN 55436 3311721310086 DANIEL A KING & KRISTIN R KING 5905 JOSEPHINE AVE EDINA MN 55436 3311721310080 TOMMY S PHILL 5908 JOSEPHINE AVE EDINA MN 55436 3311721310085 STACEY M SOLAKIAN/SARKIS SOLAKIAN 5909 JOSEPHINE AVE EDINA MN 55436 3311721310082 CARTER BEBENSEE 5912 JOSEPHINE AVE EDINA MN 55436 3311721310084 SAMUEL P & BARBARA VERDUCI 5913 JOSEPHINE AVE EDINA MN 55436 3311721310091 HUGH J MEEKER JR & HANNAH MEEKER 5809 TINGDALE AVE EDINA MN 55436 3311721310090 MARY V & JAY A KOSTERS 5813 TINGDALE AVE EDINA MN 55436 3311721310030 CRAIG OLDAKOWSKI 5821 TINGDALE AVE EDINA MN 55436 3311721310031 MIGUEL E FIOL/ANGELA FIOL/ MIGUEL A FIOL 5825 TINGDALE AVE EDINA MN 55436 3311721310032 MICHAEL J CHAPURAN 5829 TINGDALE AVE EDINA MN 55436 3311721310011 LAWRENCE J BECKER & MICHELLE D SANDLER 5900 TINGDALE AVE EDINA MN 55436 3311721310024 THOMAS M & MARIE A LAFORCE 5901 TINGDALE AVE EDINA MN 55436 3311721310025 ROBERT C & DEBORAH J SMITH 5905 TINGDALE AVE S EDINA MN 55436 3311721310071 ERIC A ANDERSON & MELISSA N ANDERSON 5028 BENTON AVE EDINA MN 55436 March 19, 2021 MICHAEL W/JENNIFER E TRUMAN 5113 GROVE ST EDINA, MN 55436 RE: Public Hearing Notice for 5100 to 5113 Grove Street Melody Lake A & B, Birchcrest C and Grandview A Neighborhood Roadway Reconstruction Dear Resident: Staff has recently discovered that while the addresses of 5100 to 5113 Grove Street within the Melody Lake A & B, Birchcrest C and Grandview A Neighborhood Roadway Reconstruction Area received the legally required mailed notice of the public hearing conducted on December 7, 2020, your property was excluded from the list of properties to be assessed. The 5100 to 5113 Grove Street properties will be included in the area to be assessed the cost of the proposed improvement. Mailed notice was sent, on November 20th, to properties within the project area and a public hearing was conducted. Council did not decide about the preliminary assessments following that public hearing but instead ordered staff to bring back more information. Staff has 6 months to bring back more information to assist council in making a final decision about preliminary assessments and whether to authorize the project for 2021 construction. Please find this letter and notice as an invitation to provide public testimony in regard to the project. Staff already provided council with a lengthy presentation on the project on Dec. 7, 2020. Instead of repeating the presentation on the April 6, we would like to make you aware that you can view the recording and discussion of the public hearing at https://www.edinamn.gov/746/Watch-a-City-Meeting. Project specific information including the Preliminary Engineering Study can be found here: https://www.bettertogetheredina.org/melodybirchcrest. If you have any questions in regards to the project or the public hearing, feel free to reach out to me at 952.826.0318 or cmillner@EdinaMN.gov or Aaron Ditzler at 952.826.0443 or aditzler@EdinaMN.gov. Sincerely, Chad A. Millner, PE Director of Engineering City of Edina March 19, 2021 NOTICE OF PUBLIC HEARING ROADWAY IMPROVEMENTS PROPOSED IMPROVEMENT NO. BA-457 MELODY LAKE A & B, BIRCHCREST C AND GRANDVIEW A NEIGHBORHOOD ROADWAY RECONSTRUCTION The Edina City Council will meet virtually, on Tuesday, April 6, 2021, at 7:00 p.m., to consider the public hearing on roadway improvements for Melody Lake A & B, Birchcrest C and Grandview A Neighborhood Roadway Reconstruction. This hearing is being conducted under the authority granted by Minnesota Statutes, Chapter 429. This hearing has been called as a recommendation from staff. The proposed project would be constructed in the summer of 2021 with the assessment hearing occurring in the fall of 2022. The estimated cost is $7,214,575.00 and is funded by special assessment. The estimated cost per assessable lot is $24,200.00 per residential equivalent unit. The assessment can be divided over a fifteen-year period with interest accumulating on the unpaid balance. The area proposed to be assessed the cost of the proposed improvement includes the following: 5109 to 5313 West 56th Street, 5100 to 5121 West 58th Street, 5105 to 5125 West 59th Street, 5044, 5100, 5124, 5200, 5300 and 5324 West 60th Street, 5100, 5101, 5120, 5121, 5200, 5201, 5215, 5216, 5300 and 5325 Benton Avenue, 5600 to 5921 Bernard Place, 5600 to 5916 Code Avenue, 5600 to 5821 Dale Avenue, 5800 to 5833 Eastview Drive, 5100 to 5113 Grove Street, 5114 to 5213 Grove Street, 5405 to 5920 Hansen Road, 5900 to 5913 Josephine Avenue, 5712 to 5733 Melody Lane, 5604 to 5637 Melody Lake Drive, 5809 to 5905 Tingdale Avenue, 5300 to 5328 Windsor Avenue A public hearing was conducted on December 7, 2020 for all the listed properties except 5100 to 5113 Grove Street. The council delayed a decision on assessments for up to 6-months for staff to bring back more information. This public hearing is for the 5100 to 5113 Grove Street that were missed with the original public hearing notice and public hearing. Your receipt of this notice is an indication that property whose ownership is listed to you is among those properties which are considered to be benefited by the improvement. The City Council can authorize the proposed project immediately upon the close of the hearing. Staff’s recommendations to City Council are: • New 5-foot concrete sidewalk on the west side of Hansen Road and the south side of West 56th Street • Hansen Road reconstructed to 24-feet wide south of CP Railroad crossing • West 56th Street reconstructed to 24-feet wide; all other streets reconstructed to 27-feet wide • One-sided parking on the west side of Hansen Road south of the railroad tracks and on the south side of West 56th Street east of Dale Avenue. No parking on West 56th Street between Hansen Road and Dale Avenue • New concrete curb and gutter on all streets • New bituminous pavement on all streets. • Full replacement of underground watermain, water services, hydrants and valves • Construction of a new retaining wall along the west side of Hansen Road. • Spot repairs of the sanitary sewer main • Storm sewer improvements to resolve local drainages issues and installation of sump drains where feasible The Engineering Study will be available online as part of the April 6 City Council meeting agenda at http://bit.ly/2y3wCOo; under Meeting Type select City Council Meeting, click Search and you will see the April 6 Agenda. To comment, you may: • Write to City of Edina, Attention Engineering, 7450 Metro Boulevard, Edina, MN 55439. • Visit and comment www.BetterTogetherEdina.org/melodybirchcrest • Watch the virtual public hearing online or on Edina TV and call in to offer comments, leave a voicemail in advance or submit your comments online. Ways to participate are included in this mailing. How to Participate in a Public Hearing MEETING PROCEDURE: The Mayor of Edina has determined that an in-person meeting is not practical or prudent because of the COVD-19 health pandemic. Because of the health pandemic, it has been determined that physical presence at the regular meeting location by members of the public is not feasible. Because of the health pandemic, it has been determined that physical presence at the regular meeting location by at least one member of the body, chief legal counsel or chief administrative officer is not feasible. Therefore, the City Council will be participating in the meeting remotely. HOW TO PARTICIPATE: Public hearing input can be provided in a variety of ways to the City Council. Options 1 & 2 are available now: 1) Better Together Edina Website (www.BetterTogetherEdina.org/melodybirchcrest) 2) Voicemail (952-826-0377) Options 3 & 4 are available the night of the meeting: 3) Watch the meeting a. Edina TV (Comcast Channels 813 or 16) b. Facebook.com/EdinaMN c. EdinaMN.gov/LiveMeetings 4) Call in to provide live testimony at 1-800-374-0221. The conference ID number for the City Council meeting will be posted online closer to the public hearing date. FURTHER INFORMATION: City of Edina Engineering Department, 7450 Metro Boulevard, Edina, MN 55439, 952- 826-0371 English: This and other public hearing notices can be viewed online at EdinaMN.gov/PublicNotices. Spanish: Este y otros avisos de audiencia pública se pueden ver en línea en EdinaMN.gov/PublicNotices. Somali: Tan iyo ogeysiisyo kale oo dhagaysi dadweyne ayaa lagu daawan karaa onlayn ahaan EdinaMN.gov/PublicNotices. March 19, 2021 JOHN W OIEN & SHEILA A OIEN 5109 GROVE ST EDINA, MN 55436 RE: Public Hearing Notice for 5100 to 5113 Grove Street Melody Lake A & B, Birchcrest C and Grandview A Neighborhood Roadway Reconstruction Dear Resident: Staff has recently discovered that while the addresses of 5100 to 5113 Grove Street within the Melody Lake A & B, Birchcrest C and Grandview A Neighborhood Roadway Reconstruction Area received the legally required mailed notice of the public hearing conducted on December 7, 2020, your property was excluded from the list of properties to be assessed. The 5100 to 5113 Grove Street properties will be included in the area to be assessed the cost of the proposed improvement. Mailed notice was sent, on November 20th, to properties within the project area and a public hearing was conducted. Council did not decide about the preliminary assessments following that public hearing but instead ordered staff to bring back more information. Staff has 6 months to bring back more information to assist council in making a final decision about preliminary assessments and whether to authorize the project for 2021 construction. Please find this letter and notice as an invitation to provide public testimony in regard to the project. Staff already provided council with a lengthy presentation on the project on Dec. 7, 2020. Instead of repeating the presentation on the April 6, we would like to make you aware that you can view the recording and discussion of the public hearing at https://www.edinamn.gov/746/Watch-a-City-Meeting. Project specific information including the Preliminary Engineering Study can be found here: https://www.bettertogetheredina.org/melodybirchcrest. If you have any questions in regards to the project or the public hearing, feel free to reach out to me at 952.826.0318 or cmillner@EdinaMN.gov or Aaron Ditzler at 952.826.0443 or aditzler@EdinaMN.gov. Sincerely, Chad A. Millner, PE Director of Engineering City of Edina March 19, 2021 NOTICE OF PUBLIC HEARING ROADWAY IMPROVEMENTS PROPOSED IMPROVEMENT NO. BA-457 MELODY LAKE A & B, BIRCHCREST C AND GRANDVIEW A NEIGHBORHOOD ROADWAY RECONSTRUCTION The Edina City Council will meet virtually, on Tuesday, April 6, 2021, at 7:00 p.m., to consider the public hearing on roadway improvements for Melody Lake A & B, Birchcrest C and Grandview A Neighborhood Roadway Reconstruction. This hearing is being conducted under the authority granted by Minnesota Statutes, Chapter 429. This hearing has been called as a recommendation from staff. The proposed project would be constructed in the summer of 2021 with the assessment hearing occurring in the fall of 2022. The estimated cost is $7,214,575.00 and is funded by special assessment. The estimated cost per assessable lot is $24,200.00 per residential equivalent unit. The assessment can be divided over a fifteen-year period with interest accumulating on the unpaid balance. The area proposed to be assessed the cost of the proposed improvement includes the following: 5109 to 5313 West 56th Street, 5100 to 5121 West 58th Street, 5105 to 5125 West 59th Street, 5044, 5100, 5124, 5200, 5300 and 5324 West 60th Street, 5100, 5101, 5120, 5121, 5200, 5201, 5215, 5216, 5300 and 5325 Benton Avenue, 5600 to 5921 Bernard Place, 5600 to 5916 Code Avenue, 5600 to 5821 Dale Avenue, 5800 to 5833 Eastview Drive, 5100 to 5113 Grove Street, 5114 to 5213 Grove Street, 5405 to 5920 Hansen Road, 5900 to 5913 Josephine Avenue, 5712 to 5733 Melody Lane, 5604 to 5637 Melody Lake Drive, 5809 to 5905 Tingdale Avenue, 5300 to 5328 Windsor Avenue A public hearing was conducted on December 7, 2020 for all the listed properties except 5100 to 5113 Grove Street. The council delayed a decision on assessments for up to 6-months for staff to bring back more information. This public hearing is for the 5100 to 5113 Grove Street that were missed with the original public hearing notice and public hearing. Your receipt of this notice is an indication that property whose ownership is listed to you is among those properties which are considered to be benefited by the improvement. The City Council can authorize the proposed project immediately upon the close of the hearing. Staff’s recommendations to City Council are: • New 5-foot concrete sidewalk on the west side of Hansen Road and the south side of West 56th Street • Hansen Road reconstructed to 24-feet wide south of CP Railroad crossing • West 56th Street reconstructed to 24-feet wide; all other streets reconstructed to 27-feet wide • One-sided parking on the west side of Hansen Road south of the railroad tracks and on the south side of West 56th Street east of Dale Avenue. No parking on West 56th Street between Hansen Road and Dale Avenue • New concrete curb and gutter on all streets • New bituminous pavement on all streets. • Full replacement of underground watermain, water services, hydrants and valves • Construction of a new retaining wall along the west side of Hansen Road. • Spot repairs of the sanitary sewer main • Storm sewer improvements to resolve local drainages issues and installation of sump drains where feasible The Engineering Study will be available online as part of the April 6 City Council meeting agenda at http://bit.ly/2y3wCOo; under Meeting Type select City Council Meeting, click Search and you will see the April 6 Agenda. To comment, you may: • Write to City of Edina, Attention Engineering, 7450 Metro Boulevard, Edina, MN 55439. • Visit and comment www.BetterTogetherEdina.org/melodybirchcrest • Watch the virtual public hearing online or on Edina TV and call in to offer comments, leave a voicemail in advance or submit your comments online. Ways to participate are included in this mailing. How to Participate in a Public Hearing MEETING PROCEDURE: The Mayor of Edina has determined that an in-person meeting is not practical or prudent because of the COVD-19 health pandemic. Because of the health pandemic, it has been determined that physical presence at the regular meeting location by members of the public is not feasible. Because of the health pandemic, it has been determined that physical presence at the regular meeting location by at least one member of the body, chief legal counsel or chief administrative officer is not feasible. Therefore, the City Council will be participating in the meeting remotely. HOW TO PARTICIPATE: Public hearing input can be provided in a variety of ways to the City Council. Options 1 & 2 are available now: 1) Better Together Edina Website (www.BetterTogetherEdina.org/melodybirchcrest) 2) Voicemail (952-826-0377) Options 3 & 4 are available the night of the meeting: 3) Watch the meeting a. Edina TV (Comcast Channels 813 or 16) b. Facebook.com/EdinaMN c. EdinaMN.gov/LiveMeetings 4) Call in to provide live testimony at 1-800-374-0221. The conference ID number for the City Council meeting will be posted online closer to the public hearing date. FURTHER INFORMATION: City of Edina Engineering Department, 7450 Metro Boulevard, Edina, MN 55439, 952- 826-0371 English: This and other public hearing notices can be viewed online at EdinaMN.gov/PublicNotices. Spanish: Este y otros avisos de audiencia pública se pueden ver en línea en EdinaMN.gov/PublicNotices. Somali: Tan iyo ogeysiisyo kale oo dhagaysi dadweyne ayaa lagu daawan karaa onlayn ahaan EdinaMN.gov/PublicNotices. March 19, 2021 BARBARA PELAK 5105 GROVE ST EDINA, MN 55436 RE: Public Hearing Notice for 5100 to 5113 Grove Street Melody Lake A & B, Birchcrest C and Grandview A Neighborhood Roadway Reconstruction Dear Resident: Staff has recently discovered that while the addresses of 5100 to 5113 Grove Street within the Melody Lake A & B, Birchcrest C and Grandview A Neighborhood Roadway Reconstruction Area received the legally required mailed notice of the public hearing conducted on December 7, 2020, your property was excluded from the list of properties to be assessed. The 5100 to 5113 Grove Street properties will be included in the area to be assessed the cost of the proposed improvement. Mailed notice was sent, on November 20th, to properties within the project area and a public hearing was conducted. Council did not decide about the preliminary assessments following that public hearing but instead ordered staff to bring back more information. Staff has 6 months to bring back more information to assist council in making a final decision about preliminary assessments and whether to authorize the project for 2021 construction. Please find this letter and notice as an invitation to provide public testimony in regard to the project. Staff already provided council with a lengthy presentation on the project on Dec. 7, 2020. Instead of repeating the presentation on the April 6, we would like to make you aware that you can view the recording and discussion of the public hearing at https://www.edinamn.gov/746/Watch-a-City-Meeting. Project specific information including the Preliminary Engineering Study can be found here: https://www.bettertogetheredina.org/melodybirchcrest. If you have any questions in regards to the project or the public hearing, feel free to reach out to me at 952.826.0318 or cmillner@EdinaMN.gov or Aaron Ditzler at 952.826.0443 or aditzler@EdinaMN.gov. Sincerely, Chad A. Millner, PE Director of Engineering City of Edina March 19, 2021 NOTICE OF PUBLIC HEARING ROADWAY IMPROVEMENTS PROPOSED IMPROVEMENT NO. BA-457 MELODY LAKE A & B, BIRCHCREST C AND GRANDVIEW A NEIGHBORHOOD ROADWAY RECONSTRUCTION The Edina City Council will meet virtually, on Tuesday, April 6, 2021, at 7:00 p.m., to consider the public hearing on roadway improvements for Melody Lake A & B, Birchcrest C and Grandview A Neighborhood Roadway Reconstruction. This hearing is being conducted under the authority granted by Minnesota Statutes, Chapter 429. This hearing has been called as a recommendation from staff. The proposed project would be constructed in the summer of 2021 with the assessment hearing occurring in the fall of 2022. The estimated cost is $7,214,575.00 and is funded by special assessment. The estimated cost per assessable lot is $24,200.00 per residential equivalent unit. The assessment can be divided over a fifteen-year period with interest accumulating on the unpaid balance. The area proposed to be assessed the cost of the proposed improvement includes the following: 5109 to 5313 West 56th Street, 5100 to 5121 West 58th Street, 5105 to 5125 West 59th Street, 5044, 5100, 5124, 5200, 5300 and 5324 West 60th Street, 5100, 5101, 5120, 5121, 5200, 5201, 5215, 5216, 5300 and 5325 Benton Avenue, 5600 to 5921 Bernard Place, 5600 to 5916 Code Avenue, 5600 to 5821 Dale Avenue, 5800 to 5833 Eastview Drive, 5100 to 5113 Grove Street, 5114 to 5213 Grove Street, 5405 to 5920 Hansen Road, 5900 to 5913 Josephine Avenue, 5712 to 5733 Melody Lane, 5604 to 5637 Melody Lake Drive, 5809 to 5905 Tingdale Avenue, 5300 to 5328 Windsor Avenue A public hearing was conducted on December 7, 2020 for all the listed properties except 5100 to 5113 Grove Street. The council delayed a decision on assessments for up to 6-months for staff to bring back more information. This public hearing is for the 5100 to 5113 Grove Street that were missed with the original public hearing notice and public hearing. Your receipt of this notice is an indication that property whose ownership is listed to you is among those properties which are considered to be benefited by the improvement. The City Council can authorize the proposed project immediately upon the close of the hearing. Staff’s recommendations to City Council are: • New 5-foot concrete sidewalk on the west side of Hansen Road and the south side of West 56th Street • Hansen Road reconstructed to 24-feet wide south of CP Railroad crossing • West 56th Street reconstructed to 24-feet wide; all other streets reconstructed to 27-feet wide • One-sided parking on the west side of Hansen Road south of the railroad tracks and on the south side of West 56th Street east of Dale Avenue. No parking on West 56th Street between Hansen Road and Dale Avenue • New concrete curb and gutter on all streets • New bituminous pavement on all streets. • Full replacement of underground watermain, water services, hydrants and valves • Construction of a new retaining wall along the west side of Hansen Road. • Spot repairs of the sanitary sewer main • Storm sewer improvements to resolve local drainages issues and installation of sump drains where feasible The Engineering Study will be available online as part of the April 6 City Council meeting agenda at http://bit.ly/2y3wCOo; under Meeting Type select City Council Meeting, click Search and you will see the April 6 Agenda. To comment, you may: • Write to City of Edina, Attention Engineering, 7450 Metro Boulevard, Edina, MN 55439. • Visit and comment www.BetterTogetherEdina.org/melodybirchcrest • Watch the virtual public hearing online or on Edina TV and call in to offer comments, leave a voicemail in advance or submit your comments online. Ways to participate are included in this mailing. How to Participate in a Public Hearing MEETING PROCEDURE: The Mayor of Edina has determined that an in-person meeting is not practical or prudent because of the COVD-19 health pandemic. Because of the health pandemic, it has been determined that physical presence at the regular meeting location by members of the public is not feasible. Because of the health pandemic, it has been determined that physical presence at the regular meeting location by at least one member of the body, chief legal counsel or chief administrative officer is not feasible. Therefore, the City Council will be participating in the meeting remotely. HOW TO PARTICIPATE: Public hearing input can be provided in a variety of ways to the City Council. Options 1 & 2 are available now: 1) Better Together Edina Website (www.BetterTogetherEdina.org/melodybirchcrest) 2) Voicemail (952-826-0377) Options 3 & 4 are available the night of the meeting: 3) Watch the meeting a. Edina TV (Comcast Channels 813 or 16) b. Facebook.com/EdinaMN c. EdinaMN.gov/LiveMeetings 4) Call in to provide live testimony at 1-800-374-0221. The conference ID number for the City Council meeting will be posted online closer to the public hearing date. FURTHER INFORMATION: City of Edina Engineering Department, 7450 Metro Boulevard, Edina, MN 55439, 952- 826-0371 English: This and other public hearing notices can be viewed online at EdinaMN.gov/PublicNotices. Spanish: Este y otros avisos de audiencia pública se pueden ver en línea en EdinaMN.gov/PublicNotices. Somali: Tan iyo ogeysiisyo kale oo dhagaysi dadweyne ayaa lagu daawan karaa onlayn ahaan EdinaMN.gov/PublicNotices. March 19, 2021 J H HARTWELL & C HARTWELL 5101 GROVE ST EDINA, MN 55436 RE: Public Hearing Notice for 5100 to 5113 Grove Street Melody Lake A & B, Birchcrest C and Grandview A Neighborhood Roadway Reconstruction Dear Resident: Staff has recently discovered that while the addresses of 5100 to 5113 Grove Street within the Melody Lake A & B, Birchcrest C and Grandview A Neighborhood Roadway Reconstruction Area received the legally required mailed notice of the public hearing conducted on December 7, 2020, your property was excluded from the list of properties to be assessed. The 5100 to 5113 Grove Street properties will be included in the area to be assessed the cost of the proposed improvement. Mailed notice was sent, on November 20th, to properties within the project area and a public hearing was conducted. Council did not decide about the preliminary assessments following that public hearing but instead ordered staff to bring back more information. Staff has 6 months to bring back more information to assist council in making a final decision about preliminary assessments and whether to authorize the project for 2021 construction. Please find this letter and notice as an invitation to provide public testimony in regard to the project. Staff already provided council with a lengthy presentation on the project on Dec. 7, 2020. Instead of repeating the presentation on the April 6, we would like to make you aware that you can view the recording and discussion of the public hearing at https://www.edinamn.gov/746/Watch-a-City-Meeting. Project specific information including the Preliminary Engineering Study can be found here: https://www.bettertogetheredina.org/melodybirchcrest. If you have any questions in regards to the project or the public hearing, feel free to reach out to me at 952.826.0318 or cmillner@EdinaMN.gov or Aaron Ditzler at 952.826.0443 or aditzler@EdinaMN.gov. Sincerely, Chad A. Millner, PE Director of Engineering City of Edina March 19, 2021 NOTICE OF PUBLIC HEARING ROADWAY IMPROVEMENTS PROPOSED IMPROVEMENT NO. BA-457 MELODY LAKE A & B, BIRCHCREST C AND GRANDVIEW A NEIGHBORHOOD ROADWAY RECONSTRUCTION The Edina City Council will meet virtually, on Tuesday, April 6, 2021, at 7:00 p.m., to consider the public hearing on roadway improvements for Melody Lake A & B, Birchcrest C and Grandview A Neighborhood Roadway Reconstruction. This hearing is being conducted under the authority granted by Minnesota Statutes, Chapter 429. This hearing has been called as a recommendation from staff. The proposed project would be constructed in the summer of 2021 with the assessment hearing occurring in the fall of 2022. The estimated cost is $7,214,575.00 and is funded by special assessment. The estimated cost per assessable lot is $24,200.00 per residential equivalent unit. The assessment can be divided over a fifteen-year period with interest accumulating on the unpaid balance. The area proposed to be assessed the cost of the proposed improvement includes the following: 5109 to 5313 West 56th Street, 5100 to 5121 West 58th Street, 5105 to 5125 West 59th Street, 5044, 5100, 5124, 5200, 5300 and 5324 West 60th Street, 5100, 5101, 5120, 5121, 5200, 5201, 5215, 5216, 5300 and 5325 Benton Avenue, 5600 to 5921 Bernard Place, 5600 to 5916 Code Avenue, 5600 to 5821 Dale Avenue, 5800 to 5833 Eastview Drive, 5100 to 5113 Grove Street, 5114 to 5213 Grove Street, 5405 to 5920 Hansen Road, 5900 to 5913 Josephine Avenue, 5712 to 5733 Melody Lane, 5604 to 5637 Melody Lake Drive, 5809 to 5905 Tingdale Avenue, 5300 to 5328 Windsor Avenue A public hearing was conducted on December 7, 2020 for all the listed properties except 5100 to 5113 Grove Street. The council delayed a decision on assessments for up to 6-months for staff to bring back more information. This public hearing is for the 5100 to 5113 Grove Street that were missed with the original public hearing notice and public hearing. Your receipt of this notice is an indication that property whose ownership is listed to you is among those properties which are considered to be benefited by the improvement. The City Council can authorize the proposed project immediately upon the close of the hearing. Staff’s recommendations to City Council are: • New 5-foot concrete sidewalk on the west side of Hansen Road and the south side of West 56th Street • Hansen Road reconstructed to 24-feet wide south of CP Railroad crossing • West 56th Street reconstructed to 24-feet wide; all other streets reconstructed to 27-feet wide • One-sided parking on the west side of Hansen Road south of the railroad tracks and on the south side of West 56th Street east of Dale Avenue. No parking on West 56th Street between Hansen Road and Dale Avenue • New concrete curb and gutter on all streets • New bituminous pavement on all streets. • Full replacement of underground watermain, water services, hydrants and valves • Construction of a new retaining wall along the west side of Hansen Road. • Spot repairs of the sanitary sewer main • Storm sewer improvements to resolve local drainages issues and installation of sump drains where feasible The Engineering Study will be available online as part of the April 6 City Council meeting agenda at http://bit.ly/2y3wCOo; under Meeting Type select City Council Meeting, click Search and you will see the April 6 Agenda. To comment, you may: • Write to City of Edina, Attention Engineering, 7450 Metro Boulevard, Edina, MN 55439. • Visit and comment www.BetterTogetherEdina.org/melodybirchcrest • Watch the virtual public hearing online or on Edina TV and call in to offer comments, leave a voicemail in advance or submit your comments online. Ways to participate are included in this mailing. How to Participate in a Public Hearing MEETING PROCEDURE: The Mayor of Edina has determined that an in-person meeting is not practical or prudent because of the COVD-19 health pandemic. Because of the health pandemic, it has been determined that physical presence at the regular meeting location by members of the public is not feasible. Because of the health pandemic, it has been determined that physical presence at the regular meeting location by at least one member of the body, chief legal counsel or chief administrative officer is not feasible. Therefore, the City Council will be participating in the meeting remotely. HOW TO PARTICIPATE: Public hearing input can be provided in a variety of ways to the City Council. Options 1 & 2 are available now: 1) Better Together Edina Website (www.BetterTogetherEdina.org/melodybirchcrest) 2) Voicemail (952-826-0377) Options 3 & 4 are available the night of the meeting: 3) Watch the meeting a. Edina TV (Comcast Channels 813 or 16) b. Facebook.com/EdinaMN c. EdinaMN.gov/LiveMeetings 4) Call in to provide live testimony at 1-800-374-0221. The conference ID number for the City Council meeting will be posted online closer to the public hearing date. FURTHER INFORMATION: City of Edina Engineering Department, 7450 Metro Boulevard, Edina, MN 55439, 952- 826-0371 English: This and other public hearing notices can be viewed online at EdinaMN.gov/PublicNotices. Spanish: Este y otros avisos de audiencia pública se pueden ver en línea en EdinaMN.gov/PublicNotices. Somali: Tan iyo ogeysiisyo kale oo dhagaysi dadweyne ayaa lagu daawan karaa onlayn ahaan EdinaMN.gov/PublicNotices. March 19, 2021 CITY OF EDINA 4801 50TH ST W EDINA, MN 55424 RE: Public Hearing Notice for 5100 to 5113 Grove Street Melody Lake A & B, Birchcrest C and Grandview A Neighborhood Roadway Reconstruction Dear Resident: Staff has recently discovered that while the addresses of 5100 to 5113 Grove Street within the Melody Lake A & B, Birchcrest C and Grandview A Neighborhood Roadway Reconstruction Area received the legally required mailed notice of the public hearing conducted on December 7, 2020, your property was excluded from the list of properties to be assessed. The 5100 to 5113 Grove Street properties will be included in the area to be assessed the cost of the proposed improvement. Mailed notice was sent, on November 20th, to properties within the project area and a public hearing was conducted. Council did not decide about the preliminary assessments following that public hearing but instead ordered staff to bring back more information. Staff has 6 months to bring back more information to assist council in making a final decision about preliminary assessments and whether to authorize the project for 2021 construction. Please find this letter and notice as an invitation to provide public testimony in regard to the project. Staff already provided council with a lengthy presentation on the project on Dec. 7, 2020. Instead of repeating the presentation on the April 6, we would like to make you aware that you can view the recording and discussion of the public hearing at https://www.edinamn.gov/746/Watch-a-City-Meeting. Project specific information including the Preliminary Engineering Study can be found here: https://www.bettertogetheredina.org/melodybirchcrest. If you have any questions in regards to the project or the public hearing, feel free to reach out to me at 952.826.0318 or cmillner@EdinaMN.gov or Aaron Ditzler at 952.826.0443 or aditzler@EdinaMN.gov. Sincerely, Chad A. Millner, PE Director of Engineering City of Edina March 19, 2021 NOTICE OF PUBLIC HEARING ROADWAY IMPROVEMENTS PROPOSED IMPROVEMENT NO. BA-457 MELODY LAKE A & B, BIRCHCREST C AND GRANDVIEW A NEIGHBORHOOD ROADWAY RECONSTRUCTION The Edina City Council will meet virtually, on Tuesday, April 6, 2021, at 7:00 p.m., to consider the public hearing on roadway improvements for Melody Lake A & B, Birchcrest C and Grandview A Neighborhood Roadway Reconstruction. This hearing is being conducted under the authority granted by Minnesota Statutes, Chapter 429. This hearing has been called as a recommendation from staff. The proposed project would be constructed in the summer of 2021 with the assessment hearing occurring in the fall of 2022. The estimated cost is $7,214,575.00 and is funded by special assessment. The estimated cost per assessable lot is $24,200.00 per residential equivalent unit. The assessment can be divided over a fifteen-year period with interest accumulating on the unpaid balance. The area proposed to be assessed the cost of the proposed improvement includes the following: 5109 to 5313 West 56th Street, 5100 to 5121 West 58th Street, 5105 to 5125 West 59th Street, 5044, 5100, 5124, 5200, 5300 and 5324 West 60th Street, 5100, 5101, 5120, 5121, 5200, 5201, 5215, 5216, 5300 and 5325 Benton Avenue, 5600 to 5921 Bernard Place, 5600 to 5916 Code Avenue, 5600 to 5821 Dale Avenue, 5800 to 5833 Eastview Drive, 5100 to 5113 Grove Street, 5114 to 5213 Grove Street, 5405 to 5920 Hansen Road, 5900 to 5913 Josephine Avenue, 5712 to 5733 Melody Lane, 5604 to 5637 Melody Lake Drive, 5809 to 5905 Tingdale Avenue, 5300 to 5328 Windsor Avenue A public hearing was conducted on December 7, 2020 for all the listed properties except 5100 to 5113 Grove Street. The council delayed a decision on assessments for up to 6-months for staff to bring back more information. This public hearing is for the 5100 to 5113 Grove Street that were missed with the original public hearing notice and public hearing. Your receipt of this notice is an indication that property whose ownership is listed to you is among those properties which are considered to be benefited by the improvement. The City Council can authorize the proposed project immediately upon the close of the hearing. Staff’s recommendations to City Council are: • New 5-foot concrete sidewalk on the west side of Hansen Road and the south side of West 56th Street • Hansen Road reconstructed to 24-feet wide south of CP Railroad crossing • West 56th Street reconstructed to 24-feet wide; all other streets reconstructed to 27-feet wide • One-sided parking on the west side of Hansen Road south of the railroad tracks and on the south side of West 56th Street east of Dale Avenue. No parking on West 56th Street between Hansen Road and Dale Avenue • New concrete curb and gutter on all streets • New bituminous pavement on all streets. • Full replacement of underground watermain, water services, hydrants and valves • Construction of a new retaining wall along the west side of Hansen Road. • Spot repairs of the sanitary sewer main • Storm sewer improvements to resolve local drainages issues and installation of sump drains where feasible The Engineering Study will be available online as part of the April 6 City Council meeting agenda at http://bit.ly/2y3wCOo; under Meeting Type select City Council Meeting, click Search and you will see the April 6 Agenda. To comment, you may: • Write to City of Edina, Attention Engineering, 7450 Metro Boulevard, Edina, MN 55439. • Visit and comment www.BetterTogetherEdina.org/melodybirchcrest • Watch the virtual public hearing online or on Edina TV and call in to offer comments, leave a voicemail in advance or submit your comments online. Ways to participate are included in this mailing. How to Participate in a Public Hearing MEETING PROCEDURE: The Mayor of Edina has determined that an in-person meeting is not practical or prudent because of the COVD-19 health pandemic. Because of the health pandemic, it has been determined that physical presence at the regular meeting location by members of the public is not feasible. Because of the health pandemic, it has been determined that physical presence at the regular meeting location by at least one member of the body, chief legal counsel or chief administrative officer is not feasible. Therefore, the City Council will be participating in the meeting remotely. HOW TO PARTICIPATE: Public hearing input can be provided in a variety of ways to the City Council. Options 1 & 2 are available now: 1) Better Together Edina Website (www.BetterTogetherEdina.org/melodybirchcrest) 2) Voicemail (952-826-0377) Options 3 & 4 are available the night of the meeting: 3) Watch the meeting a. Edina TV (Comcast Channels 813 or 16) b. Facebook.com/EdinaMN c. EdinaMN.gov/LiveMeetings 4) Call in to provide live testimony at 1-800-374-0221. The conference ID number for the City Council meeting will be posted online closer to the public hearing date. FURTHER INFORMATION: City of Edina Engineering Department, 7450 Metro Boulevard, Edina, MN 55439, 952- 826-0371 English: This and other public hearing notices can be viewed online at EdinaMN.gov/PublicNotices. Spanish: Este y otros avisos de audiencia pública se pueden ver en línea en EdinaMN.gov/PublicNotices. Somali: Tan iyo ogeysiisyo kale oo dhagaysi dadweyne ayaa lagu daawan karaa onlayn ahaan EdinaMN.gov/PublicNotices. March 19, 2021 BRETT & THERESA HALVERSON 5110 GROVE ST EDINA, MN 55436 RE: Public Hearing Notice for 5100 to 5113 Grove Street Melody Lake A & B, Birchcrest C and Grandview A Neighborhood Roadway Reconstruction Dear Resident: Staff has recently discovered that while the addresses of 5100 to 5113 Grove Street within the Melody Lake A & B, Birchcrest C and Grandview A Neighborhood Roadway Reconstruction Area received the legally required mailed notice of the public hearing conducted on December 7, 2020, your property was excluded from the list of properties to be assessed. The 5100 to 5113 Grove Street properties will be included in the area to be assessed the cost of the proposed improvement. Mailed notice was sent, on November 20th, to properties within the project area and a public hearing was conducted. Council did not decide about the preliminary assessments following that public hearing but instead ordered staff to bring back more information. Staff has 6 months to bring back more information to assist council in making a final decision about preliminary assessments and whether to authorize the project for 2021 construction. Please find this letter and notice as an invitation to provide public testimony in regard to the project. Staff already provided council with a lengthy presentation on the project on Dec. 7, 2020. Instead of repeating the presentation on the April 6, we would like to make you aware that you can view the recording and discussion of the public hearing at https://www.edinamn.gov/746/Watch-a-City-Meeting. Project specific information including the Preliminary Engineering Study can be found here: https://www.bettertogetheredina.org/melodybirchcrest. If you have any questions in regards to the project or the public hearing, feel free to reach out to me at 952.826.0318 or cmillner@EdinaMN.gov or Aaron Ditzler at 952.826.0443 or aditzler@EdinaMN.gov. Sincerely, Chad A. Millner, PE Director of Engineering City of Edina March 19, 2021 NOTICE OF PUBLIC HEARING ROADWAY IMPROVEMENTS PROPOSED IMPROVEMENT NO. BA-457 MELODY LAKE A & B, BIRCHCREST C AND GRANDVIEW A NEIGHBORHOOD ROADWAY RECONSTRUCTION The Edina City Council will meet virtually, on Tuesday, April 6, 2021, at 7:00 p.m., to consider the public hearing on roadway improvements for Melody Lake A & B, Birchcrest C and Grandview A Neighborhood Roadway Reconstruction. This hearing is being conducted under the authority granted by Minnesota Statutes, Chapter 429. This hearing has been called as a recommendation from staff. The proposed project would be constructed in the summer of 2021 with the assessment hearing occurring in the fall of 2022. The estimated cost is $7,214,575.00 and is funded by special assessment. The estimated cost per assessable lot is $24,200.00 per residential equivalent unit. The assessment can be divided over a fifteen-year period with interest accumulating on the unpaid balance. The area proposed to be assessed the cost of the proposed improvement includes the following: 5109 to 5313 West 56th Street, 5100 to 5121 West 58th Street, 5105 to 5125 West 59th Street, 5044, 5100, 5124, 5200, 5300 and 5324 West 60th Street, 5100, 5101, 5120, 5121, 5200, 5201, 5215, 5216, 5300 and 5325 Benton Avenue, 5600 to 5921 Bernard Place, 5600 to 5916 Code Avenue, 5600 to 5821 Dale Avenue, 5800 to 5833 Eastview Drive, 5100 to 5113 Grove Street, 5114 to 5213 Grove Street, 5405 to 5920 Hansen Road, 5900 to 5913 Josephine Avenue, 5712 to 5733 Melody Lane, 5604 to 5637 Melody Lake Drive, 5809 to 5905 Tingdale Avenue, 5300 to 5328 Windsor Avenue A public hearing was conducted on December 7, 2020 for all the listed properties except 5100 to 5113 Grove Street. The council delayed a decision on assessments for up to 6-months for staff to bring back more information. This public hearing is for the 5100 to 5113 Grove Street that were missed with the original public hearing notice and public hearing. Your receipt of this notice is an indication that property whose ownership is listed to you is among those properties which are considered to be benefited by the improvement. The City Council can authorize the proposed project immediately upon the close of the hearing. Staff’s recommendations to City Council are: • New 5-foot concrete sidewalk on the west side of Hansen Road and the south side of West 56th Street • Hansen Road reconstructed to 24-feet wide south of CP Railroad crossing • West 56th Street reconstructed to 24-feet wide; all other streets reconstructed to 27-feet wide • One-sided parking on the west side of Hansen Road south of the railroad tracks and on the south side of West 56th Street east of Dale Avenue. No parking on West 56th Street between Hansen Road and Dale Avenue • New concrete curb and gutter on all streets • New bituminous pavement on all streets. • Full replacement of underground watermain, water services, hydrants and valves • Construction of a new retaining wall along the west side of Hansen Road. • Spot repairs of the sanitary sewer main • Storm sewer improvements to resolve local drainages issues and installation of sump drains where feasible The Engineering Study will be available online as part of the April 6 City Council meeting agenda at http://bit.ly/2y3wCOo; under Meeting Type select City Council Meeting, click Search and you will see the April 6 Agenda. To comment, you may: • Write to City of Edina, Attention Engineering, 7450 Metro Boulevard, Edina, MN 55439. • Visit and comment www.BetterTogetherEdina.org/melodybirchcrest • Watch the virtual public hearing online or on Edina TV and call in to offer comments, leave a voicemail in advance or submit your comments online. Ways to participate are included in this mailing. How to Participate in a Public Hearing MEETING PROCEDURE: The Mayor of Edina has determined that an in-person meeting is not practical or prudent because of the COVD-19 health pandemic. Because of the health pandemic, it has been determined that physical presence at the regular meeting location by members of the public is not feasible. Because of the health pandemic, it has been determined that physical presence at the regular meeting location by at least one member of the body, chief legal counsel or chief administrative officer is not feasible. Therefore, the City Council will be participating in the meeting remotely. HOW TO PARTICIPATE: Public hearing input can be provided in a variety of ways to the City Council. Options 1 & 2 are available now: 1) Better Together Edina Website (www.BetterTogetherEdina.org/melodybirchcrest) 2) Voicemail (952-826-0377) Options 3 & 4 are available the night of the meeting: 3) Watch the meeting a. Edina TV (Comcast Channels 813 or 16) b. Facebook.com/EdinaMN c. EdinaMN.gov/LiveMeetings 4) Call in to provide live testimony at 1-800-374-0221. The conference ID number for the City Council meeting will be posted online closer to the public hearing date. FURTHER INFORMATION: City of Edina Engineering Department, 7450 Metro Boulevard, Edina, MN 55439, 952- 826-0371 English: This and other public hearing notices can be viewed online at EdinaMN.gov/PublicNotices. Spanish: Este y otros avisos de audiencia pública se pueden ver en línea en EdinaMN.gov/PublicNotices. Somali: Tan iyo ogeysiisyo kale oo dhagaysi dadweyne ayaa lagu daawan karaa onlayn ahaan EdinaMN.gov/PublicNotices PID TAX_NAME TAX_ADD_L1 TAX_ADD_L2 3311721310037 MICHAEL W/JENNIFER E TRUMAN 5113 GROVE ST EDINA, MN 55436 3311721310036 JOHN W OIEN & SHEILA A OIEN 5109 GROVE ST EDINA, MN 55436 3311721310035 BARBARA PELAK 5105 GROVE ST EDINA, MN 55436 3311721310034 J H HARTWELL & C HARTWELL 5101 GROVE ST EDINA, MN 55436 3311721240001 CITY OF EDINA 4801 50TH ST W EDINA, MN 55424 3311721240002 BRETT & THERESA HALVERSON 5110 GROVE ST EDINA, MN 55436 The CITY ofEDINA Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Roadway Reconstruction BA-457 Resolution No. 2021-34 April 20, 2021 The CITY ofEDINAPublic Hearing Details •Dec. 7, 2020 Public Hearing •April 6, 2021 Public Hearing •Grove Street addresses •No additional comments www.EdinaMN.gov 2 The CITY ofEDINA www.EdinaMN.gov 3 •Project Cost Concerns •Sidewalks were decided •Creating Bid Documents and Receive Bids •Do not approve preliminary special assessment amounts •Staff brings back better costs and assessments with the bids •Per MN Statue 429: Allows council to continue improvement hearing for up to 6 months after the date of the initial hearing. Recall Recommendation The CITY ofEDINA www.EdinaMN.gov 4 •April 6, 2021 Revised Assessment Policy Removed Subcuts and Public Retaining Walls from Assessments •Preliminary Estimated Assessment Pre-Revision: $24,200 Post Revision with Bids: $17,200 w/ a 5% contingency Bid Results: $16,400 w/o contingency Assessment Update The CITY ofEDINAEstimated Roadway Assessments www.EdinaMN.gov 5 •297.54 REUs •-1 REU per single-family home •-0.5 REU for corner properties •$17,200 per REU The CITY ofEDINA www.EdinaMN.gov 6 •Staff believes this project is feasible, cost effective and necessary to improve the public infrastructure •Approve Resolution No. 2021-34 •Authorize Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Roadway Reconstruction •Set the preliminary / pending assessment at $17,200 per REU Recommendation The CITY ofEDINA Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Roadway Reconstruction BA-457 Resolution No. 2021-34 April 20, 2021 The CITY ofEDINAPublic Hearing Details •Dec. 7, 2020 Public Hearing •April 6, 2021 Public Hearing •Grove Street addresses •No additional comments www.EdinaMN.gov 2 The CITY ofEDINA www.EdinaMN.gov 3 •Project Cost Concerns •Sidewalks were decided •Creating Bid Documents and Receive Bids •Do not approve preliminary special assessment amounts •Staff brings back better costs and assessments with the bids •Per MN Statue 429: Allows council to continue improvement hearing for up to 6 months after the date of the initial hearing. Recall Recommendation The CITY ofEDINA www.EdinaMN.gov 4 •April 6, 2021 Revised Assessment Policy Removed Subcuts and Public Retaining Walls from Assessments •Preliminary Estimated Assessment Pre-Revision: $24,200 Post Revision with Bids: $17,200 w/ a 5% contingency Bid Results: $16,400 w/o contingency Assessment Update The CITY ofEDINAEstimated Roadway Assessments www.EdinaMN.gov 5 •297.54 REUs •-1 REU per single-family home •-0.5 REU for corner properties •$17,200 per REU The CITY ofEDINA www.EdinaMN.gov 6 •Staff believes this project is feasible, cost effective and necessary to improve the public infrastructure •Approve Resolution No. 2021-34 •Authorize Melody Lake A&B/Grandview A/Birchcrest C Neighborhood Roadway Reconstruction •Set the preliminary / pending assessment at $17,200 per REU Recommendation Date: April 20, 2021 Agenda Item #: VIII.C. To:Mayor and City Council Item Type: Request For Purchase From:Chad A. Millner, P.E., Director of Engineering Item Activity: Subject:Request for Purchase: Melody Lake A & B, Grandview A, Birchcrest C Neighborhood Roadway Reconstruction Project Action CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: Approve Request for Purchase for the Melody Lake A & B, Grandview A, Birchcrest C Neighborhood Roadway Reconstruction Project with Valley Paving, Inc. for $10,536,643. INTRODUCTION: See attached staff report and request for purchase form. ATTACHMENTS: Description Request for Purchase: Melody Lake A & B, Grandview A, Birchcrest C N'hood Roadway Reconstruction Project Staff Report: Melody Lake A & B, Grandview A, Birchcrest C N'hood Roadway Reconstruction Contract Request for Purchase Requisition Number 1 CITY OF EDINA 4801 W 50th St., Edina, MN 55424 www.EdinaMN.gov | 952-927-8861 12100081 Department: Engineering Buyer: Aaron Ditzler Date: 04/08/2021 Requisition Description: ENG 21-2 Melody AB, Grandview A, Birhcrest C Street Reconstruction Vendor: VALLEY PAVING INC Cost: $10,536,643.19 REPLACEMENT or NEW:REPLACEM - REPLACEMENT PURCHASE SOURCE:QUOTE/BD - QUOTE/BID DESCRIPTION: Contract ENG 21-2 Melody Lake A&B, Grandview A, Birchcrest C Street Reconstruction. The project involves reconstruction of local bituminous and concrete streets, replacement of existing concrete curb and gutter, installation of new concrete curb and gutter, construction of new concrete sidewalk and localized rehabilitation of the sanitary sewer, watermain and storm sewer systems in the neighborhood. The project includes Bernard Place, Code Avenue, Dale Avenue, Eastview Drive, Grove Street, Hansen Road, Josephine Avenue, Melody Lane, Melody Lake Drive, Tingdale Avenue, Windsor Avenue, West 56th Street, West 57th Street, West 58th Street and West 59th Street. It also includes a sidewalk along 56th Street from Code Avenue to Normandale Road. BUDGET IMPACT: The Project is funded by a combination of utility and PACS funds along with special assessments included in CIP Project Nos. 17-024, 17-026, 19-319, and 19-320. Cost Comparison Table (includes indirect costs for finance, engineering, administration, and contingency) CIP Project Cost Estimate $14,493,000Preliminary Engineering Report Project Cost Estimate $16,400,000 Low Bid Project Cost Estimate $12,910,000 Environmental Impact - item specific: 2 COMMUNITY IMPACT: This project will provide premier, long term core service facilities and provide access and mobility for all transportation modes while enhancing safety and convenience. It is necessary to improve the infrastructure, and comply with the City’s Living Streets Policy as well as Vision Edina’s mission statement to “provide effective and valued public services and maintain a sound public infrastructure”. ENVIRONMENTAL IMPACT: This project involves rehabilitation of the sanitary sewer, upgrades to the storm sewer, localized rehabilitation and full reconstruction of watermain systems, construction of new concrete curb and gutter and sidewalks, and complete reconstruction of bituminous pavement surfaces. Alternative construction methods utilized within the City include reclamation of existing bituminous surfaces to reuse aggregate base material, implementation of utility pipe rehabilitation through trenchless technologies thus reducing greenhouse gases associated with open cut installations. This project includes alternative storm sewer pipe materials (High Density Poly Ethylene (HDPE) and High- Density Poly Propylene (HDPP) vs. reinforced concrete). It addresses multiple facets of sustainability by being more cost effective, more environmentally friendly by being recyclable and using recyclable products in its manufacturing while lowering our carbon footprint from manufacturing processes, transportation and installation of the product. This project will reduce impervious surfaces. Vehicle - Make/Model/Year requested vehicle: Vehicle - Make/Model/Year current vehicle (if replacement): Vehicle - Does purchase meet Green Fleet Recommendations? - Vehicle - If does not meet Green Fleet Recommendations, justification: - MPG: Carbon Emissions: April 20, 2021 Mayor and City Council Chad A. Millner, P.E. Director of Engineering Adopt Resolution No. 2021-34: Melody Lake A & B, Grandview A, Birchcrest C Neighborhood Roadway Reconstruction Improvement No. BA-457 Executive Summary: Adopt Resolution No. 2021-34 and approve preliminary assessment of $17,200 per REU based on the assessment policy dated April 6, 2021 and bids received on March 25, 2021 for the referenced project. Information / Background Recall a public hearing was conducted on Dec. 7, 2020 and April 6, 2021 for the referenced project. The estimated assessment amount per REU was estimated at $24,200 per REU. There were concerns with the amount of the assessment. As the same time, the street funding task force was completing their work related to street reconstruction funding. As allowed by state statue, the council delayed a final decision on the preliminary assessment amount per REU for up to 6-months for staff to bring back more information. The street funding task force completed a street funding recommendation report and presented those findings to the council on March 2, 2021. The council considered those recommendations during a council retreat on March 13 and at a City Council Meeting on April 6. At the April 6 meeting, the City Council approved step one of the street funding task force recommendations. The revised assessment policy removed subcuts and public retaining walls from assessments related to the 2021 Street Reconstruction Projects. A decision on the preliminary assessments was delayed for up to 6-months for staff to being back more information. Staff completed the bidding documents and accepted bids. Seven bids were received as listed below. The engineers construction cost estimate was $12,200,000. STAFF REPORT Page 2 Company Amount of Bid Valley Paving, Inc. $10,536,643.19 Bituminous Roadways, Inc. $11,307,043,54 GMH Asphalt Corporation $11,331,323.75 McNamara Contracting $11,832,821.01 Park Construction Company $11,900,886.16 Geislinger & Sons $12,479,552.40 Meter Contracting, Inc. $13,301,674.56 Cost Comparison Table (includes indirect costs for finance, engineering, administration, and contingency) CIP Project Cost Estimate Preliminary Engineering Report Project Cost Estimate Low Bid Project Cost Estimate $14,493,000 $16,400,000 $12,910,000 With the changes to the assessment policy dated April 6, 2021 that removed subcuts and public retaining walls, the preliminary assessment with a 5% contingency is $17,200 per REU. Without a contingency the estimated assessment is $16,400 per REU. Staff recommends adoption of Resolution No. 2021-34 and approve preliminary assessment of $17,200 per REU based on the assessment policy dated April 6, 2021 and bids received on March 25, 2021 for the referenced project. Staff will manage the project in the hope to lower the assessment amount as close to $16,400 per REU. 1 1/2015 CONTRACT NO. ENG 21-2 THIS AGREEMENT made this 20th day of April, 2021, by and between the CITY OF EDINA, a Minnesota municipal corporation (“City”) and Valley Paving Inc, 8800 13th Ave NE, Shakopee, MN 55379 (“Contractor”). City and Contractor, in consideration of the mutual covenants set forth herein, agree as follows: 1. CONTRACT DOCUMENTS. The following documents shall be referred to as the “Contract Documents,” all of which shall be taken together as a whole as the contract between the parties as if they were set verbatim and in full herein: A. This Agreement. B. Instructions to Bidders. C. City of Edina General Contract Conditions. D. Addenda number 1 & 2. E. Specifications prepared by Aaron T Ditzler, P.E., dated March 10, 2021. F. Plan sheets numbered 1 to 114. G. Performance Bond. H. Payment Bond. I. Responsible Contractor Verification of Compliance J. Contractor’s Bid dated March 25, 2021. The Contract Documents are to be read and interpreted as a whole. The intent of the Contract Documents is to include all items necessary for the proper execution and completion of the Work and to require Contractor to provide the highest quality and greatest quantity consistent with the Contract Documents. If there are inconsistencies within or among part of the Contract Documents or between the Contract Documents and applicable standards, codes or ordinances, the Contractor shall provide the better quality or greater quantity of Work or comply with the more stringent requirements. 1.1 Before ordering any materials or doing any Work, the Contractor shall verify measurements at the Project site and shall be responsible for the correctness of such measurements. No extra charges or compensation will be allowed on account of differences between actual dimensions and the dimensions indicated on the Drawings. Any difference that may be found shall be submitted to the City for resolution before proceeding with the Work. 1.2 If a minor change in the Work is necessary due to actual field conditions, the Contractor shall submit detailed drawings of such departure to the City for approval before making the change. The City shall not be required to make any adjustment to either the Contract Sum or Contract Time because of any failure by the Contractor to comply with the requirements of this paragraph. Actual or alleged conflicts or inconsistencies between the Plans and Specifications or other Contract Documents shall be brought to the City’s attention in writing, prior to performing the affected Work. The City’s directions shall be followed by the Contractor. 2. OBLIGATIONS OF THE CONTRACTOR. The Contractor shall provide the goods, services, and perform the work in accordance with the Contract Documents. 3. OBLIGATIONS OF THE CITY. The City agrees to pay and the Contractor agrees to receive and accept payment in accordance with the Contractor’s bid $10,536,643.19. 2 1/2015 4. PAYMENT PROCEDURES. A. Contractor shall submit Applications for Payment. Applications for Payment will be processed by City as provided in the General Conditions. B. Progress Payments; Retainage. City shall make 95% progress payments on account of the Contract Price on the basis of Contractor’s Applications for Payment during performance of the Work. C. Payments to Subcontractor. (1) Prompt Payment to Subcontractors. Pursuant to Minn. Stat. § 471.25, Subd. 4a, the Contractor must pay any subcontractor within ten (10) days of the Contractor’s receipt of payment from the City for undisputed services provided by the subcontractor. The Contractor must pay interest of 1½ percent per month or any part of a month to the subcontractor on any undisputed amount not paid on time to the subcontractor. The minimum monthly interest penalty payment for an unpaid balance of $100.00 or more is $10.00. For an unpaid balance of less than $100.00, the Contractor shall pay the actual penalty due to the subcontractor. (2) Form IC-134 required from general contractor. Minn. Stat. § 290.92 requires that the City of Edina obtain a Withholding Affidavit for Contractors, Form IC-134, before making final payments to Contractors. This form needs to be submitted by the Contractor to the Minnesota Department of Revenue for approval. The form is used to receive certification from the state that the vendor has complied with the requirement to withhold and remit state withholding taxes for employee salaries paid. D. Final Payment. Upon final completion of the Work, City shall pay the remainder of the Contract Price as recommended by City. 5. COMPLETION DATE. The Work must be completed and ready for final payment by November 12, 2021. 6. CONTRACTOR’S REPRESENTATIONS. A. Contractor has examined and carefully studied the Contract Documents and other related data identified in the Contract Documents. B. Contractor has visited the Site and become familiar with and is satisfied as to the general, local, and Site conditions that may affect cost, progress, and performance of the Work. C. Contractor is familiar with and is satisfied as to all federal, state, and local Laws and Regulations that may affect cost, progress, and performance of the Work. D. Contractor has carefully studied all: (1) reports of explorations and tests of subsurface conditions at or contiguous to the Site and all drawings of physical conditions in or relating to existing surface or subsurface structures at or contiguous to the Site (except Underground Facilities) which have been identified in the General Conditions; and (2) reports and drawings of a Hazardous Environmental Condition, if any, at the Site. E. Contractor has obtained and carefully studied (or assumes responsibility for doing so) all additional or supplementary examinations, investigations, explorations, tests, studies, and data concerning conditions (surface, subsurface, and underground facilities) at or contiguous to the Site which may affect cost, progress, or performance of the Work or which relate to any aspect of the means, methods, techniques, 3 1/2015 sequences, and procedures of construction to be employed by Contractor, including any specific means, methods, techniques, sequences, and procedures of construction expressly required by the Bidding Documents, and safety precautions and programs incident thereto. F. Contractor does not consider that any further examinations, investigations, explorations, tests, studies, or data are necessary for the performance of the Work at the Contract Price, within the Contract Times, and in accordance with the other terms and conditions of the Contract Documents. G. Contractor is aware of the general nature of work to be performed by City and others at the Site that relates to the Work as indicated in the Contract Documents. H. Contractor has correlated the information known to Contractor, information and observations obtained from visits to the Site, reports and drawings identified in the Contract Documents, and all additional examinations, investigations, explorations, tests, studies, and data with the Contract Documents. I. Contractor has given City written notice of all conflicts, errors, ambiguities, or discrepancies that Contractor has discovered in the Contract Documents, and the written resolution thereof by City is acceptable to Contractor. J. The Contract Documents are generally sufficient to indicate and convey understanding of all terms and conditions for performance and furnishing of the Work. K. Subcontracts: (1) Unless otherwise specified in the Contract Documents, the Contractor shall, upon receipt of the executed Contract Documents, submit in writing to the City the names of the subcontractors proposed for the work. Subcontractors may not be changed except at the request or with the consent of the City. (2) The Contractor is responsible to the City for the acts and omissions of the Contractor's subcontractors, and of their direct and indirect employees, to the same extent as the Contractor is responsible for the acts and omissions of the Contractor's employees. (3) The Contract Documents shall not be construed as creating any contractual relation between the City and any subcontractor. (4) The Contractor shall bind every subcontractor by the terms of the Contract Documents. 7. WARRANTY. The Contractor guarantees that all new equipment warranties as specified within the bid shall be in full force and transferred to the City upon payment by the City. The Contractor shall be held responsible for any and all defects in workmanship, materials, and equipment which may develop in any part of the contracted service, and upon proper notification by the City shall immediately replace, without cost to the City, any such faulty part or parts and damage done by reason of the same in accordance with the bid specifications. 8. INDEMNITY. The Contractor agrees to indemnify and hold the City harmless from any claim made by third parties as a result of the services performed by it. In addition, the Contractor shall reimburse the City for any cost of reasonable attorney’s fees it may incur as a result of any such claims. 9. MISCELLANEOUS. A. Terms used in this Agreement have the meanings stated in the General Conditions. B. City and Contractor each binds itself, its partners, successors, assigns and legal representatives to the other party hereto, its partners, successors, assigns and legal representatives in respect to all covenants, agreements, and obligations contained in the Contract Documents. C. Any provision or part of the Contract Documents held to be void or unenforceable under any Law or Regulation shall be deemed stricken, and all remaining provisions shall continue to be valid and binding upon City and Contractor, who agree that the Contract Documents shall be reformed to replace such 4 1/2015 stricken provision or part thereof with a valid and enforceable provision that comes as close as possible to expressing the intention of the stricken provisions. D. Data Practices/Records. (1) All data created, collected, received, maintained or disseminated for any purpose in the course of this Contract is governed by the Minnesota Government Data Practices Act, Minn. Stat. Ch. 13, any other applicable state statute, or any state rules adopted to implement the act, as well as federal regulations on data privacy. (2) All books, records, documents and accounting procedures and practices to the Contractor and its subcontractors, if any, relative to this Contract are subject to examination by the City. E. Copyright/Patent. Contractor shall defend actions or claims charging infringement of any copyright or patent by reason of the use or adoption of any designs, drawings or specifications supplied by it, and it shall hold harmless the City from loss or damage resulting there from. If the equipment provided by the Contractor pursuant to this Agreement contains software, including that which the manufacturer may have embedded into the hardware as an integral part of the equipment, the Contractor shall pay all software licensing fees. The Contractor shall also pay for all software updating fees for a period of one year following cutover. The Contractor shall have no obligation to pay for such fees thereafter. Nothing in the software license or licensing agreement shall obligate the City to pay any additional fees as a condition for continuing to use the software. F. Assignment. Neither party may assign, sublet, or transfer any interest or obligation in this Agreement without the prior written consent of the other party, and then only upon such terms and conditions as both parties may agree to and set forth in writing. G. Waiver. In the particular event that either party shall at any time or times waive any breach of this Agreement by the other, such waiver shall not constitute a waiver of any other or any succeeding breach of this Agreement by either party, whether of the same or any other covenant, condition or obligation. H. Governing Law/Venue. The laws of the State of Minnesota govern the interpretation of this Agreement. In the event of litigation, the exclusive venue shall be in the District Court of the State of Minnesota for Hennepin County. I. Severability. If any provision, term or condition of this Agreement is found to be or becomes unenforceable or invalid, it shall not affect the remaining provisions, terms and conditions of this Agreement, unless such invalid or unenforceable provision, term or condition renders this Agreement impossible to perform. Such remaining terms and conditions of the Agreement shall continue in full force and effect and shall continue to operate as the parties’ entire agreement. J. Entire Agreement. This Agreement represents the entire agreement of the parties and is a final, complete and all inclusive statement of the terms thereof, and supersedes and terminates any prior agreement(s), understandings or written or verbal representations made between the parties with respect thereto. K. Permits and Licenses; Rights-of-Way and Easements. The Contractor shall procure all permits and licenses, pay all charges and fees therefore, and give all notices necessary and incidental to the construction and completion of the Project. The City will obtain all necessary rights-of-way and easements. The Contractor shall not be entitled to any additional compensation for any construction delay resulting from the City’s not timely obtaining rights-of-way or easements. L. If the work is delayed or the sequencing of work is altered because of the action or inaction of the City, the Contractor shall be allowed a time extension to complete the work but shall not be entitled to any other compensation. c....Z.4..,-. rent A. Carron, President M. Responsible Contractor. This contract may be terminated by the City at any time upon discovery by the City that the prime contractor or subcontractor has submitted a false statement under oath verifying compliance with any of the minimum criteria set forth in Minn Stat. § 16C.285, subd. 3. CITY OF EDINA CONTRACTOR BY: BY: Its Mayor AND AND Its City Manager Its 5 1/2015 Date: April 20, 2021 Agenda Item #: VIII.D. To:Mayor and City Council Item Type: Request For Purchase From:Chad A. Millner, P.E., Director of Engineering Item Activity: Subject:Request for Purchase: Construction Observation Assistance Action CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: Approve Request for Purchase for Construction Observation Assistance with Short Elliot Hendrickson for $117,895. INTRODUCTION: With recent staff turnovers and the size of the street reconstruction projects in 2021, staff needs assistance to monitor the construction. T his contract ensure less experienced staff increase their understanding of street reconstruction inspection and that the projects are constructed to Edina standards. The construction inspector assigned to these projects has recently worked on the Vernon Avenue and Interlachen Boulevard Intersection & York Avenue Sanitary Sewer Projects. ATTACHMENTS: Description Request for Purchase: Construction Observation Assistance Letter of Agreement Request for Purchase Requisition Number 1 CITY OF EDINA 4801 W 50th St., Edina, MN 55424 www.EdinaMN.gov | 952-927-8861 12100080 Department:Engineering Buyer:Chad Millner Date: 04/06/2021 Requisition Description:Construction Observation Assistance Vendor:SHORT-ELLIOT-HENDRICKSON INCORPORATED Cost:$117,895.00 REPLACEMENT or NEW:- PURCHASE SOURCE:SERVIC K - SERVICE CONTRACT DESCRIPTION: With recent staff turnovers and the size of the street reconstruction projects in 2021, staff needs assistance to monitor the construction. This contract ensures less experienced staff increase their understanding of street reconstruction inspection and that the projects are constructed to Edina standards. The construction inspector assigned to these projects has recently worked on the Vernon Avenue and Interlachen Boulevard Intersection & York Avenue Sanitary Sewer Projects. BUDGET IMPACT: The Project is funded by a combination of utility and PACS funds along with special assessments included in CIP Project Nos. 17-024, 17-026, 19-319, and 19-320. Environmental Impact - item specific: 2 COMMUNITY IMPACT: This project will provide premier, long term core service facilities and provide access and mobility for all transportation modes while enhancing safety and convenience. It is necessary to improve the infrastructure, and comply with the City’s Living Streets Policy as well as Vision Edina’s mission statement to “provide effective and valued public services and maintain a sound public infrastructure”. Vehicle - Make/Model/Year requested vehicle: Vehicle - Make/Model/Year current vehicle (if replacement): Vehicle - Does purchase meet Green Fleet Recommendations? - Vehicle - If does not meet Green Fleet Recommendations, justification: - MPG: Carbon Emissions: Engineers | Architects | Planners | Scientists Short Elliott Hendrickson Inc., 10901 Red Circle Drive, Suite 300, Minnetonka, MN 55343-9302 SEH is 100% employee-owned | sehinc.com | 952.912.2600 | 800.734.6757 | 888.908.8166 fax SUPPLEMENTAL LETTER AGREEMENT April 6, 2021 RE: City of Edina Melody Lake and Creek Knoll Construction Observation Assistance SEH No. EDINA160103 10.00 Mr. Chad Millner, PE Director of Engineering City of Edina Engineering and Public Works Facility 7450 Metro Boulevard Edina, MN 55439 Dear Chad: Short Elliott Hendrickson Inc. (SEH®) appreciates the opportunity to submit the attached proposal for construction observation services relative to the referenced project. If accepted, this supplemental letter agreement describes how we will provide these services for a not-to-exceed fee of $117,895.00. This amount is detailed in the attached Task Hour Budget (THB) and includes our reimbursable expenses. We will bill the City monthly for reimbursable expenses and on an hourly basis for labor. We will provide these services in accordance with our Agreement for Professional Engineering Services dated June 4, 2013, herein called the Agreement. We will provide construction observation services to support the City’s Melody Lake and Creek Knoll neighborhood reconstruction projects. It is understood that construction is anticipated to begin by May 4 at the latest and be complete by November 12. Below is a list of our assumptions. · Construction observation services at 25 hours/week for 29 weeks at Melody Lake · Construction observation services at 5 hours/week for 29 weeks at Creek Knoll · City will contract with a materials testing subconsultant separately. City staff will coordinate the testing schedule · City will handle all construction administration including pay applications, shop drawing/submittal reviews, and agendas/minutes for weekly construction meetings. SEH staff will coordinate quantities with City staff for inclusion in pay applications and will attend weekly construction meetings. · City will handle the majority of communications with residents · All construction staking will be completed by City staff This Supplemental Letter Agreement, THB, and the Agreement represent the entire understanding between the City of Edina and SEH in respect to the project and may only be modified in writing if signed by both parties. Mr. Chad Millner, PE April 6, 2021 Page 2 We look forward to working with you and your staff on this project. Please contact me at 319.450.8732 or wbauer@sehinc with questions regarding this proposal. Sincerely, SHORT ELLIOTT HENDRICKSON INC. William Bauer, PE Project Manager Enclosures x:\ae\e\edina\160103\1-genl\10-setup-cont\03-proposal\sla ltr melody lake rpr fnl.docx Accepted on this ___day of________________, 2021 City of Edina, Minnesota By: _________________________________ Name _________________________________ Title PM RPR Reimbursable Expenses Total 1.1 725 725 145 145 4 4 4 870 N/A 874 $629.20 $109,452.53 $0.00 $110,081.73 4 870 N/A 874 $629.20 $109,452.53 $7,813.27 $117,895.00 4 870 N/A 874 $629.20 $109,452.53 $7,813.27 $117,895.00 4 870 N/A 874 $629.20 $109,452.53 $7,813.27 $117,895.00 Task Hours Summary Task Fee Summary Project Hours Summary Project Fee Summary Project Summary Task #1 - Construction Observation Construction Observation Construction Observation - Creek Knoll Subtotal Hours Subtotal Fees Project Management Construction Observation - Melody Lake Client: City of Edina Project Name: Melody Lake and Creek Knoll Construction Observation Assistance SEH Project #160103 Date: April 6, 2021 Billing Title Task #1 - Construction Observation Task Hours Summary Task Fee Summary Page 1 of 1 Date: April 20, 2021 Agenda Item #: VIII.E. To:Mayor and City Council Item Type: Request For Purchase From:Ross Bintner P.E., Engineering Services Manager Item Activity: Subject:Request for Purchase: Engineering Services for Morningside Flood Infrastructure Project Action CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: 1. Approve strategy, design goals, considerations and opportunities detailed in the staff report. 2. Approve budget modification to CIP Project No. 19-341 (attached) to include estimated design professional services costs in 2021 of $1.4M, construction professional services in 2022 of $0.6M, capital expenses of $9.5M in 2022, and $0.5M in 2023 3. Approve Request for Purchase for Engineering Services for Morningside Flood Infrastructure P roject with Barr Engineering for $1,204,000. 4. Approve Public P articipation Plan to inform the public and project about park landscape aesthetics choices. INTRODUCTION: See attached documentation for details. ATTACHMENTS: Description Request for Purchase: Engineering Services for Morningside Flood Infrastructure Staff Report: Engineering Services for Morningside Flood Infrastructure Revised CIP Project No. 19-341 Public Participation Plan Technical Memo Engagement Report Letter of Agreement Staff Presentation Request for Purchase Requisition Number 1 CITY OF EDINA 4801 W 50th St., Edina, MN 55424 www.EdinaMN.gov | 952-927-8861 12100085 Department: Engineering Buyer: Date: 04/13/2021 Requisition Description: Engineering Services for Morningside Flood Infrastructure Project Vendor: BARR ENGINEERING CO Cost: $1,204,000.00 REPLACEMENT or NEW:REPLACEM - REPLACEMENT PURCHASE SOURCE:SERVIC K - SERVICE CONTRACT DESCRIPTION: Engineering services related to Morningside Flood Instructure Project The staff and design team recommend creating infrastructure consistent with the “Bigger” option, with the following features to include in design 1. An expanded and lowered Weber Pond 2. An expanded and lower Lynn/Kipling inundation area 3. An expanded pipe and swale to provide overflow from the Lynn/Kipling inundation area 4. An expanded and reconfigured pipe network extending west on 42nd, south on Crocker, east on Morningside Road, south on Grimes, and west on Branson minor grade changes on Grimes and Crocker BUDGET IMPACT: Funded from modified CIP No. 19-341 Modify Capital Improvement Plan item 19-341to include estimated design professional services costs in 2021 of $1.4M, construction professional services in 2022 of $0.5M, capital expenses of $9.5M in 2022, and $0.5M in 2023, totaling $10M in capital and $2M in professional services, in addition to the $0.25M previously allocated to engagement and concept design work. Environmental Impact - item specific: 2 COMMUNITY IMPACT: The design team sees the potential for significant flood reduction in even large events, at the “Bigger” option. While flooding on private properties and risk to homes is not eliminated, it is significantly reduced. Some areas, particularly landlocked areas have more modest benefits as the design proposes to eliminate or reduce the potential to overflow into those areas. ENVIRONMENTAL IMPACT: Creation and modification of infrastructure uses natural resources to construct, maintain and operate. There are trade-offs between reducing flood risk to properties and the necessary power to operate equipment to provide the service. Sustainability goals will be considered in the final design. Landscaping of the disturbed areas will provide many opportunities to remove invasive species and establish natural plantings that can better thrive with today's climate. Vehicle - Make/Model/Year requested vehicle: Vehicle - Make/Model/Year current vehicle (if replacement): Vehicle - Does purchase meet Green Fleet Recommendations? - Vehicle - If does not meet Green Fleet Recommendations, justification: - MPG: Carbon Emissions: April 20, 2021 Mayor and City Council Ross Bintner, P.E., Engineering Services Manager Jessica Wilson, Water Resources Coordinator Request for Purchase: Engineering Services for Morningside Flood Infrastructure Project Information / Background: This recommendation was provided in draft at the City Council work session March 16. Sections 1-4 remain unchanged, and Section 5 has been updated to reflect next steps consistent with Council input. The purpose of this report is to end the concept design phase of the Morningside Flood Infrastructure Project and move forward by setting project goals, requirements, and resources for project design and construction, approving a scope of service for design, and approving a plan for public input of park features. The proposed council action is spelled out in section 5. The report includes the following sections and topics: • In Section 1, the report provides background and context from the 2018 Comprehensive Water Resources Management Plan (CWRMP) update, the Flood Risk Reduction Strategy, the timeline for creation of new infrastructure in the Morningside neighborhood, and previews the challenge of flooding and meeting the challenges of flooding. • In Section 2, the report provides information about how we engaged the public and used public input to inform the concept design and a framework for the concept design and engineering process that tested scenarios and developed and refined options. • In Section 3, the report provides detail on the scenarios, lessons learned, and how they informed the design. • In Section 4, the report details the options at three levels of effort and decision criteria that were used to explore the scale and relative value of the varying features of the options. • In Section 5, the report provides context on the development of a preferred option, a staff recommendation and next steps. STAFF REPORT Page 2 Section 1: Background and Context Flooding in Edina is not only common, but also increasing. The City of Edina uses its Flood Risk Reduction Strategy to understand and address this issue. Flood risk is defined by climate, exposure, and vulnerability. These factors vary with time, and across the landscape, assets, and people that characterize the community. Weather patterns and climate trends. Rainfall varies over time, landscapes, and elevation. Soils and the natural shape of the land also define runoff. The degree to which property, homes, buildings, infrastructure and other assets come into contact with flood water. The degree to which exposed assets, both public and private, are unable to resist flooding and are damaged by floods. The metric we use to measure flood risk is the exposure and vulnerability to principal, habitable structures. Structural flood risk can occur through over land flooding, groundwater seepage, and sanitary backflow. Over the land surface Groundwater seepage Sanitary backflow The primary and secondary drivers are climate change and aging infrastructure. Well-drained landscapes and imperviousness also matter but are more historical drivers of flood risk. STAFF REPORT Page 3 Climate change is making storms more intense and increasing the chance of extended wet periods or drought. Climate change has already and will expose more assets to flooding in the future. This driver is predicted to overwhelm the other drivers in terms of scale. Private and public assets and infrastructure are both exposed and vulnerable. Public infrastructure can define flood exposure for different points in the landscape and serve as a pathway for private risk. Public infrastructure assets are old and not capable of meeting the current demand. This is a significant driver as infrastructure provides most stormwater service. Development has connected the landscape to the water to make land well- drained. While this a major historic driver, it is a minor driver increasing future flood exposure. Most of the drainage and land development decisions have already been made and cannot be unmade. There is additional demand for drainage that can reduce vulnerability, but marginally affects flood exposure downstream. Community demand for garages, parking areas, patios, decks, pools, and bigger homes has increased the hard cover of soils. Imperviousness drives runoff in small storms and marginally affects flood exposure in large storms. We defined the sectors of municipal work within which we work to connect on the promise to comprehensively reduce the risk of flooding throughout the community; infrastructure, regulation, outreach and engagement, and emergency services. This planning project was conducted to be consistent with the City Council’s Better Together public engagement goals to plan infrastructure consistent with the Strong Foundation (maintain physical assets and infrastructure) goals. The project focused on the infrastructure and engagement areas of work. INFRASTRUCTURE: We will renew our infrastructure and operate it to reduce risk. We will plan public streets and parks to accept and transmit flood waters to reduce the risk and disruption of related city services. REGULATION: We acknowledge competing demands of land use and addressing drainage, groundwater, and surface water issues. We help people solve issues without harming another. STAFF REPORT Page 4 OUTREACH AND ENGAGEMENT: We make flood information available and give people tools for flood resilience. EMERGENCY SERVICES: We help people prepare for floods, remove people from harm during floods, and recover after floods. While developing the Flood Risk Reduction Strategy, we used the Morningside Neighborhood as a focus area to test concepts on what works to reduce flood exposure for homes. Two concepts that challenged the infrastructure area of work in that Strategy development effort also challenged this infrastructure design effort – scale and balance. Scale and Balance; Infrastructure sized to provide benefit to all, and harm no one, while balancing flood risk reduction benefits, takes neighborhood scale with additional flood storage, and careful sizing and planning of pipes, flow paths and intervening flood storage. Anticipated roadway reconstruction in the Morningside neighborhood in 2022 and 2023 presents an opportunity to explore infrastructure-based solutions to managing flood risk. This is the first project to engage a neighborhood and plan flood infrastructure under the new strategy. Staff initiated the engagement and engineering design in early 2020 to prepare for the street reconstruction design, set to kick-off in May 2021. City of Edina budget goals Strong Foundation: Maintain physical assets and infrastructure. Livable City: Plan for connected and sustainable development. Reliable Service: Maintain service levels that best meet the needs of the community. Better Together: Foster an inclusive and engaged community. STAFF REPORT Page 5 Section 2: Flood Infrastructure Concept Design Process The design team was made up of City of Edina staff and scientists and engineers from Barr Engineering Company. The design team engaged with a variety of individuals and groups to inform the design. Here is who was involved. Public Policy Technical Individuals in the Morningside neighborhood Energy and Environment Commission Expert engineering panel Morningside Neighborhood Association steering committee Planning Commission Neighboring cities staff Avail Academy and Susan Lindgren School Parks and Recreation Commission Minnehaha Creek Watershed District The design process involved the following steps to iteratively gather input and develop flood infrastructure scenarios leading to conceptual designs: 1. Preliminary public engagement 2. Scenario development 3. Scenario public engagement 4. Scenario technical expert panel 5. Option development 6. Option public engagement 7. Option expert panel 8. Staff recommendation of refined option We are grateful to many individuals that followed, posted, emailed, called, attended and otherwise reached out during this project. Here is a summary of what we heard, and how it affected the design: • Concerns for individual residential structures • Concerns for balancing and sharing of benefits throughout neighborhood • Concerns for future flood risk with climate change • Concerns about property acquisition or use of public property for flood storage • Concerns about public spaces and natural resources • Concerns about floodwall scenarios • Concerns about some options not serving part of the neighborhood Additional details, including specific events and comments in the public engagement process are available in the appendix (Public Participation Summary, January 22, 2021). Additional detail about the flood infrastructure scenarios and concepts are provided in the following sections. Here is how public input affected our design; • Include as design goals; o No increase in risk to any individual property o Balance the risk and benefit of the project o No private property will be proposed for acquisition STAFF REPORT Page 6 o Avoid floodwalls • Include as design consideration; o Future climate change o Limit impact at Weber Park • Take advantage of opportunity; o Enhance natural areas where impacts occur o Consider park improvements where impacts occur o Remove or reduce potential for flood overflow into private property through minor changes in grade o Add inlets in low areas to fully utilize pipe • Detailed conversations also led the design team to; o Consider backflow and overflow on Grimes Avenue o Improve system map and model accuracy in 41st street right-of-way o Consider overflow on Crocker Avenue In addition to these direct effects on our design, City staff engaged directly with many residents on individual concerns and responded with phone conversations, conducted site visits, shared flood vulnerability reduction technical advice, interpreted and questioned model results, expanded on and shared ideas for flood risk and reduction techniques, attended on-site public open houses, and held online virtual meetings with discussions. Section 3: Flood Infrastructure Scenarios The design team created and reviewed the following scenarios to test key infrastructure strategies at reducing flood risk. • Pipes / Floodwalls • Flood storage • Graded overflows • Ponds and predictive pumping • Combination Each of the scenarios resulted in increased flood risk for some properties in the neighborhood. Some scenarios and specific infrastructure features lead to unacceptable results or risks that drew concern from the public including those that contemplated using private property or tried to store flood water above home elevations with floodwalls. Key lessons learned: 1. Additional storage is key for providing benefit for middle and low elevation areas, above ground storage in existing and expanded ponds and low areas is most valuable and cost effective. 2. Subwatershed scale is large and providing benefit across the subwatershed takes significant pipe upgrade. Pipes transfer risk downstream that must be mitigated with additional flood storage. 3. Balancing the flood risk benefits and making sure no additional risk was produced for some properties took careful planning and iterative testing using stormwater modeling. STAFF REPORT Page 7 4. Lowering storage areas with new lower pipe outlets, or pumped outlets was the only way to create the amount of new storage needed to reduce flood elevations and get to subwatershed scale while keeping park land tradeoffs reasonable. In the end, while no single scenario met the mark for the designers nor the community, we kept the elements that did provide value and explored what various levels of implementation would look like. Additional details on lessons learned from the scenario development can be found in the February 3 Technical Memo, Infrastructure Options to Reduce Flood Risk in the Morningside Neighborhood located in the appendix. Section 4: Options and Decision Criteria The design team created and reviewed the three various size options “Big”, “Bigger” and “Biggest”, by iteratively adding or removing individual features of the design. Due to the interconnected relationship of storage to pipes, and the all-in cost of some of infrastructure features, some features were upsized or downsized in one or more of the options. The options were then reviewed with decision criteria described in this section, to find which were providing good value, and which were not. The process to create these three options built off the lessons learned from the scenarios described in Section 3. The design team explored the following criteria to refine the options and inform the staff recommendation. Criteria / Name No-build Big Bigger Biggest Approximate Infrastructure Cost $0M(2) $5M $10M $15M Neighborhood-scale? Not applicable No Yes Yes Balances upstream and downstream risk? Not applicable Yes Yes Yes Homes removed from risk (1%- annual-chance event)(1) 0 5 28 37 Home with risk reduced (1%- annual-chance event) (1) 0 91 119 119 Benefit (Annualized damage avoided) (1) $0 $102,200 $172,500 $180,800 % Reduction damages (1%- annual-chance flooding) (1) 0 -10% -46% -53% Neighborhood wide reduction in damage (damage avoided in 1% annual-chance flooding) (1) 0 $291,000 $1,386,000 $1,612,000 % Reduction damages (10%- annual-chance flooding) (1) 0 -28% -47% -48% Neighborhood wide reduction in damage (damage avoided in 10% annual-chance flooding) (1) 0 $439,000 $750,000 $759,000 STAFF REPORT Page 8 Damage Reduction / Cost Ratio Not applicable 1.1 0.9 0.7 Parks, land, natural resource, tradeoffs and opportunities No Yes Yes Yes Note 1; 1% annual chance event, sometimes called the 100-year event, or 10% annual chance event, sometimes called the 10-year event. More detail on smaller and larger event metrics can be found in the technical memo, in the appendix. Note 2; While the no-build option is listed in this chart as $0, we note that the renewal of the existing infrastructure scheduled for 2022 and 2023 as part of planned street reconstruction will exceed $2M. While some savings accrue by upgrading parts of the infrastructure rather than maintaining, additional costs for maintaining existing infrastructure are planned as part of the neighborhood reconstruction program. While the three refined options are not fully optimized for stormwater flood risk reduction, the design team feels they represent a good range of the scale and value that can be achieved, for the costs and tradeoffs proposed. The design team concludes that several of the features only found in the “Biggest” option, are not providing good value or are redundant with features that perform better. Section 3 of the technical memo has detailed descriptions of all the features. The technical memo also includes figures that show existing and proposed flood inundation mapping for all options for a variety of storm sizes. The 1%-annual-chance event for the existing and “Bigger” options are shown as examples. STAFF REPORT Page 9 Existing 1%-Annual-Chance Event Inundation (7.5 inches in 24 hours) 1%-Annual-Chance Event, $10M-“Bigger” Option Inundation The design team sees the potential for significant flood reduction in even large events, at the “Bigger” option, $10M cost. While flooding on private properties and risk to homes is not eliminated, it is significantly reduced. Some areas, particularly landlocked areas have more modest benefits as the design proposes to eliminate or reduce the potential to overflow into those areas. Section 5: Preliminary Recommendation and Next Steps The staff and design team recommend creating infrastructure consistent with the “Bigger” option, with the following features to include in design (see Table 1 and Figure 2 of the tech memo); 1. An expanded and lowered Weber Pond, (tech memo Feature 1) including: a. Expansion into Weber Woods and the removal of approximately 6 acres of trees b. Natural resource restoration and improvement of the entire Weber Woods land area c. Creation of nature trails and a bridge or floating boardwalk connecting east to west across the pond 2. An expanded and lower Lynn/Kipling inundation area (tech memo feature 4) including: a. Tree removal along most of the basin, with several tree stands saved b. A mixed wetland and pond, with aquatic and upland natural resource restoration STAFF REPORT Page 10 3. An expanded pipe and swale to provide overflow from the Lynn/Kipling inundation area (tech memo features 2 and 3) including: a. A box culvert along the 41st right-of-way and easement corridor between homes b. A landscaped swale along the north side of the active play spaces in Weber Park to provide high flow and clean water benefits, including an east to west park trail. 4. An expanded and reconfigured pipe network extending west on 42nd, south on Crocker, east on Morningside Road, south on Grimes, and west on Branson minor grade changes on Grimes and Crocker (Technical Memo features 9, 9a, and 10) and minor grade changes on 40th (part of Technical Memo feature 8) including: a. Expanded surface inlets to fully utilize pipe capacity in extreme events b. Minor changes to grades in streets and curb lines to reduce potential surface flows or flood backflow into low or landlocked areas. Staff proposes the following actions for Council consideration: 1. Affirm strategy, design goals, considerations and opportunities (also described in section 2 above). a. Strategy; Risk transfer with pipe, and mitigation and additional flood reduction with storage b. Design goals; i. No increase in risk to any individual property ii. Balance the risk and benefit of the project iii. No private property will be proposed for acquisition and no floodwalls are needed as no flood stages are higher in the proposed design c. Include as design consideration; i. Consider future climate change in design ii. Limit impact at Weber Park by focusing pond expansion in Weber Woods, using a pumped outlet to lower the outlet water elevation, and using smart infrastructure approach of predictive pumping ahead of extreme events. d. Take advantage of opportunity; i. Enhance natural areas where impacts occur ii. Consider park improvements where impacts occur iii. Remove or reduce potential for flood overflow into private property through minor changes in grade iv. Add inlets in low areas to fully utilize pipe e. Tradeoffs i. Project will use park space in Weber Park, Weber Woods, and Lynn/Kipling inundation area (List of features from “Bigger” option described in section 5 to bring forward.) 2. Modify Capital Improvement Plan item 19-341 (attached) to include estimated design professional services costs in 2021 of $1.4M, construction professional services in 2022 of $0.5M, capital expenses of $9.5M in 2022, and $0.5M in 2023, totaling $10M in capital and $2M in professional services, in addition to the $0.25M previously allocated to engagement and concept design work. 3. Authorize City Manager to sign professional service scope of service with Barr Engineering for Morningside Flood Infrastructure Project for a cost not to exceed $1.204M STAFF REPORT Page 11 4. Approve public participation plan to inform the public and project about park landscape aesthetics choices. Attachments Technical Memo Engagement Report Past reports to Council March 16, 2021 Council Work Session – Preliminary Staff Recommendation September 1, 2020 Council Work Session – Morningside Flood Infrastructure Project Update April 21, 2020 Approve Public Participation Plan for Morningside Flood Infrastructure Project and Request for Purchase for Engineering and Engagement Services Public Participation Plan April 7, 2020 Flood Risk Reduction Strategy approval March 5, 2019 FRRS Strategy Update September 5, 2018 – Adoption of 2018 Comprehensive Water Resources Management Plan April 3, 2018 – Work Session – Comprehensive Water Resources Management Plan – Implementation Discussion January 17, 2018 – Authorize Staff to Submit Draft Comprehensive Water Resources Management Plan for Agency Review November 21, 2017 – Work Session – Draft 2018 Comprehensive Water Resources Management Plan Presentation for Review and Comment Water Resources Library – Historical Morningside Neighborhood Stormwater Reports May 17, 2016 – Weber Woods Purchase Agreement City of Edina 2019-203 CIP Change Request Form 4/21/2016 4:37 PM Project Name Project Contact Project Number Department Head Project in 3ULRU CIP? Department Project Description (what and where?) – include enough detail that a person who is unfamiliar with the project before reading this can understand what we are proposing. Strategic Justification (why?) – describe why the City should do this project. Usually the City’s top priorities are set by the Council in documents like Vision (GLQD, Comp Plan, or City Work Plan. City of Edina 2019-203 CIP Change Request Form 4/21/2016 4:37 PM Environmental considerations – list environmental effects to consider. Are "greener" alternatives being considered? Already Future Total Expenditures (describe) Spent 2019 2020 2021 2022 2023 Years Project 1 2 3 4 5 Total Expenditures Funding Sources: List all known funding. If there is none identified yet, specify "Construction Fund". 1 2 3 4 5 6 Total Funding Sources Project Costs (how much?) and Financing (how?) - include everything. Expenditures might include construction, consultants, hardware, software, etc. Funding might include donations, state grants, special assessments, etc. Comments on costs and financing, if necessary. Are there any ongoing costs/benefits to consider? PUBLIC PARTICIPATION PLAN I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 1 PUBLIC PARTICIPATION PLAN MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT DECISION TO BE MADE - Develop Weber Park landscape design consistent with flood infrastructure elements and budget approved by City Council with the Morningside Flood Infrastructure Project decision. (www.BetterTogetherEdina.org/Morningside). - Staff will update City Council at the 30% design milestone. - Staff will make a request for purchase for construction, City Council will decide. DECISION CRITERIA IN SCOPE - Natural areas restoration - Walking paths - Ball fields and rink placement - Irrigation - Tree removal and planting - Pond and park grading - Lynn/Kipling open space grading and natural areas restoration OUT OF SCOPE - Roadway reconstruction elements such as street width, and sanitary sewer and water improvements DECISIONS ALREADY MADE - Consistent with the purchase agreement, Weber Woods shall be used solely for public park purposes, including open space, outdoor recreation, and dog park, and similar uses and facilities; stormwater management facilities; and public utilities. - Roadway reconstruction schedule - Renewal of sanitary sewer, water, and storm sewer utilities included in roadway reconstruction project - A dedicated bicycle facility along the east side of Grimes Avenue will be installed during construction - Concept-level flood infrastructure elements and budget approved by City Council - At least two ball fields will be included in the design - The number of skate facilities (1 rink and 1 open skate) will remain the same - Rink lighting will be replaced - No changes to the warming house - No changes to the tennis courts - No changes to the playground - No changes to the basketball court OTHER CONSIDERATIONS - Neighboring Cities - Roadway reconstruction is guided by the Living Streets Plan - Walking and biking facilities are guided by the Pedestrian and Bicycle Master Plan - Safety improvements are guided by the City’s Traffic Safety Committee and existing City policies LEGAL OR TECHNICAL REQUIREMENTS PUBLIC PARTICIPATION PLAN I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 2 - FEMA floodplain designation - Minnehaha Creek Watershed District rules - Minnesota Department of Natural Resources rules PROJECT TIMELINE - Spring 2021 through early 2022 for engagement and design. - The Engineering Study for the road reconstruction would occur concurrently. Construction would start in the spring of 2022. STAKEHOLDERS - Morningside Neighborhood - Morningside Neighborhood Association - Park and Recreation Commission - Avail Academy (formerly Calvin Christian School) - Minnehaha Creek Watershed District - City of St Louis Park - City of Minneapolis ROLES RESIDENTS Expertise in sense of place, neighborhood feel, public attitudes, community values, desired amenities, tax burden. - Provides their expertise on values - Reviews concept - Communicates questions and concerns STAFF Expertise in engineering, water and natural resources management, flood risk, transportation planning and safety, street and utility construction, parks and recreation, and landscape architecture. - Develops design based on technical expertise and professional judgement - Communicates the costs, tradeoffs, constraints, and impacts (economic, social, environmental) - Considers feedback from stakeholders - Seeks direction from Council on political decisions and operates within parameters set by Council - Describes how the public influenced the concept design - Memorializes engagement process and decision - Closes the loop with the public - Implements the decision made by Council CITY COUNCIL Decision-making body. - Shares the feedback received directly from stakeholders with the project team in a timely manner so that all have the same information - Decides funding level and source - Defines level of service - Sets parameters for improvements in public spaces such as streets, right-of-way, and parks PUBLIC PARTICIPATION PLAN I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 3 - Approves design PUBLIC PARTICIPATON LEVEL CONSULT - Goal: To obtain public feedback on analysis, alternatives and/or decisions. - Promise: We will keep the public informed, listen to and acknowledge concerns and aspirations, and provide feedback on how public input influenced the decision. TECHNIQUES - Better Together Edina website - Social media (Next Door, Facebook, Twitter) - Community Meetings DECISION PROCESS Objective Staff will inform people of the project and process. This is an extension of the Morningside Flood Infrastructure Project. Staff will present the 30% concept design and solicit feedback. Staff will consider feedback. Staff will provide an update to City Council. Staff will make a request for purchase for construction following a competitive bid process. City Council will make a decision. Staff will communicate the final design to the public. Staff will archive the project and process online. Anticipated Outcomes People know how and when to provide feedback. People have access to information. People have the ability to provide their feedback. Staff have listened to and acknowledged resident feedback. People know how feedback was used. Staff have listened to and acknowledged resident feedback. People know how feedback was used. The staff recommendation aligns with City Council direction. People know what decision was made. People can view the information and process on the BetterTogetherEdina webpage. Timeline Spring 2021 Summer 2021 Summer or Fall 2021 Spring 2022 Spring 2022 Close the loopProject AuthorizationCouncil Update Share Concept Design Introduce Project Barr Engineering Co. 4300 MarketPointe Drive, Suite 200, Minneapolis, MN 55435 952.832.2600 www.barr.com Memorandum To: Jessica Wilson and Ross Bintner, City of Edina From: Cory Anderson, Greg Williams, and Sarah Stratton Subject: Infrastructure Options to Reduce Flood Risk in the Morningside Neighborhood Date: February 3, 2020 Project: 23271798.00 1.0 Purpose of Project and Project Background This technical memorandum summarizes Barr Engineering Co.’s (Barr’s) evaluation of the refined potential options for flood risk reduction in the Morningside neighborhood within the City of Edina (Figure 1). This evaluation expanded on previous efforts briefly summarized in Section 2.0. The flood risk reduction features of the refined options are described in Section 3.0. The benefits and the associated costs of each of the refined options are discussed in Section 4.0, and Section 5.0 describes some tradeoffs and opportunities that may exist for further refinement ahead of final detailed design and construction. Finally, conclusions of this work and the previous efforts and a summary of recommended next steps are included in Section 6.0. The goal of this memo is to provide City staff and City Council with the information needed to make decisions in 2021 aimed at implementing the most economical, advantageous, and optimized flood risk reduction project in the Morningside neighborhood in coordination with the planned street reconstruction in 2022 and 2023. The City has also performed extensive community engagement to address flood risk reduction options in the Morningside neighborhood. These efforts are described in a separate report. Figure 1 Morningside Neighborhood study area (storm sewer shown in black lines) To: Jessica Wilson and Ross Bintner, City of Edina From: Cory Anderson, Greg Williams, and Sarah Stratton Subject: Infrastructure Options to Reduce Flood Risk in the Morningside Neighborhood Date: February 3, 2020 Page: 2 P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Mitigation Alternatives Technical Memo\Jan2021 Memo\Morningside_Flood_Infrastructure_Technical_Memo_02032021.docx 2.0 Summary of Previous Work The City of Edina’s Comprehensive Water Resources Management Plan (CWRMP), published in July 2018 (reference (1)) identified the Morningside neighborhood as an area with a significant number of structures at risk of flooding. This neighborhood is also planned for street reconstruction in 2022 and 2023 (reference (2)). Given both the need to reduce flood risk and the street reconstruction opportunity, the City began planning for a flood risk reduction project. At the time the CWRMP was published, an uncalibrated stormwater model of the City was used to determine the main factors affecting flood risk. These factors were identified as limited outlet capacity from the Morningside neighborhood to Minneapolis and limited flood storage capacity within the neighborhood. A preliminary analysis was completed to understand options available to reduce peak water levels during storm events and to assess the impact of each potential flood risk reduction option. Ultimately, the suggestions documented in the CWRMP included increased flood storage in Weber Park, increased outlet capacity to Bde Maka Ska (in coordination with Minneapolis), and increased pipe capacity and additional or new stormwater outlets within the neighborhood. In November 2018, the uncalibrated stormwater model was used to conduct a more detailed assessment of the options for reducing the flood risk identified in the CRWMP (reference (3)). In this evaluation, flood risk reduction scenarios (i.e., surface storage, conveyance, underground storage, pumping, etc.) were initially analyzed, one at a time, to understand the impacts of each type of approach and identify the locations in the neighborhood that would receive the most flood risk reduction benefit. Individual components of each flood risk reduction scenario were then grouped into multiple “combination options” to further increase flood risk reduction benefits. Additionally, a method was developed to (1) estimate potential flood damage (in dollars) to individual homes and to the neighborhood as a whole, and (2) estimate the value of each flood risk reduction option (in dollars of potential damage avoided). The study included planning-level opinions Timeline of Previous Related Work 2018 • City of Edina Comprehensive Water Resources Management Plan developed • Uncalibrated Morningside neighborhood stormwater model used to assess feasibility of preliminary options for reducing flood risk 2019 • Morningside surface water levels monitored and used to calibrate existing stormwater model in cooperation with St. Louis Park and Minneapolis • City engages a citizen task force to help inform a flood risk reduction strategy 2020 • City publishes a Flood Risk Reduction Strategy • Updated stormwater model used to evaluate design storm events; resulting flood risk documented • Local engineering experts in urban/residential flooding and mitigation meet to further evaluate existing flood risk reduction concepts and discuss new and modified approaches • Calibrated and detailed stormwater model used to model the best subset of flood risk reduction scenarios • “Refined options” are created that maximize the flood risk reduction benefit to the neighborhood while considering a range of estimated costs To: Jessica Wilson and Ross Bintner, City of Edina From: Cory Anderson, Greg Williams, and Sarah Stratton Subject: Infrastructure Options to Reduce Flood Risk in the Morningside Neighborhood Date: February 3, 2020 Page: 3 P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Mitigation Alternatives Technical Memo\Jan2021 Memo\Morningside_Flood_Infrastructure_Technical_Memo_02032021.docx of construction costs for comparison to the estimated value of each flood risk reduction option (i.e., benefit-cost analysis). This analysis showed: 1) Additional flood storage volume is necessary in this neighborhood. 2) Increased pipe capacity benefits the upstream (south and west) portions of the neighborhood and is only possible if increased flood storage volume is also included. 3) Pumping is one way to create additional flood storage volume. 4) Adding a predictive component to the pumping increases the cost by a relatively small amount (approximately 1% of the overall cost estimate, or about 10% of the pump station alone). 5) Although it can provide significant storage, underground storage is not economical. It was during this study that the option for a larger outlet pipe to Minneapolis was removed from consideration because it would exacerbate existing flooding concerns within Minneapolis. Evaluations up to this point were completed using an uncalibrated stormwater model. In 2019 the hydrology and hydraulics of the neighborhood were studied in more detail by monitoring surface water levels and then using the data to calibrate the stormwater model to multiple storm events. The model was also combined with the stormwater models of the adjacent cities of St. Louis Park and Minneapolis to further reduce uncertainties associated with model boundary conditions. Finally, additional overland flow detail (two-dimensional modeling of water on the ground surface) was added to the model to improve the understanding of surface flow during large storm events. The updated model was used to model design storm events (from the 20%-annual-chance event through the 0.2%-annual-chance event), and the resulting flood risk was documented in April 2020 (reference (4)). In 2020, City staff convened two meetings of local engineering experts in urban/residential flooding and mitigation to further evaluate existing flood risk reduction concepts and discuss new or modified approaches. For this meeting, a modified version of an Estimate-Talk-Estimate (ETE) approach was used— a problem was presented, and multiple rounds of thoughts and opinions shared until consensus was reached. These meetings helped confirm that there are three primary approaches to reducing flood risk in this area (reference (5)): 1) Increase conveyance to move water away from people and structures 2) Increase storage to hold water away from people and structures 3) Move people and structures away from water to reduce exposure and/or reduce structure vulnerability To: Jessica Wilson and Ross Bintner, City of Edina From: Cory Anderson, Greg Williams, and Sarah Stratton Subject: Infrastructure Options to Reduce Flood Risk in the Morningside Neighborhood Date: February 3, 2020 Page: 4 P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Mitigation Alternatives Technical Memo\Jan2021 Memo\Morningside_Flood_Infrastructure_Technical_Memo_02032021.docx The three primary approaches confirmed during these meetings were consistent with the previous work described above; however, there was no detailed discussion about where to use these general approaches within the Morningside neighborhood. Also in 2020, the calibrated two-dimensional stormwater model was used to model the best subset of the flood risk reduction scenarios created in 2018. This was an effort to update our understanding of the benefit of these scenarios (compared to the existing flood risk) using the best available model (reference (5)). The main conclusions from the 2018 analysis were confirmed and the modeling highlighted the increased benefit of combining features best suited for different portions of the neighborhood. At the end of 2020, “refined options” were created that maximize the flood risk reduction benefit to the neighborhood while considering a range of estimated costs (Section 3.0). Throughout this process, every effort was made to avoid relying on acquisition of homes to reduce exposure to flood risk. In 2020, the City also developed a Flood Risk Reduction Strategy (reference (6)) that included a summary of actions that homeowners can take to reduce their vulnerability to flooding. This information, along with other information related to flooding and drainage, is available on the City’s website (reference (7)). 3.0 Description of the Refined Options Refining flood risk reduction options requires a “balancing act.” For example, while using larger pipes to increase conveyance may reduce flood risk in the upstream portion of the watershed, it can also push the problem downstream. To mitigate the effect of increased upstream conveyance, increased storage downstream is required. In short, we need to take care that flood risk reduction measures do not simply transfer risk from one area of the watershed to the other. In addition to achieving balance, an additional goal for refined flood risk reduction options was that flood risk should not increase for any structure. The effort to refine flood risk reduction options was informed by the previous work described in Section 2.0 and summarized below: • Additional flow capacity out of the neighborhood to Minneapolis should be removed from consideration. While adding flow capacity using larger pipe will effectively decrease risk in upstream areas, it also transfers that risk to downstream areas—where conveyance capacity does not exist. There are existing and significant flooding issues present in Minneapolis between the Morningside neighborhood and Bde Maka Ska, and on the lake itself. • Additional flood storage in the Morningside neighborhood is necessary. Additional flood storage not only serves those who live closest to it by reducing local water levels, but also makes it possible to increase conveyance from upstream areas to the areas with additional storage. Without additional flood storage, additional conveyance merely transfers risk from upstream to To: Jessica Wilson and Ross Bintner, City of Edina From: Cory Anderson, Greg Williams, and Sarah Stratton Subject: Infrastructure Options to Reduce Flood Risk in the Morningside Neighborhood Date: February 3, 2020 Page: 5 P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Mitigation Alternatives Technical Memo\Jan2021 Memo\Morningside_Flood_Infrastructure_Technical_Memo_02032021.docx downstream. Increasing flood risk to individual downstream structures is not an acceptable outcome. • The additional flood storage needed should be placed in open areas located at the surface (i.e., not underground), near the mid- and downstream portions of the neighborhood. The result is a few large, concentrated pond features in the neighborhood. The upstream portions of the neighborhood are fully developed with no room for large surface storage, and underground storage is not a cost-effective solution here. • A moderately sized pump station can be added to the neighborhood and can provide substantial available storage in advance of large storms by pumping down the ponds in a controlled manner (i.e., predictive pumping). Using pumping to pre-emptively increase available storage can allow greater effective storage within a smaller footprint. Predictive ability (monitoring weather forecasts and water levels in real-time) can be added for little additional cost and automates the operation of this feature. • Increased conveyance capacity via storm sewer pipes is necessary to reduce upstream flooding and limit surcharging and overland flow in the mid-to-downstream areas. The main storm sewer lines through the neighborhood flow above full capacity during large storms, which results in water spilling out of the storm sewer into the streets and onto the surface (surcharging). Increased conveyance can transfer risk from upstream to downstream if there is insufficient storage capacity downstream; thus, increased conveyance must be balanced with increased storage volume. • Flood risk in backyard areas that lack or do not have sufficient storm sewer outlets can be reduced by adding catch basins or similar structures. However, this can only be done if the capacity of the connected storm sewer lines is increased to accommodate the additional water. Ultimately, this can only be done if additional flood storage volume is provided downstream. • Individual home and property owners can and should take preventative measures to further reduce flood risk to themselves. One of the approaches for reducing flood risk is to limit exposure and/or vulnerability. As homes are rebuilt in the City, policies regarding minimum building elevations may reduce exposure and therefore flood risk. Additionally, features such as backflow preventers, tile drain around homes, and backup generators reduce vulnerability and risk (reference (8)). The City’s Flood Risk Reduction Strategy included a tool kit that provide residents with a range of ideas (including low-cost and no-cost options) to reduce the vulnerability of their homes, such as storing valuable items off the basement floor, redirecting downspouts and taking temporary mitigation measures when rains are anticipated. A refined combination option was created based on the bullet points above. The initial concept was intended to achieve as much flood risk reduction as possible, while avoiding options previously ruled out (e.g., increasing flow to Minneapolis, acquisition, avoiding unrealistically sized infrastructure). The To: Jessica Wilson and Ross Bintner, City of Edina From: Cory Anderson, Greg Williams, and Sarah Stratton Subject: Infrastructure Options to Reduce Flood Risk in the Morningside Neighborhood Date: February 3, 2020 Page: 6 P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Mitigation Alternatives Technical Memo\Jan2021 Memo\Morningside_Flood_Infrastructure_Technical_Memo_02032021.docx probable cost was estimated for construction and design (~$15M, “Biggest” option) and identified to be higher than the anticipated funding available. Therefore, the refined combination option was modified by removing features that were less beneficial (compared to their individual cost) until the costs were lowered to levels closer to the available-funding estimate provided by City staff (~$5M, “Big” option) and about double that value (~$10M, “Bigger” option). The following numbered list describes each of the individual flood risk reduction features in the refined options. Figure 2 shows the locations of those features identified using the numbers from the list below. Table 1 identifies which features are included at the three different estimated cost levels. Additional information is available in the published documents on the City’s Better Together website, particularly documents related to the December 2020 virtual public meeting (reference (9)). 1) The first feature is an expanded Weber Pond, creating some of the necessary additional flood storage in the downstream-most portion of the neighborhood. The proposed pond is larger in extent, expanding into Weber Woods and slightly west into Weber Park. The pond bottom is lowered, and the outlet elevation of the pond is also lowered by creating a lower gravity outlet, or a pumped outlet, which creates more vertical flood storage capacity before water levels reach homes or other infrastructure. This feature also includes a pump station with predictive pumping capabilities to draw the level of the pond down by as much as 3 feet in advance of large storm events. The pump will not pump the pond fully dry, leaving at least 1 foot of water prior to very large storm events. Predictive pumping introduces an element of operational uncertainty; the potential impacts of predictive pumping scenarios were evaluated and summarized in Table 2 of (reference (5)). The expanded pond requires the removal of a portion of the existing Weber Woods. Recognizing that these woods are a valued neighborhood amenity, the intent is to keep them accessible via a bridge over the pond that connects walking paths and enhances the park. There is also an opportunity to improve the wildlife habitat and restore some ecological integrity. The preliminary assessment indicates that Weber Woods is a “D” quality lowland forest, close to classification as an altered/non-native forest/woodland. The canopy is mostly second-growth cottonwoods, with some box elder, Siberian elm, and American elm. The shrub layer comprises mostly invasive species or weedy natives, and the ground layer is mostly bare. This feature is a foundational component of all refined options due to the significant need for additional storage, although the impact to Weber Woods is smallest in the “Big” refined option and includes pumped outlets in the ”Bigger” and ”Biggest” refined options. 2) The second feature is a surface swale through Weber Park, between existing park features (tennis court, baseball and softball fields, etc.). The proposed swale extends from Grimes Avenue to the expanded Weber Pond, conveying surface flow from the west to the pond in a controlled manner. The swale can double as a walking path in normal conditions and will be used to convey flows during large storm events, such as those with less than a 10% chance of occurring annually. To: Jessica Wilson and Ross Bintner, City of Edina From: Cory Anderson, Greg Williams, and Sarah Stratton Subject: Infrastructure Options to Reduce Flood Risk in the Morningside Neighborhood Date: February 3, 2020 Page: 7 P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Mitigation Alternatives Technical Memo\Jan2021 Memo\Morningside_Flood_Infrastructure_Technical_Memo_02032021.docx This feature is not used in the “Big” refined option and is used in the “Bigger” and “Biggest” refined options. The design of this feature must be considered in conjunction with the design of feature #9, as both features increase conveyance and have different sizing constraints. 3) The third feature is a large box culvert conveying flow from the open space area between Lynn Avenue and Kipling Avenue to the storm sewer at the intersection of Grimes Avenue and the W 41st Street corridor. This box culvert could be installed parallel to the existing storm sewer but will more likely replace the existing storm sewer in that location due to space constraints. In normal, low-flow conditions, the box culvert will convey water to the existing storm sewer at Grimes Avenue and the W 41st Street corridor, and water will continue to flow through the storm sewer out to Minneapolis. During larger storm events, the large box culvert will convey significantly more flow than the current storm sewer pipes in that location and will discharge excess flow into the proposed swale in Weber Park (again for large events with less than a 10% chance of occurring annually). This box culvert is also intended to relieve the flow that would occur over Kipling Avenue and then overland between homes to Grimes Avenue. This feature is not used in the “Big” refined option and is used in the “Bigger” and “Biggest” refined options. 4) The fourth feature is an expansion and lowering of the current open space area between Lynn Avenue and Kipling Avenue. This open space is periodically inundated by stormwater. The current normal water level is controlled by the two storm sewer outlets available in the northwest and northeast corners. These outlets will be reconstructed so that the outlet control level is lowered by about 3 feet. Additionally, dredging and clearing of vegetation may be done to create more storage capacity. The City recognizes that the trees along the perimeter of this inundation area have value, offering a wooded and more natural appearance to this open area. Therefore, the outer perimeter of trees will be partially left intact to maintain the appearance from the street and for residents living along Lynn Avenue and Kipling Avenue. The area also has the potential to be improved for natural resource and wildlife habitat. The final design should consider expanding these benefits through natural resource restoration. This feature is used in all three of the refined options. 5) The fifth feature is a large box culvert conveying flow from open park space (Yale Gardens Park) west of Monterey Avenue to the expanded and lowered inundation area between Lynn Avenue and Kipling Avenue. This box culvert could be installed parallel to the existing storm sewer but may end up replacing the storm sewer in that location instead due to space constraints. In normal, low-flow conditions, the box culvert will not carry significant flow or may not carry flow at all because the open space west of Monterey Avenue is intended to store and infiltrate water (feature #6). During larger storm events (those with less than a 4% chance of occurring annually) To: Jessica Wilson and Ross Bintner, City of Edina From: Cory Anderson, Greg Williams, and Sarah Stratton Subject: Infrastructure Options to Reduce Flood Risk in the Morningside Neighborhood Date: February 3, 2020 Page: 8 P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Mitigation Alternatives Technical Memo\Jan2021 Memo\Morningside_Flood_Infrastructure_Technical_Memo_02032021.docx the large box culvert will convey flow into the expanded and lowered open space area between Lynn Avenue and Kipling Avenue. This box culvert is also intended to eliminate the overland flow that would occur over Monterey Avenue on the surface between homes towards Lynn Avenue. This feature is only used in the “Biggest” refined option. 6) The sixth feature is an engineered, lowered, open field on the Susan Lindgren School property west of Monterey Avenue. This area currently stores some flood water during large storm events, but storage is limited due, in part, to a rise in the ground elevation in the northeast corner. This feature will require leveling and lowering the field by 2 to 3 feet and enhancing the drainage of the field. With this feature, the annual chance that the existing storm sewer pipe that runs under this space, carrying water from St. Louis Park into Edina, would surcharge is about 20% or less. During smaller storm events, the field would drain quickly and be usable as open park space. This feature is only used in the “Biggest” refined option. 7) The seventh feature is a cleared space to create additional surface storage on the Avail Academy School Property. Consisting largely of trees, there is some flood storage available in this area. The trees would be cleared in the interior of this area, the ground would be lowered by about 5 feet, and the area would be connected via buried storm sewer pipe to the expanded Weber Pond. This area would be inundated with water as the water level in Weber Pond rises above an elevation of approximately 859 feet (during events with a less than 20% annual chance of occurring). Because of the connection to Weber Pond, this area would stay inundated for a long period of time (likely greater than 48 hours). Additionally, the proposed storm sewer pipes along Inglewood Avenue (feature #8) would discharge to this area during larger storm events— those with a 10% or less annual chance of occurring. This feature is only used in the “Biggest” refined option. 8) The eighth feature is improved conveyance along W 40th Street, Grimes Avenue, and new conveyance under Inglewood Avenue. Surface flow in the street along W 40th Street carries some flow from St. Louis Park and some flow from portions of the neighborhood north of W 40th Street. Currently, a significant portion of that water flows south along the surface of Monterey Avenue, Lynn Avenue, and Kipling Avenue towards the open space area between Lynn Avenue and Kipling Avenue and the storm sewer along the W 41st Street corridor. This feature would increase the pipe capacity along W 40th Street; limit the overland and street flow south on Monterey Avenue, Lynn Avenue, and Kipling Avenue via modified street grade; and add storm sewer pipes under Inglewood Avenue. Runoff during low flows and smaller storm events would be carried entirely by storm sewer pipe to the intersection of Grimes Avenue and Inglewood Avenue and then out to Minneapolis via the new pipes under Inglewood Avenue, bypassing the To: Jessica Wilson and Ross Bintner, City of Edina From: Cory Anderson, Greg Williams, and Sarah Stratton Subject: Infrastructure Options to Reduce Flood Risk in the Morningside Neighborhood Date: February 3, 2020 Page: 9 P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Mitigation Alternatives Technical Memo\Jan2021 Memo\Morningside_Flood_Infrastructure_Technical_Memo_02032021.docx expanded Weber Pond. Larger storm events would result in street flow down Grimes Avenue, ultimately contributing to the storm sewer discharging to Weber Pond and the surface swale through Weber Park. This feature is only used in the “Biggest” refined option. 9) The ninth feature is increased capacity in the existing storm sewer along W 42nd Street and along a portion of Crocker Avenue (feature #9) and additional capacity along Crocker Avenue to Morningside Avenue, serving homes around Branson Street and Morningside Road (feature #9a). The additional capacity (from larger diameter pipe, and in some cases, where possible, a steepened pipe slope) serves the upstream and midstream portions of the neighborhood by increasing conveyance and moving water away from these areas and by limiting surcharging water nearer to the midstream and downstream areas. The additional capacity also potentially allows for adding stormwater outlets to backyard areas that currently do not have outlets, such as the area west of Crocker Avenue and south of W 42nd Street. The additional capacity along W 42nd Street also allows for a stormwater outlet from the southeast corner of the open space area between Lynn Avenue and Kipling Avenue, further benefiting the homes in that area. In addition, proposed localized grading (within the street right-of-way) may be needed in low areas on the west side of Crocker Avenue to prevent water from overflowing from the street into backyards. The portion of this feature along W 42nd Street and extending south along a portion of Crocker Avenue (feature #9) is used in all three of the refined options. This is one of the more costly features of the refined options. Therefore, only the $10M and $15M cost options include increased pipe capacity that extends farther south to Morningside Road (feature #9a). 10) The tenth feature consists of disconnecting storm sewer pipe at Scott Terrace from storm sewer pipe to the west along W 42nd Street. In the existing condition, the storm sewer pipe under W 42nd Street is under capacity and carries such significant flow that it surcharges, increasing the flood risk to homes near Scott Terrace and W 42nd Street. The storm sewer pipe to the west under W 42nd Street is disconnected and rerouted to Weber Pond under the southeast corner of Weber Park. The increased capacity under W 42nd Street (feature #9) also helps with the flooding in this intersection by limiting surcharge. This feature is used in all three of the refined options. 11) The eleventh feature consists of modifications within Weber Park, in particular to the sports fields. The baseball and softball fields would all be lowered by an average of about 7 feet, and the drainage would be enhanced. The northeast softball field would be mirrored to the southwest corner to make room for the swale (feature #2). The annual chance that this area would be used for temporary flood storage is about 10% or less, and the area would be inundated for less than 24 hours. The area closer to Grimes Avenue would also be leveled, lowered by about 5 feet on To: Jessica Wilson and Ross Bintner, City of Edina From: Cory Anderson, Greg Williams, and Sarah Stratton Subject: Infrastructure Options to Reduce Flood Risk in the Morningside Neighborhood Date: February 3, 2020 Page: 10 P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Mitigation Alternatives Technical Memo\Jan2021 Memo\Morningside_Flood_Infrastructure_Technical_Memo_02032021.docx average, and the ice rink would be rebuilt in a new configuration to make room for the park swale. This area would be used for temporary flood storage during events with a less than 2% annual chance of occurring and is estimated to be inundated for less than 12 hours. This feature is only used in the “Biggest” refined option. There are other locations throughout the neighborhood where some localized grading may be required to prevent overflow from the streets into private parcels, particularly into backyards. Locations that have been identified through modeling (based on LiDAR elevation data) are: near the intersection of Grimes Avenue and Inglewood Avenue, along Little Street near Lynn Avenue, along Grimes Avenue, Alden Drive, and Scott Terrace all south of W 42nd Street, the north side of W 42nd Street near Kipling Avenue, and finally along Branson Street, west of Grimes Avenue. These areas may require slightly higher curbs and/or surface grading near the streets to ensure that the stormwater flow stays in the streets during large storm events. Table 1 Summary of individual flood risk reduction features included in the refined options at the three different cost levels Feature Number Feature Description “Big” (~$5M) “Bigger” (~$10M) “Biggest” (~$15M) 1 Expanded Weber Pond and Pump Station1 X X X 2 Surface swale through Weber Park X X 3 Large box culvert from Kipling to Grimes X X 4 Open space area between Lynn and Kipling X X X 5 Large box culvert from Monterey to Lynn X 6 Open field on Susan Lindgren School property west of Monterey X 7 Avail Academy property surface storage X 8 Improved conveyance along W 40th Street, Grimes, and Inglewood X 9 Increased storm sewer capacity along W 42nd Street and north portion of Crocker Avenue X X X 9a Increased storm sewer capacity extending south along Crocker Avenue and additional capacity around Branson and Morningside Road X X 10 Disconnecting storm sewer at Scott Terrace X X X 11 Modifications to sports fields within Weber Park X 1 In the “Big” refined option, the Weber Pond expansion into Weber Woods is smaller and does not include a pump station. To: Jessica Wilson and Ross Bintner, City of Edina From: Cory Anderson, Greg Williams, and Sarah Stratton Subject: Infrastructure Options to Reduce Flood Risk in the Morningside Neighborhood Date: February 3, 2020 Page: 11 P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Mitigation Alternatives Technical Memo\Jan2021 Memo\Morningside_Flood_Infrastructure_Technical_Memo_02032021.docx Figure 2 Flood risk reduction features of the refined options (see numbered list and Table 1) Inundation mapping is provided in Attachment B for the ~$15M refined option, in Attachment C for the ~$10M refined option, and Attachment D for the ~$5M refined option. Figure 3 and Figure 4 show the incremental flood storage volume that is gained by layering several components of the flood risk reduction options for both the Weber Pond area and the open space area between Lynn Avenue and Kipling Avenue, respectively. To: Jessica Wilson and Ross Bintner, City of Edina From: Cory Anderson, Greg Williams, and Sarah Stratton Subject: Infrastructure Options to Reduce Flood Risk in the Morningside Neighborhood Date: February 3, 2020 Page: 12 P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Mitigation Alternatives Technical Memo\Jan2021 Memo\Morningside_Flood_Infrastructure_Technical_Memo_02032021.docx Figure 3 Incremental flood storage volume gained at Weber Pond with various flood risk reduction options Figure 4 Incremental flood storage volume gained with various flood risk reduction options at the open space area between Lynn Avenue and Kipling Avenue 0 10 20 30 40 50 60 70 80 90 100 Total Flood Storage Volume Available (acre-feet)Incremental Flood Storage Gained at Weber Pond with Various Options Previous Increment(s)This Increment Existing flood storage volume available between the normal water level of Weber Pond and the lowest adjacent home + Expand Weber Pond 2 acres into Weber Woods + Expand Weber an additional 3 acres into Weber Woods and Weber Park + Lower expanded Weber Pond 2.5 feet below normal water level using a pump station + Lower expanded Weber Pond an additional 3 feet prior to storm using predictive pumping 0 5 10 15 20 25 30 Total Flood Storage Volume Available (acre-feet)Previous Increment(s)This Increment Existing flood storage volume available between the normal water level and the lowest adjacent home + Expand storage area by 3 acres + Lower the controlling outlet elevation and normal water level by 3 feet To: Jessica Wilson and Ross Bintner, City of Edina From: Cory Anderson, Greg Williams, and Sarah Stratton Subject: Infrastructure Options to Reduce Flood Risk in the Morningside Neighborhood Date: February 3, 2020 Page: 13 P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Mitigation Alternatives Technical Memo\Jan2021 Memo\Morningside_Flood_Infrastructure_Technical_Memo_02032021.docx 4.0 Benefits and Costs Barr and City staff developed a method to estimate flood damages based on the peak flood elevations and approximate home elevations. The method is detailed in the City’s 2018 analysis (reference (10)) and summarized in the sidebar. The goal of the analysis was to estimate flood risk and associated impacts at a neighborhood-scale for varying storm events with and without flood risk reduction options. The flood damage estimates reflect “loss potential” in dollars, based on estimated flood loss potential tables published by the Federal Emergency Management Agency (FEMA) (reference (11)) and assumptions or judgments about the probability of damage given a flood level relative to the home elevations. Home elevations were based on surveyed basement or first-floor elevations for about half of the homes and estimated from LiDAR-based (elevation data) adjacent grades for the other half of homes using the process documented in reference (10). On an individual home-by-home basis we expect some results to be underestimated and some to be overestimated. However, at the neighborhood scale, we believe that the estimate of total damages is comparable to the level of confidence in the planning-level costs developed for each option. As the City’s flood risk reduction effort continues and surveyed elevations of homes are collected, the analysis can be updated with more accurate elevation information and subsequently improve the damage estimates on both a home- by-home and neighborhood-wide basis. Additionally, as more information about storm sewer connections or rebuilt homes is shared and learned, the estimates of the number of homes impacted and the total damages in dollars is improved. Table 2 shows the number of structures at risk during each of the storm events modeled, up to the 1%- annual-chance event. Table 3 shows the annualized, monetized damage of each condition (existing and with a flood risk reduction option), the annualized monetary benefit of each flood risk reduction option, and the number of structures at risk, removed from risk, and where risk was reduced. The annualized, monetized damage and benefit considers all of the storm events modeled and the probability of those events occurring. The City’s method estimates an annualized flood damage for each structure with consideration for three potential modes of flooding for each structure: 1) Indirect (floodwater against the foundation) 2) Direct (floodwater over the foundation) 3) Sanitary sewer backup A curve is developed for each structure correlating water surface elevation (WSEL) and estimated damage (or “potential loss”). Damages are estimated according to the mode of flooding, severity (i.e., flood depth), structure footprint, and unit area. An annualized damage estimate is generated for each property by integrating the estimated damage at a given WSEL multiplied by the annual exceedance probability between the 5- year and 100-year events, as shown: The benefit of a flood risk reduction action is estimated as the difference in the annualized damage estimates using pre- and post- mitigation water surface elevations between the 20%-annual-chance event and the 1%-annual- chance event. To: Jessica Wilson and Ross Bintner, City of Edina From: Cory Anderson, Greg Williams, and Sarah Stratton Subject: Infrastructure Options to Reduce Flood Risk in the Morningside Neighborhood Date: February 3, 2020 Page: 14 P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Mitigation Alternatives Technical Memo\Jan2021 Memo\Morningside_Flood_Infrastructure_Technical_Memo_02032021.docx Table 2 Summary of the number of structures with potential damage by any of the three modes of damage (direct surface water, indirect groundwater, or sanitary backup) by storm event up to the 1%-annual-chance event (ACE) [100-year event] Condition 5-year 20% ACE 10-year 10% ACE 25-year 4% ACE 50-year 2% ACE 100-year 1% ACE 500-year 0.2$ ACE Existing 95 107 115 126 139 160 “Big” 80 94 103 116 134 154 “Bigger” 76 80 84 95 111 141 “Biggest” 76 80 82 89 102 133 Table 3 Summary of assessment of potential damages and impacts to structures Condition Annualized Damage, $ Annualized Benefit, $ # of Structures with Risk Removed # of Structures with Risk Reduced # of Structures with Risk Increased # of Structures with Risk Added Total Structures at Risk of Flood Damage Existing $362,600 --- --- --- --- --- 160 “Big” $260,400 $102,200 6 106 0 0 154 “Bigger” $190,100 $172,500 19 138 0 0 141 “Biggest” $181,800 $180,800 27 139 0 0 133 Table 4 Summary of the potential neighborhood-wide damages in dollars due to flooding by storm event up to the 1%-annual-chance event (ACE) [100-year event] Condition 5-year 20% ACE 10-year 10% ACE 25-year 4% ACE 50-year 2% ACE 100-year 1% ACE Existing $1,037,000 $1,588,000 $1,999,000 $2,349,000 $3,003,000 “Big” $703,000 $1,149,000 $1,413,000 $1,898,000 $2,712,000 “Bigger” $661,000 $838,000 $1,081,000 $1,261,000 $1,617,000 “Biggest” $660,500 $828,500 $995,600 $1,185,000 $1,391,000 To: Jessica Wilson and Ross Bintner, City of Edina From: Cory Anderson, Greg Williams, and Sarah Stratton Subject: Infrastructure Options to Reduce Flood Risk in the Morningside Neighborhood Date: February 3, 2020 Page: 15 P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Mitigation Alternatives Technical Memo\Jan2021 Memo\Morningside_Flood_Infrastructure_Technical_Memo_02032021.docx Table 5 Summary of the neighborhood-wide benefits (reduction in damages) in dollars by storm event up to the 1%-annual-chance event (ACE) [100-year event] Condition 5-year 20% ACE 10-year 10% ACE 25-year 4% ACE 50-year 2% ACE 100-year 1% ACE Existing --- --- --- --- --- “Big” $334,000 $439,000 $586,000 $451,000 $291,000 “Bigger” $376,000 $750,000 $918,000 $1,088,000 $1,386,000 “Biggest” $377,000 $759,000 $1,003,000 $1,164,000 $1,612,000 The estimates of damages neighborhood-wide (Table 4) and the benefits (Table 5) are not the annualized damages and benefits, but the estimated total (in dollars) for particular storm events (20%-annual-chance event through 1%-annual-chance event). They show the total neighborhood-wide estimated damage (dollars) and benefit (reduction in damages in dollars) for each of the listed storm events. An Engineer’s planning-level opinion of probable construction cost had been developed for each of the previous flood risk reduction options (reference (3) and (5)). The costs were updated to reflect the three levels of the refined options (“Big,” “Bigger,” and “Biggest”) and are included as Attachment E. The planning-level opinions of probable construction cost are intended to aid in evaluating and comparing flood risk reduction options and should not be assumed as absolute values for each option. These opinions of probable cost generally correspond to standards established by the Association for the Advancement of Cost Engineering (AACE). This cost estimate is characterized by limited project definition, widescale use of parametric models to calculate estimated costs (i.e., making extensive use of order-of- magnitude costs from similar projects or proposals), and uncertainty. The estimated accuracy range for the opinions of probable cost developed as part of this analysis is -30% to +50%. All estimated construction costs are presented in 2020 U.S. dollars and include costs for engineering and project administration. Further details of the planning-level opinions of probable cost are included in the memo detailing the previous effort (reference (3)). Estimated construction costs were compared to the total annualized benefit of each flood mitigation option, divided over an assumed 60-year period (valuable life of the project). Benefit/cost (B/C) ratios greater than one (1) indicate the estimated reduction in flood damage expected from a given mitigation option is greater than the cost to implement that mitigation option. B/C ratios are presented in Table 6. To: Jessica Wilson and Ross Bintner, City of Edina From: Cory Anderson, Greg Williams, and Sarah Stratton Subject: Infrastructure Options to Reduce Flood Risk in the Morningside Neighborhood Date: February 3, 2020 Page: 16 P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Mitigation Alternatives Technical Memo\Jan2021 Memo\Morningside_Flood_Infrastructure_Technical_Memo_02032021.docx Table 6 Economic assessment of the flood risk reduction options Condition Annualized Damage, $ Annualized Benefit, $ Improvement Cost, $ Annual Improvement Cost, $ Benefit – Cost Benefit / Cost Ratio Existing $362,600 --- --- --- --- --- “Big” $260,400 $102,200 $5.5M $92,000 $10,200 1.1 “Bigger” $190,100 $172,500 $11.2M $187,000 -$14,500 0.9 “Biggest” $181,800 $180,800 $15.8M $263,000 -$82,200 0.7 The “Big” option of limited additional storage and conveyance capacity is the only option with a B/C ratio greater than 1. However, this refined option reduces flood risk to the fewest number of homes and has limited potential for adding future flood risk reduction efforts. The “Biggest” option has the lowest B/C ratio at 0.7. Additionally, the “Biggest” option reduces risk for a number of homes that is similar to the “Bigger” option, which costs nearly $5M less to design and construct. Regardless of the resulting B/C ratios, the ETE discussions with additional local engineering experts confirmed that the refined options use the most cost-effective approaches applicable in this area. The design phase of any selected flood risk reduction option will also provide further opportunity to evaluate expanding benefits and reducing cost. Additional discussion on the costs and benefits of several of the components is also provided in Section 5.0. 5.0 Tradeoffs and Opportunities To provide a significant flood risk reduction benefit in the Morningside neighborhood, large infrastructure changes are required. With some of those large infrastructure changes come similarly large changes to the landscape. Because the neighborhood is mostly developed and open space is limited, the remaining open space is highly valued by the community. However, as described herein, additional storage is a necessary component to reduce flood risk, and storage underground and out of sight is not economically feasible for this site. Therefore, there are some social, aesthetic, and recreational tradeoffs and opportunities to consider as the City evaluates the feasibility of the refined options. The swale through Weber Park (feature #2) will utilize park space and require moving or reconfiguring some athletic fields. • The benefits or opportunities are that the swale collects and concentrates runoff from the park (versus diffusive flow in the existing condition), has high conveyance capacity as an open channel feature, and could have water quality and infiltration benefits. If properly designed, the swale could be an attractive feature that also provides clean-water benefits. To: Jessica Wilson and Ross Bintner, City of Edina From: Cory Anderson, Greg Williams, and Sarah Stratton Subject: Infrastructure Options to Reduce Flood Risk in the Morningside Neighborhood Date: February 3, 2020 Page: 17 P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Mitigation Alternatives Technical Memo\Jan2021 Memo\Morningside_Flood_Infrastructure_Technical_Memo_02032021.docx • If the loss of the space in Weber Park is not acceptable, an alternative means of conveyance is needed. It may be possible to further increase the pipe capacity (increase pipe size) under W 42nd Street (feature #9) to Weber Pond. This will need more study in the design phase to confirm constructability with related utility conflicts. The box culvert outlet (feature #3) from the open space between Lynn Avenue and Kipling Avenue would be eliminated and the new outlet from the southeast corner of the inundation area would become much larger. With this tradeoff, the potential for water quality and infiltration benefits is lost, and stormwater is kept underground and hidden, removing the potential for a water feature in Weber Park. The expansion of Weber Pond into the woods to the north modifies that open space from its current use. • The benefits or opportunities are that the expanded pond provides the storage required to maximize neighborhood flood risk reduction at a much lower cost than underground storage. The expanded pond could also provide passive recreation benefit through improvement of trails and enhancement of the natural resource habitat. The design phase should employ landscape architectural design to refine and promote a well-utilized recreational space if the open water feature is maintained; this may include boardwalks, viewing alcoves, or other community features. • If the loss of some of the woods to the north of Weber Pond is not acceptable, an alternative means of storage is needed. If the woods are more valuable to the community than the sports fields, then it may be preferable to leave the woods intact and expand Weber Pond into the sports fields area (i.e., making feature #11 actual pond space and removing the sports fields). The anticipated use of predictive pumping significantly increases the effective storage available within the neighborhood, but introduces some uncertainty related to feasibility and operations. • The benefits or opportunities of predictive pumping include a significant increase in available storage achieved with a relatively small increase in cost. Increased storage is a foundational component of the refined options, and predictive pumping allows more effective storage to be achieved with a smaller footprint and, therefore, less impact to existing natural areas and open space. • Predictive pumping has operational risks that may affect performance (e.g., pump failure, difficulty in predicting large precipitation events, downstream water levels that limit pumping). Uncertainty related to predictive pumping is evaluated in greater detail in Section 3.1 of reference (5). These risks may be mitigated by the development of an operating plan. Additional uncertainty in feasibility (e.g., permitting requirements) must also be considered during optimization of any refined options including predictive pumping (see Section 6.0). Additional storage will be required to realize similar benefits without predictive pumping. Storage options may include Weber Park athletic fields, private property, and/or Minikhada Vista Park in St. Louis Park. Private property and St. Louis Park property each come with additional cost and To: Jessica Wilson and Ross Bintner, City of Edina From: Cory Anderson, Greg Williams, and Sarah Stratton Subject: Infrastructure Options to Reduce Flood Risk in the Morningside Neighborhood Date: February 3, 2020 Page: 18 P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Mitigation Alternatives Technical Memo\Jan2021 Memo\Morningside_Flood_Infrastructure_Technical_Memo_02032021.docx tradeoffs that are uncertain because they are not under the City’s direct control. Several of these options were removed from consideration due to cost, complexity, and other factors (e.g., being outside City jurisdiction). The “Big” option provides a measure of the benefits achieved without the predictive pumping. Modifications to the storm sewer present an opportunity to alter the large conveyance pipe underneath Crocker Avenue and W 42nd Street. • The benefits or opportunities of modifying the storm sewer at Crocker Avenue and W 42nd Street include the potential to add connections to alleviate backyard flooding issues. The flood risk in these types of areas is primarily due to winter melt, which allows residents the ability to anticipate issues and prepare temporary pumping or other mitigation (due to the relatively slow nature of winter melt). • Tradeoffs to this possible action include the need for land acquisition and/or easements for access and structures. Additionally, connection of landlocked areas will transfer flood risk to downstream areas where it may pose greater risk to structures and will require additional storage. This opportunity was removed from consideration at this point in time due to concerns about feasibility and the City’s preference to avoid acquisitions. It is worth noting however that the refined options currently provide more benefit in the “downstream” portions of the neighborhood where there are large storage features (see Figures B-7, C-7, and D-7 in Appendices B, C, and D, respectively) so that in the future, additional stormwater connections can be made, thereby increasing benefits throughout the neighborhood. 6.0 Conclusions The Morningside neighborhood has a high potential for flood damage. Detailed flood-related studies have been completed in the past few years in advance of expected street reconstruction in 2022 and 2023. These studies have continually and transparently refined flood risk reduction options, considering the economics, the benefits, and the values of the community, using direct engagement with the Flood Risk Reduction Task Force for the earlier effort (July 2019 through February 2020), and a specific engagement plan as part of this effort. Given the space available in the neighborhood, the values of the community, and the funding that is expected to be available, refined options to reduce flood risk in an optimized way have been summarized and presented in this memo. The “Big” option of limited additional storage and conveyance capacity is the only option with a benefit- to-cost (B/C) ratio greater than 1. However, this refined option reduces flood risk to the fewest number of homes with limited potential for coordination with future flood risk reduction efforts. The “Bigger” option is the minimum required to extend the benefit neighborhood wide. The “Biggest” option has the lowest B/C ratio at 0.7. Additionally, the “Biggest” option reduces risk for a number of homes that is similar to the “Bigger” option, which costs nearly $5M less to design and construct To: Jessica Wilson and Ross Bintner, City of Edina From: Cory Anderson, Greg Williams, and Sarah Stratton Subject: Infrastructure Options to Reduce Flood Risk in the Morningside Neighborhood Date: February 3, 2020 Page: 19 P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Mitigation Alternatives Technical Memo\Jan2021 Memo\Morningside_Flood_Infrastructure_Technical_Memo_02032021.docx Upon approval to continue pursuing final design of a flood risk reduction project in the Morningside neighborhood, the chosen refined option should be optimized once more in final design to match the overall cost with the approved funding. This effort will coincide with additional evaluation of predictive pumping feasibility and permitting, including coordination with the Minnesota Department of Natural Resources (MDNR), Minnehaha Creek Watershed District (MCWD), and the City of Minneapolis. The final design should consider detailed topographic survey data, wetland permitting, potential flood insurance impacts, groundwater levels, and soils information from boreholes. The final design should also reconsider the tradeoffs and opportunities and be reassessed for geographical balance that addresses risk reduction and benefits, as discussed in Section 5.0. After optimizing the option to match funding and account for tradeoffs and opportunities, the option should also be reassessed to finalize the estimate of flood damage reduction benefits. 7.0 References 1. City of Edina. 2018 Comprehensive Water Resources Management Plan. Edina, MN : s.n., July 2018. 2. —. 2020 Street Reconstruction Projects. City of Edina. [Online] https://www.bettertogetheredina.org/2020StreetRecon. 3. Barr Engineering Co. Morningside Neighborhood Flood Risk Reduction Strategy Conceptual Study. November, 2018. 4. —. Morningside XP-SWMM Modeling. April, 2020. 5. —. Morningside Neighborhood Flood Infrastructure Project. October, 2020. 6. City of Edina. Flood Risk Reduction Strategy. s.l. : City of Edina Engineering Department, 2020. 7. —. City Service Status: Flooding and Drainage. City of Edina. [Online] 8. —. Flooding and Drainage. City of Edina. [Online] August 2020. https://www.edinamn.gov/371/Flooding-and-Drainage. 9. —. Better Together. Morningside Flood Infrastructure Project. [Online] August 2020. https://www.bettertogetheredina.org/6145/widgets/19058/documents/11586. 10. —. Edina Morningside Neighborhood Flood Risk Reduction Concepts. Edina, MN : s.n., September 2018. 11. FEMA. Estimated Flood Loss Potential. Flood Loss Estimations 2017. [Online] [Cited: September 1, 2018.] https://www.fema.gov/media-library-data/1499290622913- 0bcd74f47bf20aa94998a5a920837710/Flood_Loss_Estimations_2017.pdf. Attachment A Existing Conditions Inundation Maps and Structure Impacts Kojetin Park Open Space 5 OpenSpace 6 WeberField Park Weber Woods LynnFrance40th 42nd Morningside 44th SunnysideLittel SidellGrimesNatchezOa k d a l e C u r v e Eaton45th InglewoodBranson CrockerAldenScottKiplingMontereyBarr Footer: ArcGIS 10.7.1, 2020-09-15 19:30 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig A-1 Existing Conditions 20% AEP.mxd User: EMA 20% ACE INUNDATION AND TOTAL FLOOD RISK EXISTING CONDITIONSFIGURE A-1 Imagery: Hennepin County, 2018 Inundation Depth (feet) < 0.1 feet 0.1 - 1 feet 1 - 3 feet 3 - 6 feet 6 - 9 feet 9 - 12 feet > 12 feet Total Flood Risk (160 Homes at Risk) 234 No Risk1 - Lowest Risk 5 - Highest Risk !;N 0 175 350 Feet Note: Total Flood Risk accountsfor all storm events modeled, notthe risk for an individual storm. Kojetin Park Open Space 5 OpenSpace 6 WeberField Park Weber Woods LynnFrance40th 42nd Morningside 44th SunnysideLittel SidellGrimesNatchezOa k d a l e C u r v e Eaton45th InglewoodBranson CrockerAldenScottKiplingMontereyBarr Footer: ArcGIS 10.7.1, 2020-09-15 19:33 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig A-2 Existing Conditions 10% AEP.mxd User: EMA 10% ACE INUNDATION AND TOTAL FLOOD RISK EXISTING CONDITIONSFIGURE A-2 Imagery: Hennepin County, 2018 Inundation Depth (feet) < 0.1 feet 0.1 - 1 feet 1 - 3 feet 3 - 6 feet 6 - 9 feet 9 - 12 feet > 12 feet Total Flood Risk (160 Homes at Risk) 234 No Risk1 - Lowest Risk 5 - Highest Risk !;N 0 175 350 Feet Note: Total Flood Risk accountsfor all storm events modeled, notthe risk for an individual storm. Kojetin Park Open Space 5 OpenSpace 6 WeberField Park Weber Woods LynnFrance40th 42nd Morningside 44th SunnysideLittel SidellGrimesNatchezOa k d a l e C u r v e Eaton45th InglewoodBranson CrockerAldenScottKiplingMontereyBarr Footer: ArcGIS 10.7.1, 2020-09-15 19:33 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig A-3 Existing Conditions 4% AEP.mxd User: EMA 4% ACE INUNDATION AND TOTAL FLOOD RISK EXISTING CONDITIONSFIGURE A-3 Imagery: Hennepin County, 2018 Inundation Depth (feet) < 0.1 feet 0.1 - 1 feet 1 - 3 feet 3 - 6 feet 6 - 9 feet 9 - 12 feet > 12 feet Total Flood Risk (160 Homes at Risk) 234 No Risk1 - Lowest Risk 5 - Highest Risk !;N 0 175 350 Feet Note: Total Flood Risk accountsfor all storm events modeled, notthe risk for an individual storm. Kojetin Park Open Space 5 OpenSpace 6 WeberField Park Weber Woods LynnFrance40th 42nd Morningside 44th SunnysideLittel SidellGrimesNatchezOa k d a l e C u r v e Eaton45th InglewoodBranson CrockerAldenScottKiplingMontereyBarr Footer: ArcGIS 10.7.1, 2020-09-15 19:33 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig A-4 Existing Conditions 2% AEP.mxd User: EMA 2% ACE INUNDATION AND TOTAL FLOOD RISK EXISTING CONDITIONSFIGURE A-4 Inundation Depth (feet) < 0.1 feet 0.1 - 1 feet 1 - 3 feet 3 - 6 feet 6 - 9 feet 9 - 12 feet > 12 feet Total Flood Risk (160 Homes at Risk) 234 No Risk1 - Lowest Risk 5 - Highest Risk !;N 0 175 350 Feet Note: Total Flood Risk accountsfor all storm events modeled, notthe risk for an individual storm. Kojetin Park Open Space 5 OpenSpace 6 WeberField Park Weber Woods LynnFrance40th 42nd Morningside 44th SunnysideLittel SidellGrimesNatchezOa k d a l e C u r v e Eaton45th InglewoodBranson CrockerAldenScottKiplingMontereyBarr Footer: ArcGIS 10.7.1, 2020-09-16 07:58 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig A-5 Existing Conditions 1% AEP.mxd User: EMA 1% ACE INUNDATION AND TOTAL FLOOD RISK EXISTING CONDITIONSFIGURE A-5 !;N Inundation Depth (feet) < 0.1 feet 0.1 - 1 feet 1 - 3 feet 3 - 6 feet 6 - 9 feet 9 - 12 feet > 12 feet 0 175 350 Feet Total Flood Risk (160 Homes at Risk) 234 No Risk1 - Lowest Risk 5 - Highest Risk Note: Total Flood Risk accountsfor all storm events modeled, notthe risk for an individual storm. Kojetin Park Open Space 5 OpenSpace 6 WeberField Park Weber Woods LynnFrance40th 42nd Morningside 44th SunnysideLittel SidellGrimesNatchezOa k d a l e C u r v e Eaton45th InglewoodBranson CrockerAldenScottKiplingMontereyBarr Footer: ArcGIS 10.7.1, 2020-09-15 19:33 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig A-6 Existing Conditions 0.2% AEP.mxd User: EMA 0.2% ACE INUNDATION AND TOTAL FLOOD RISK EXISTING CONDITIONSFIGURE A-6 Imagery: Hennepin County, 2018 Inundation Depth (feet) < 0.1 feet 0.1 - 1 feet 1 - 3 feet 3 - 6 feet 6 - 9 feet 9 - 12 feet > 12 feet Total Flood Risk (160 Homes at Risk) 234 No Risk1 - Lowest Risk 5 - Highest Risk !;N 0 175 350 Feet Note: Total Flood Risk accountsfor all storm events modeled, notthe risk for an individual storm. P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Mitigation Alternatives Technical Memo\Jan2021 Memo\Morningside_Flood_Infrastructure_Technical_Memo_02032021.docx Attachment B Refined Option at the ~$15M Cost Inundation Maps and Structure Impacts Kojetin Park Open Space 5 OpenSpace 6 WeberField Park Weber Woods LynnFrance40th 42nd Morningside 44th SunnysideLittel SidellGrimesNatchezOa k d a l e C u r v e Eaton45th InglewoodBranson CrockerAldenScottKiplingMontereyBarr Footer: ArcGIS 10.7.1, 2020-09-15 20:05 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig F-1 Option 10 20% AEP.mxd User: EMA 20% ACE INUNDATION AND TOTAL FLOOD RISK REFINED COMBINATION OPTION, ~$15M COST FIGURE B-1 Imagery: Hennepin County, 2018 Inundation Depth (feet) < 0.1 feet 0.1 - 1 feet 1 - 3 feet 3 - 6 feet 6 - 9 feet 9 - 12 feet > 12 feet 234 1 - Lowest Risk 5 - Highest Risk No Risk Added Risk (0 home) Homes Removed fromRisk (27 homes) !;N 0 175 350 Feet Note: Total Flood Risk accountsfor all storm events modeled, notthe risk for an individual storm. Total Flood Risk (133 Homes at Risk) Kojetin Park Open Space 5 OpenSpace 6 WeberField Park Weber Woods LynnFrance40th 42nd Morningside 44th SunnysideLittel SidellGrimesNatchezOa k d a l e C u r v e Eaton45th InglewoodBranson CrockerAldenScottKiplingMontereyBarr Footer: ArcGIS 10.7.1, 2020-09-15 20:05 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig F-1 Option 10 20% AEP.mxd User: EMA 10% ACE INUNDATION AND TOTAL FLOOD RISK REFINED COMBINATION OPTION, ~$15M COST FIGURE B-2 Imagery: Hennepin County, 2018 Inundation Depth (feet) < 0.1 feet 0.1 - 1 feet 1 - 3 feet 3 - 6 feet 6 - 9 feet 9 - 12 feet > 12 feet 234 1 - Lowest Risk 5 - Highest Risk No Risk Added Risk (0 home) Homes Removed fromRisk (27 homes) !;N 0 175 350 Feet Note: Total Flood Risk accountsfor all storm events modeled, notthe risk for an individual storm. Total Flood Risk (133 Homes at Risk) Kojetin Park Open Space 5 OpenSpace 6 WeberField Park Weber Woods LynnFrance40th 42nd Morningside 44th SunnysideLittel SidellGrimesNatchezOa k d a l e C u r v e Eaton45th InglewoodBranson CrockerAldenScottKiplingMontereyBarr Footer: ArcGIS 10.7.1, 2020-09-15 20:05 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig F-1 Option 10 20% AEP.mxd User: EMA 4% ACE INUNDATION AND TOTAL FLOOD RISK REFINED COMBINATION OPTION, ~$15M COST FIGURE B-3 Imagery: Hennepin County, 2018 Inundation Depth (feet) < 0.1 feet 0.1 - 1 feet 1 - 3 feet 3 - 6 feet 6 - 9 feet 9 - 12 feet > 12 feet 234 1 - Lowest Risk 5 - Highest Risk No Risk Added Risk (0 home) Homes Removed fromRisk (27 homes) !;N 0 175 350 Feet Note: Total Flood Risk accountsfor all storm events modeled, notthe risk for an individual storm. Total Flood Risk (133 Homes at Risk) Kojetin Park Open Space 5 OpenSpace 6 WeberField Park Weber Woods LynnFrance40th 42nd Morningside 44th SunnysideLittel SidellGrimesNatchezOa k d a l e C u r v e Eaton45th InglewoodBranson CrockerAldenScottKiplingMontereyBarr Footer: ArcGIS 10.7.1, 2020-09-15 20:05 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig F-1 Option 10 20% AEP.mxd User: EMA 2% ACE INUNDATION AND TOTAL FLOOD RISK REFINED COMBINATION OPTION, ~$15M COST FIGURE B-4 Imagery: Hennepin County, 2018 Inundation Depth (feet) < 0.1 feet 0.1 - 1 feet 1 - 3 feet 3 - 6 feet 6 - 9 feet 9 - 12 feet > 12 feet 234 1 - Lowest Risk 5 - Highest Risk No Risk Added Risk (0 home) Homes Removed fromRisk (27 homes) !;N 0 175 350 Feet Note: Total Flood Risk accountsfor all storm events modeled, notthe risk for an individual storm. Total Flood Risk (133 Homes at Risk) Kojetin Park Open Space 5 OpenSpace 6 WeberField Park Weber Woods LynnFrance40th 42nd Morningside 44th SunnysideLittel SidellGrimesNatchezOa k d a l e C u r v e Eaton45th InglewoodBranson CrockerAldenScottKiplingMontereyBarr Footer: ArcGIS 10.7.1, 2020-09-15 20:05 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig F-1 Option 10 20% AEP.mxd User: EMA 1% ACE INUNDATION AND TOTAL FLOOD RISK REFINED COMBINATION OPTION, ~$15M COST FIGURE B-5 Imagery: Hennepin County, 2018 Inundation Depth (feet) < 0.1 feet 0.1 - 1 feet 1 - 3 feet 3 - 6 feet 6 - 9 feet 9 - 12 feet > 12 feet 234 1 - Lowest Risk 5 - Highest Risk No Risk Added Risk (0 home) Homes Removed fromRisk (27 homes) !;N 0 175 350 Feet Note: Total Flood Risk accountsfor all storm events modeled, notthe risk for an individual storm. Total Flood Risk (133 Homes at Risk) Kojetin Park Open Space 5 OpenSpace 6 WeberField Park Weber Woods LynnFrance40th 42nd Morningside 44th SunnysideLittel SidellGrimesNatchezOa k d a l e C u r v e Eaton45th InglewoodBranson CrockerAldenScottKiplingMontereyBarr Footer: ArcGIS 10.7.1, 2020-09-15 20:05 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig F-1 Option 10 20% AEP.mxd User: EMA 0.2% ACE INUNDATION AND TOTAL FLOOD RISK REFINED COMBINATION OPTION, ~$15M COST FIGURE B-6 Imagery: Hennepin County, 2018 Inundation Depth (feet) < 0.1 feet 0.1 - 1 feet 1 - 3 feet 3 - 6 feet 6 - 9 feet 9 - 12 feet > 12 feet 234 1 - Lowest Risk 5 - Highest Risk No Risk Added Risk (0 home) Homes Removed fromRisk (27 homes) !;N 0 175 350 Feet Note: Total Flood Risk accountsfor all storm events modeled, notthe risk for an individual storm. Total Flood Risk (133 Homes at Risk) $15,600; 64%$51,700; 98% $20,100; 40% $1,600; 6% $500; 4% $63,200; 79% $3,400; 14%$17,400; 25%$7,200; 28% Sources: Esri, HERE, Garmin, USGS, Intermap, INCREMENT P, NRCan, Esri Japan, METI, Esri China(Hong Kong), Esri Korea, Esri (Thailand), NGCC, (c) OpenStreetMap contributors, and the GIS UserCommunity Barr Footer: ArcGIS 10.7.1, 2021-01-18 16:20 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig B-7 Option 12 Zone Benefits.mxd User: EMA FIGURE B-7 0 175 350 Feet Primary Structures Annualized Damage Reduction, $ < $10,000 $10,000 - $20,000 $20,000 - $30,000 $30,000 - $40,000 $40,000 - $50,000 $50,000 - $60,000 $60,000 - $70,000 TOTAL FLOOD RISKREDUCTION AS ADOLLAR AMOUNT ANDAS A PERCENTAGE REFINED COMBINATIONOPTION, ~$15M COST P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Mitigation Alternatives Technical Memo\Jan2021 Memo\Morningside_Flood_Infrastructure_Technical_Memo_02032021.docx Attachment C Refined Option at the ~$10M Cost Inundation Maps and Structure Impacts Kojetin Park Open Space 5 OpenSpace 6 WeberField Park Weber Woods LynnFrance40th 42nd Morningside 44th SunnysideLittel SidellGrimesNatchezOa k d a l e C u r v e Eaton45th InglewoodBranson CrockerAldenScottKiplingMontereyBarr Footer: ArcGIS 10.7.1, 2020-09-15 20:05 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig F-1 Option 10 20% AEP.mxd User: EMA 20% ACE INUNDATION AND TOTAL FLOOD RISK REFINED COMBINATION OPTION, ~$10M COST FIGURE C-1 Imagery: Hennepin County, 2018 Inundation Depth (feet) < 0.1 feet 0.1 - 1 feet 1 - 3 feet 3 - 6 feet 6 - 9 feet 9 - 12 feet > 12 feet 234 1 - Lowest Risk 5 - Highest Risk No Risk Added Risk (0 home) Homes Removed fromRisk (19 homes) !;N 0 175 350 Feet Note: Total Flood Risk accountsfor all storm events modeled, notthe risk for an individual storm. Total Flood Risk (141 Homes at Risk) Kojetin Park Open Space 5 OpenSpace 6 WeberField Park Weber Woods LynnFrance40th 42nd Morningside 44th SunnysideLittel SidellGrimesNatchezOa k d a l e C u r v e Eaton45th InglewoodBranson CrockerAldenScottKiplingMontereyBarr Footer: ArcGIS 10.7.1, 2020-09-15 20:05 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig F-1 Option 10 20% AEP.mxd User: EMA 10% ACE INUNDATION AND TOTAL FLOOD RISK REFINED COMBINATION OPTION, ~$10M COST FIGURE C-2 Imagery: Hennepin County, 2018 Inundation Depth (feet) < 0.1 feet 0.1 - 1 feet 1 - 3 feet 3 - 6 feet 6 - 9 feet 9 - 12 feet > 12 feet 234 1 - Lowest Risk 5 - Highest Risk No Risk Added Risk (0 home) Homes Removed fromRisk (19 homes) !;N 0 175 350 Feet Note: Total Flood Risk accountsfor all storm events modeled, notthe risk for an individual storm. Total Flood Risk (141 Homes at Risk) Kojetin Park Open Space 5 OpenSpace 6 WeberField Park Weber Woods LynnFrance40th 42nd Morningside 44th SunnysideLittel SidellGrimesNatchezOa k d a l e C u r v e Eaton45th InglewoodBranson CrockerAldenScottKiplingMontereyBarr Footer: ArcGIS 10.7.1, 2020-09-15 20:05 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig F-1 Option 10 20% AEP.mxd User: EMA 4% ACE INUNDATION AND TOTAL FLOOD RISK REFINED COMBINATION OPTION, ~$10M COST FIGURE C-3 Imagery: Hennepin County, 2018 Inundation Depth (feet) < 0.1 feet 0.1 - 1 feet 1 - 3 feet 3 - 6 feet 6 - 9 feet 9 - 12 feet > 12 feet 234 1 - Lowest Risk 5 - Highest Risk No Risk Added Risk (0 home) Homes Removed fromRisk (19 homes) !;N 0 175 350 Feet Note: Total Flood Risk accountsfor all storm events modeled, notthe risk for an individual storm. Total Flood Risk (141 Homes at Risk) Kojetin Park Open Space 5 OpenSpace 6 WeberField Park Weber Woods LynnFrance40th 42nd Morningside 44th SunnysideLittel SidellGrimesNatchezOa k d a l e C u r v e Eaton45th InglewoodBranson CrockerAldenScottKiplingMontereyBarr Footer: ArcGIS 10.7.1, 2020-09-15 20:05 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig F-1 Option 10 20% AEP.mxd User: EMA 2% ACE INUNDATION AND TOTAL FLOOD RISK REFINED COMBINATION OPTION, ~$10M COST FIGURE C-4 Imagery: Hennepin County, 2018 Inundation Depth (feet) < 0.1 feet 0.1 - 1 feet 1 - 3 feet 3 - 6 feet 6 - 9 feet 9 - 12 feet > 12 feet 234 1 - Lowest Risk 5 - Highest Risk No Risk Added Risk (0 home) Homes Removed fromRisk (19 homes) !;N 0 175 350 Feet Note: Total Flood Risk accountsfor all storm events modeled, notthe risk for an individual storm. Total Flood Risk (141 Homes at Risk) Kojetin Park Open Space 5 OpenSpace 6 WeberField Park Weber Woods LynnFrance40th 42nd Morningside 44th SunnysideLittel SidellGrimesNatchezOa k d a l e C u r v e Eaton45th InglewoodBranson CrockerAldenScottKiplingMontereyBarr Footer: ArcGIS 10.7.1, 2020-09-15 20:05 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig F-1 Option 10 20% AEP.mxd User: EMA 1% ACE INUNDATION AND TOTAL FLOOD RISK REFINED COMBINATION OPTION, ~$10M COST FIGURE C-5 Imagery: Hennepin County, 2018 Inundation Depth (feet) < 0.1 feet 0.1 - 1 feet 1 - 3 feet 3 - 6 feet 6 - 9 feet 9 - 12 feet > 12 feet 234 1 - Lowest Risk 5 - Highest Risk No Risk Added Risk (0 home) Homes Removed fromRisk (19 homes) !;N 0 175 350 Feet Note: Total Flood Risk accountsfor all storm events modeled, notthe risk for an individual storm. Total Flood Risk (141 Homes at Risk) Kojetin Park Open Space 5 OpenSpace 6 WeberField Park Weber Woods LynnFrance40th 42nd Morningside 44th SunnysideLittel SidellGrimesNatchezOa k d a l e C u r v e Eaton45th InglewoodBranson CrockerAldenScottKiplingMontereyBarr Footer: ArcGIS 10.7.1, 2020-09-15 20:05 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig F-1 Option 10 20% AEP.mxd User: EMA 0.2% ACE INUNDATION AND TOTAL FLOOD RISK REFINED COMBINATION OPTION, ~$10M COST FIGURE C-6 Imagery: Hennepin County, 2018 Inundation Depth (feet) < 0.1 feet 0.1 - 1 feet 1 - 3 feet 3 - 6 feet 6 - 9 feet 9 - 12 feet > 12 feet 234 1 - Lowest Risk 5 - Highest Risk No Risk Added Risk (0 home) Homes Removed fromRisk (19 homes) !;N 0 175 350 Feet Note: Total Flood Risk accountsfor all storm events modeled, notthe risk for an individual storm. Total Flood Risk (141 Homes at Risk) $13,100; 54%$48,900; 93% $17,800; 35% $1,600; 6% $500; 4% $63,000; 79% $3,400; 14%$16,900; 24%$7,200; 28% Sources: Esri, HERE, Garmin, USGS, Intermap, INCREMENT P, NRCan, Esri Japan, METI, Esri China(Hong Kong), Esri Korea, Esri (Thailand), NGCC, (c) OpenStreetMap contributors, and the GIS UserCommunity Barr Footer: ArcGIS 10.7.1, 2021-01-18 16:15 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig C-7 Option 12 Zone Benefits.mxd User: EMA FIGURE C-7 0 175 350 Feet Primary Structures Annualized Damage Reduction, $ < $10,000 $10,000 - $20,000 $20,000 - $30,000 $30,000 - $40,000 $40,000 - $50,000 $50,000 - $60,000 $60,000 - $70,000 TOTAL FLOOD RISKREDUCTION AS ADOLLAR AMOUNT ANDAS A PERCENTAGE REFINED COMBINATIONOPTION, ~$10M COST P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Mitigation Alternatives Technical Memo\Jan2021 Memo\Morningside_Flood_Infrastructure_Technical_Memo_02032021.docx Attachment D Refined Option at the ~$5M Cost Inundation Maps and Structure Impacts Kojetin Park Open Space 5 OpenSpace 6 WeberField Park Weber Woods LynnFrance40th 42nd Morningside 44th SunnysideLittel SidellGrimesNatchezOa k d a l e C u r v e Eaton45th InglewoodBranson CrockerAldenScottKiplingMontereyBarr Footer: ArcGIS 10.7.1, 2020-09-15 20:05 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig F-1 Option 10 20% AEP.mxd User: EMA 20% ACE INUNDATION AND TOTAL FLOOD RISK REFINED COMBINATION OPTION, ~$5M COST FIGURE D-1 Imagery: Hennepin County, 2018 Inundation Depth (feet) < 0.1 feet 0.1 - 1 feet 1 - 3 feet 3 - 6 feet 6 - 9 feet 9 - 12 feet > 12 feet 234 1 - Lowest Risk 5 - Highest Risk No Risk Added Risk (0 home) Homes Removed fromRisk (6 homes) !;N 0 175 350 Feet Note: Total Flood Risk accountsfor all storm events modeled, notthe risk for an individual storm. Total Flood Risk (154 Homes at Risk) Kojetin Park Open Space 5 OpenSpace 6 WeberField Park Weber Woods LynnFrance40th 42nd Morningside 44th SunnysideLittel SidellGrimesNatchezOa k d a l e C u r v e Eaton45th InglewoodBranson CrockerAldenScottKiplingMontereyBarr Footer: ArcGIS 10.7.1, 2020-09-15 20:05 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig F-1 Option 10 20% AEP.mxd User: EMA 10% ACE INUNDATION AND TOTAL FLOOD RISK REFINED COMBINATION OPTION, ~$5M COST FIGURE D-2 Imagery: Hennepin County, 2018 Inundation Depth (feet) < 0.1 feet 0.1 - 1 feet 1 - 3 feet 3 - 6 feet 6 - 9 feet 9 - 12 feet > 12 feet 234 1 - Lowest Risk 5 - Highest Risk No Risk Added Risk (0 home) Homes Removed fromRisk (6 homes) !;N 0 175 350 Feet Note: Total Flood Risk accountsfor all storm events modeled, notthe risk for an individual storm. Total Flood Risk (154 Homes at Risk) Kojetin Park Open Space 5 OpenSpace 6 WeberField Park Weber Woods LynnFrance40th 42nd Morningside 44th SunnysideLittel SidellGrimesNatchezOa k d a l e C u r v e Eaton45th InglewoodBranson CrockerAldenScottKiplingMontereyBarr Footer: ArcGIS 10.7.1, 2020-09-15 20:05 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig F-1 Option 10 20% AEP.mxd User: EMA 4% ACE INUNDATION AND TOTAL FLOOD RISK REFINED COMBINATION OPTION, ~$5M COST FIGURE D-3 Imagery: Hennepin County, 2018 Inundation Depth (feet) < 0.1 feet 0.1 - 1 feet 1 - 3 feet 3 - 6 feet 6 - 9 feet 9 - 12 feet > 12 feet 234 1 - Lowest Risk 5 - Highest Risk No Risk Added Risk (0 home) Homes Removed fromRisk (6 homes) !;N 0 175 350 Feet Note: Total Flood Risk accountsfor all storm events modeled, notthe risk for an individual storm. Total Flood Risk (154 Homes at Risk) Kojetin Park Open Space 5 OpenSpace 6 WeberField Park Weber Woods LynnFrance40th 42nd Morningside 44th SunnysideLittel SidellGrimesNatchezOa k d a l e C u r v e Eaton45th InglewoodBranson CrockerAldenScottKiplingMontereyBarr Footer: ArcGIS 10.7.1, 2020-09-15 20:05 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig F-1 Option 10 20% AEP.mxd User: EMA 2% ACE INUNDATION AND TOTAL FLOOD RISK REFINED COMBINATION OPTION, ~$5M COST FIGURE D-4 Imagery: Hennepin County, 2018 Inundation Depth (feet) < 0.1 feet 0.1 - 1 feet 1 - 3 feet 3 - 6 feet 6 - 9 feet 9 - 12 feet > 12 feet 234 1 - Lowest Risk 5 - Highest Risk No Risk Added Risk (0 home) Homes Removed fromRisk (6 homes) !;N 0 175 350 Feet Note: Total Flood Risk accountsfor all storm events modeled, notthe risk for an individual storm. Total Flood Risk (154 Homes at Risk) Kojetin Park Open Space 5 OpenSpace 6 WeberField Park Weber Woods LynnFrance40th 42nd Morningside 44th SunnysideLittel SidellGrimesNatchezOa k d a l e C u r v e Eaton45th InglewoodBranson CrockerAldenScottKiplingMontereyBarr Footer: ArcGIS 10.7.1, 2020-09-15 20:05 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig F-1 Option 10 20% AEP.mxd User: EMA 1% ACE INUNDATION AND TOTAL FLOOD RISK REFINED COMBINATION OPTION, ~$5M COST FIGURE D-5 Imagery: Hennepin County, 2018 Inundation Depth (feet) < 0.1 feet 0.1 - 1 feet 1 - 3 feet 3 - 6 feet 6 - 9 feet 9 - 12 feet > 12 feet 234 1 - Lowest Risk 5 - Highest Risk No Risk Added Risk (0 home) Homes Removed fromRisk (6 homes) !;N 0 175 350 Feet Note: Total Flood Risk accountsfor all storm events modeled, notthe risk for an individual storm. Total Flood Risk (154 Homes at Risk) Kojetin Park Open Space 5 OpenSpace 6 WeberField Park Weber Woods LynnFrance40th 42nd Morningside 44th SunnysideLittel SidellGrimesNatchezOa k d a l e C u r v e Eaton45th InglewoodBranson CrockerAldenScottKiplingMontereyBarr Footer: ArcGIS 10.7.1, 2020-09-15 20:05 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig F-1 Option 10 20% AEP.mxd User: EMA 0.2% ACE INUNDATION AND TOTAL FLOOD RISK REFINED COMBINATION OPTION, ~$5M COST FIGURE D-6 Imagery: Hennepin County, 2018 Inundation Depth (feet) < 0.1 feet 0.1 - 1 feet 1 - 3 feet 3 - 6 feet 6 - 9 feet 9 - 12 feet > 12 feet 234 1 - Lowest Risk 5 - Highest Risk No Risk Added Risk (0 home) Homes Removed fromRisk (6 homes) !;N 0 175 350 Feet Note: Total Flood Risk accountsfor all storm events modeled, notthe risk for an individual storm. Total Flood Risk (154 Homes at Risk) $13,300; 54%$18,600; 35% $2,100; 4% $0; 0% $300; 2% $53,700; 67% $3,400; 14%$3,600; 5%$7,200; 28% Sources: Esri, HERE, Garmin, USGS, Intermap, INCREMENT P, NRCan, Esri Japan, METI, Esri China(Hong Kong), Esri Korea, Esri (Thailand), NGCC, (c) OpenStreetMap contributors, and the GIS UserCommunity Barr Footer: ArcGIS 10.7.1, 2021-01-18 16:24 File: I:\Client\Edina\Projects\Morningside FRRS 23271798\Maps\Fig D-7 Option 12 Zone Benefits.mxd User: EMA TOTAL FLOOD RISKREDUCTION AS ADOLLAR AMOUNT ANDAS A PERCENTAGE FIGURE D-7 0 175 350 Feet Primary Structures Annualized Damage Reduction, $ < $10,000 $10,000 - $20,000 $20,000 - $30,000 $30,000 - $40,000 $40,000 - $50,000 $50,000 - $60,000 $60,000 - $70,000 REFINED COMBINATIONOPTION, ~$5M COST P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Mitigation Alternatives Technical Memo\Jan2021 Memo\Morningside_Flood_Infrastructure_Technical_Memo_02032021.docx Attachment E Planning Level Opinion of Probable Construction Costs PREPARED BY: BARR ENGINEERING COMPANY SHEET:1 OF 5 BY:CDA DATE:8/27/2020 FEASIBILITY STUDY CHECKED BY:KJN2 DATE:12/3/2020 ENGINEER'S OPINION OF PROBABLE PROJECT COST APPROVED BY:DATE: PROJECT:Morningside FRR Preliminary Engineering ISSUED:DATE: LOCATION:City of Edina ISSUED:DATE: PROJECT #:23/27-1798.00 ISSUED:DATE: OPINION OF COST - SUMMARY ISSUED:DATE: Engineer's Opinion of Probable Project Cost Morningside Flood Mitigation Feasibility Project REFINED COMBINATION OPTION at ~$15M Cat.ESTIMATED No.ITEM DESCRIPTION UNIT QUANTITY UNIT COST ITEM COST General Mobilization/Demobilization (<10%)LS 1 $500,000.00 $500,000.00 Temporary Erosion Control LS 1 $70,000.00 $70,000.00 Flotation Silt Curtain LF 450 $11.00 $4,950.00 Excavate Excavation CY 69,000 $4.00 $276,000.00 Weber Pond Off Site Disposal of Excavated Material CY 69,000 $18.00 $1,242,000.00 Dewatering LS 1 $50,000.00 $50,000.00 Excavate Tree 2", B&B Each 150 $500.00 $75,000.00 Weber Woods Clearing and Grubbing AC 5 $8,500.00 $42,500.00 Excavation CY 89,000 $4.00 $356,000.00 Off Site Disposal of Excavated Material CY 89,000 $18.00 $1,602,000.00 Lower Sport Excavation CY 27,000 $4.00 $108,000.00 Fieds in Park Off Site Disposal of Excavated Material CY 27,000 $18.00 $486,000.00 Turf Establishment (w/ Disc Anchored Mulch)AC 1.2 $3,000.00 $3,636.09 Erosion Control Blanket SY 3,610 $3.00 $10,830.00 Remove and Rebuild 3 baseball diamonds LS 1 $300,000.00 $300,000.00 Excavation CY 15,000 $4.00 $60,000.00 Off Site Disposal of Excavated Material CY 15,000 $18.00 $270,000.00 Turf Establishment (w/ Disc Anchored Mulch)AC 1.4 $3,000.00 $4,338.84 Erosion Control Blanket SY 2,220 $3.00 $6,660.00 Remove and Rebuild ice hockey rink area LS 1 $50,000.00 $50,000.00 Swale Excavation CY 3,900 $4.00 $15,600.00 through Off Site Disposal of Excavated Material CY 3,900 $18.00 $70,200.00 Park Upland Native Vegetation AC 0.4 $5,000.00 $1,928.37 Erosion Control Blanket SY 1,870 $3.00 $5,610.00 Walking Trail LS 1 $7,000.00 $7,000.00 Avail Excavation CY 5,000 $4.00 $20,000.00 Academy Off Site Disposal of Excavated Material CY 5,000 $18.00 $90,000.00 Excavation Tree 2", B&B Each 25 $500.00 $12,500.00 Clearing and Grubbing AC 0.8 $8,500.00 $7,219.93 Upland Native Vegetation AC 0.8 $5,000.00 $4,247.02 24" RC Pipe Sewer (Furnish and Install) (12 - 13' depth)LF 400 $120.00 $48,000.00 Inglewood 36" RC Pipe Sewer (Furnish and Install) (8 - 13' depth)LF 1,000 $180.00 $180,000.00 Construct Drainage Structure SD-60 LF 30 $730.00 $21,900.00 Tie-In Storm Sewer Main to Manhole Each 2 $1,000.00 $2,000.00 Susan Excavation CY 20,000 $4.00 $80,000.00 Lindgren Off Site Disposal of Excavated Material CY 20,000 $18.00 $360,000.00 School Turf Establishment (w/ Disc Anchored Mulch)AC 2.5 $3,000.00 $7,575.76 Park Erosion Control Blanket SY 2,780 $3.00 $8,340.00 10' W x 4' H Box Culvert (Furnish and Install)LF 470 $650.00 $305,500.00 Open Space Excavation CY 29,000 $4.00 $116,000.00 Number 5 Off Site Disposal of Excavated Material CY 29,000 $18.00 $522,000.00 10' W x 4' H Box Culvert (Furnish and Install)LF 470 $650.00 $305,500.00 Dewatering LS 1 $50,000.00 $50,000.00 P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Cost Benefit methods\Engineers Opinion of Probable Cost_20201203.xlsx 1 PREPARED BY: BARR ENGINEERING COMPANY SHEET:1 OF 5 BY:CDA DATE:8/27/2020 FEASIBILITY STUDY CHECKED BY:KJN2 DATE:12/3/2020 ENGINEER'S OPINION OF PROBABLE PROJECT COST APPROVED BY:DATE: PROJECT:Morningside FRR Preliminary Engineering ISSUED:DATE: LOCATION:City of Edina ISSUED:DATE: PROJECT #:23/27-1798.00 ISSUED:DATE: OPINION OF COST - SUMMARY ISSUED:DATE: Engineer's Opinion of Probable Project Cost Morningside Flood Mitigation Feasibility Project REFINED COMBINATION OPTION at ~$15M Cat.ESTIMATED No.ITEM DESCRIPTION UNIT QUANTITY UNIT COST ITEM COST New / Remove and Dispose of Existing Storm Sewer LF 4,580 $20.00 $91,600.00 Additional Remove and Dispose of Existing Manhole/Catch Basin Each 22 $850.00 $18,700.00 Pipe Capacity 24" RC Pipe Sewer (Furnish and Install) (12 - 13' depth)LF 728 $120.00 $87,360.00 36" RC Pipe Sewer (Furnish and Install) (8 - 13' depth)LF 710 $180.00 $127,800.00 48" RC Pipe Sewer (Furnish and Install) (15' depth)LF 368 $300.00 $110,400.00 60" RC Pipe Sewer (Furnish and Install) (8 - 10' depth)LF 840 $320.00 $268,800.00 60" RC Pipe Sewer (Furnish and Install) (10 - 16' depth)LF 2,630 $400.00 $1,052,000.00 Construct Drainage Structure SD-48 LF 434 $450.00 $195,300.00 Construct Drainage Structure SD-60 LF 56 $730.00 $40,880.00 Construct Drainage Structure SD-72 LF 14 $970.00 $13,580.00 Construct Drainage Structure SD-84 LF 224 $1,360.00 $304,640.00 Casting Assembly Each 52 $800.00 $41,600.00 Tie-In Storm Sewer Main to Manhole Each 9 $1,000.00 $9,000.00 Connect CB Leads to Constructed Storm Sewer Each 68 $700.00 $47,600.00 Pump System Opti CMAC Predictive Pumping Control System (Furnish and Install)Each 1 $85,000.00 $85,000.00 For Weber Pond 4,000 GPM Pumping Station (Includes Building Structure, Electric Supply, Control Panel)LS 1 $700,000.00 $700,000.00 Pumping Station Outlet Piping (Furnish and Install)LF 1,100 $40.00 $44,000.00 Pumping Station Inlet Suction Piping (Furnish and Install)LF 100 $40.00 $4,000.00 CONSTRUCTION SUBTOTAL $11,001,000.00 CONSTRUCTION CONTINGENCY (30%)$3,300,000.00 ESTIMATED CONSTRUCTION COST $14,301,000.00 ENGINEERING, DESIGN, PERMITTING, AND CONSTRUCTION OBSERVATION (10%)$1,430,000.00 RESIDENTIAL/CONSTRUCTION PERMANENT EASEMENT $56,000.00 ESTIMATED TOTAL PROJECT COST $15,787,000.00 -30%$11,051,000.00 50%$23,681,000.00 Notes 6 Estimate costs are to design, construct, and permit each alternative. The estimated costs do not include maintenance, monitoring or additional tasks following construction. 7 Furnish and Install pipe cost per lineal foot includes all trenching, bedding, backfilling, compaction, and disposal of excess materials 8 Estimate costs are reported to nearest thousand dollars. ESTIMATED ACCURACY RANGE 1 Limited Design Work Completed 2 Quantities Based on Design Work Completed. 3 Unit Prices Based on Information Available at This Time. 4 Minimal Soil and Field Investigations Completed. Costs do not included remediation of contaminated soils (if found). 5 This feasibility-level (Class 4, 10-15% design completion per ASTM E 2516-06) cost estimate is based on feasibility-level designs, alignments, quantities and unit prices. Costs will change with further design. Time value-of-money escalation costs are not included. A construction schedule is not available at this time. Contingency is an allowance for the net sum of costs that will be in the Final Total Project Cost at the time of the completion of design, but are not included at this level of project definition. The estimated accuracy range for the Total Project Cost as the project is defined is -30% to +50%. The accuracy range is based on professional judgement considering the level of design completed, the complexity of the project and the uncertainties in the project as scoped. The contingency and the accuracy range are not intended to include costs for future scope changes that are not part of the project as currently scoped or costs for risk contingency. Operation and Maintenance costs are not included. P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Cost Benefit methods\Engineers Opinion of Probable Cost_20201203.xlsx 2 PREPARED BY: BARR ENGINEERING COMPANY SHEET:1 OF 5 BY:CDA DATE:8/27/2020 FEASIBILITY STUDY CHECKED BY:KJN2 DATE:12/3/2020 ENGINEER'S OPINION OF PROBABLE PROJECT COST APPROVED BY:DATE: PROJECT:Morningside FRR Preliminary Engineering ISSUED:DATE: LOCATION:City of Edina ISSUED:DATE: PROJECT #:23/27-1798.00 ISSUED:DATE: OPINION OF COST - SUMMARY ISSUED:DATE: Engineer's Opinion of Probable Project Cost Morningside Flood Mitigation Feasibility Project REFINED COMBINATION OPTION at ~$10M Cat.ESTIMATED No.ITEM DESCRIPTION UNIT QUANTITY UNIT COST ITEM COST General Mobilization/Demobilization (<10%)LS 1 $500,000.00 $500,000.00 Temporary Erosion Control LS 1 $50,000.00 $50,000.00 Flotation Silt Curtain LF 450 $11.00 $4,950.00 Excavate Excavation CY 49,000 $4.00 $196,000.00 Weber Pond Off Site Disposal of Excavated Material CY 49,000 $18.00 $882,000.00 Dewatering LS 1 $50,000.00 $50,000.00 Excavate Tree 2", B&B Each 150 $500.00 $75,000.00 Weber Woods Clearing and Grubbing AC 5 $8,500.00 $42,500.00 Excavation CY 76,000 $4.00 $304,000.00 Off Site Disposal of Excavated Material CY 76,000 $18.00 $1,368,000.00 Lower Sport Excavation CY $4.00 $0.00 Fieds in Park Off Site Disposal of Excavated Material CY $18.00 $0.00 Turf Establishment (w/ Disc Anchored Mulch)AC $3,000.00 $0.00 Erosion Control Blanket SY $3.00 $0.00 Remove and Rebuild 3 baseball diamonds LS $300,000.00 $0.00 Excavation CY $4.00 $0.00 Off Site Disposal of Excavated Material CY $18.00 $0.00 Turf Establishment (w/ Disc Anchored Mulch)AC $3,000.00 $0.00 Erosion Control Blanket SY $3.00 $0.00 Remove and Rebuild ice hockey rink area LS $50,000.00 $0.00 Swale Excavation CY 3,900 $4.00 $15,600.00 through Off Site Disposal of Excavated Material CY 3,900 $18.00 $70,200.00 Park Upland Native Vegetation AC 0.4 $5,000.00 $1,928.37 Erosion Control Blanket SY 1,870 $3.00 $5,610.00 Walking Trail LS 1 $7,000.00 $7,000.00 Avail Excavation CY $4.00 $0.00 Academy Off Site Disposal of Excavated Material CY $18.00 $0.00 Excavation Tree 2", B&B Each $500.00 $0.00 Clearing and Grubbing AC $8,500.00 $0.00 Upland Native Vegetation AC $5,000.00 $0.00 24" RC Pipe Sewer (Furnish and Install) (12 - 13' depth)LF $120.00 $0.00 Inglewood 36" RC Pipe Sewer (Furnish and Install) (8 - 13' depth)LF $180.00 $0.00 Construct Drainage Structure SD-60 LF $730.00 $0.00 Tie-In Storm Sewer Main to Manhole Each $1,000.00 $0.00 Susan Excavation CY $4.00 $0.00 Lindgren Off Site Disposal of Excavated Material CY $18.00 $0.00 School Turf Establishment (w/ Disc Anchored Mulch)AC $3,000.00 $0.00 Park Erosion Control Blanket SY $3.00 $0.00 10' W x 4' H Box Culvert (Furnish and Install)LF $650.00 $0.00 Open Space Excavation CY 29,000 $4.00 $116,000.00 Number 5 Off Site Disposal of Excavated Material CY 29,000 $18.00 $522,000.00 10' W x 4' H Box Culvert (Furnish and Install)LF 470 $650.00 $305,500.00 Dewatering LS 1 $50,000.00 $50,000.00 P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Cost Benefit methods\Engineers Opinion of Probable Cost_20201203.xlsx 3 PREPARED BY: BARR ENGINEERING COMPANY SHEET:1 OF 5 BY:CDA DATE:8/27/2020 FEASIBILITY STUDY CHECKED BY:KJN2 DATE:12/3/2020 ENGINEER'S OPINION OF PROBABLE PROJECT COST APPROVED BY:DATE: PROJECT:Morningside FRR Preliminary Engineering ISSUED:DATE: LOCATION:City of Edina ISSUED:DATE: PROJECT #:23/27-1798.00 ISSUED:DATE: OPINION OF COST - SUMMARY ISSUED:DATE: Engineer's Opinion of Probable Project Cost Morningside Flood Mitigation Feasibility Project REFINED COMBINATION OPTION at ~$10M Cat.ESTIMATED No.ITEM DESCRIPTION UNIT QUANTITY UNIT COST ITEM COST New / Remove and Dispose of Existing Storm Sewer LF 4,580 $20.00 $91,600.00 Additional Remove and Dispose of Existing Manhole/Catch Basin Each 22 $850.00 $18,700.00 Pipe Capacity 24" RC Pipe Sewer (Furnish and Install) (12 - 13' depth)LF 728 $120.00 $87,360.00 36" RC Pipe Sewer (Furnish and Install) (8 - 13' depth)LF 710 $180.00 $127,800.00 48" RC Pipe Sewer (Furnish and Install) (15' depth)LF 368 $300.00 $110,400.00 60" RC Pipe Sewer (Furnish and Install) (8 - 10' depth)LF 840 $320.00 $268,800.00 60" RC Pipe Sewer (Furnish and Install) (10 - 16' depth)LF 2,630 $400.00 $1,052,000.00 Construct Drainage Structure SD-48 LF 434 $450.00 $195,300.00 Construct Drainage Structure SD-60 LF 56 $730.00 $40,880.00 Construct Drainage Structure SD-72 LF 14 $970.00 $13,580.00 Construct Drainage Structure SD-84 LF 224 $1,360.00 $304,640.00 Casting Assembly Each 52 $800.00 $41,600.00 Tie-In Storm Sewer Main to Manhole Each 9 $1,000.00 $9,000.00 Connect CB Leads to Constructed Storm Sewer Each 68 $700.00 $47,600.00 Pump System Opti CMAC Predictive Pumping Control System (Furnish and Install)Each 1 $85,000.00 $85,000.00 For Weber Pond 4,000 GPM Pumping Station (Includes Building Structure, Electric Supply, Control Panel)LS 1 $700,000.00 $700,000.00 Pumping Station Outlet Piping (Furnish and Install)LF 1,100 $40.00 $44,000.00 Pumping Station Inlet Suction Piping (Furnish and Install)LF 100 $40.00 $4,000.00 CONSTRUCTION SUBTOTAL $7,809,000.00 CONSTRUCTION CONTINGENCY (30%)$2,343,000.00 ESTIMATED CONSTRUCTION COST $10,152,000.00 ENGINEERING, DESIGN, PERMITTING, AND CONSTRUCTION OBSERVATION (10%)$1,015,000.00 RESIDENTIAL/CONSTRUCTION PERMANENT EASEMENT $56,000.00 ESTIMATED TOTAL PROJECT COST $11,223,000.00 -30%$7,857,000.00 50%$16,835,000.00 Notes 6 Estimate costs are to design, construct, and permit each alternative. The estimated costs do not include maintenance, monitoring or additional tasks following construction. 7 Furnish and Install pipe cost per lineal foot includes all trenching, bedding, backfilling, compaction, and disposal of excess materials 8 Estimate costs are reported to nearest thousand dollars. ESTIMATED ACCURACY RANGE 1 Limited Design Work Completed 2 Quantities Based on Design Work Completed. 3 Unit Prices Based on Information Available at This Time. 4 Minimal Soil and Field Investigations Completed. Costs do not included remediation of contaminated soils (if found). 5 This feasibility-level (Class 4, 10-15% design completion per ASTM E 2516-06) cost estimate is based on feasibility-level designs, alignments, quantities and unit prices. Costs will change with further design. Time value-of-money escalation costs are not included. A construction schedule is not available at this time. Contingency is an allowance for the net sum of costs that will be in the Final Total Project Cost at the time of the completion of design, but are not included at this level of project definition. The estimated accuracy range for the Total Project Cost as the project is defined is -30% to +50%. The accuracy range is based on professional judgement considering the level of design completed, the complexity of the project and the uncertainties in the project as scoped. The contingency and the accuracy range are not intended to include costs for future scope changes that are not part of the project as currently scoped or costs for risk contingency. Operation and Maintenance costs are not included. P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Cost Benefit methods\Engineers Opinion of Probable Cost_20201203.xlsx 4 PREPARED BY: BARR ENGINEERING COMPANY SHEET:1 OF 5 BY:CDA DATE:8/27/2020 FEASIBILITY STUDY CHECKED BY:KJN2 DATE:12/3/2020 ENGINEER'S OPINION OF PROBABLE PROJECT COST APPROVED BY:DATE: PROJECT:Morningside FRR Preliminary Engineering ISSUED:DATE: LOCATION:City of Edina ISSUED:DATE: PROJECT #:23/27-1798.00 ISSUED:DATE: OPINION OF COST - SUMMARY ISSUED:DATE: Engineer's Opinion of Probable Project Cost Morningside Flood Mitigation Feasibility Project REFINED COMBINATION OPTION at ~$5M Cat.ESTIMATED No.ITEM DESCRIPTION UNIT QUANTITY UNIT COST ITEM COST General Mobilization/Demobilization (<10%)LS 1 $500,000.00 $500,000.00 Temporary Erosion Control LS 1 $30,000.00 $30,000.00 Flotation Silt Curtain LF 450 $11.00 $4,950.00 Excavate Excavation CY $4.00 $0.00 Weber Pond Off Site Disposal of Excavated Material CY $18.00 $0.00 Dewatering LS $50,000.00 $0.00 Excavate Tree 2", B&B Each 90 $500.00 $45,000.00 Weber Woods Clearing and Grubbing AC 3 $8,500.00 $25,500.00 Excavation CY 26,000 $4.00 $104,000.00 Off Site Disposal of Excavated Material CY 26,000 $18.00 $468,000.00 Lower Sport Excavation CY $4.00 $0.00 Fieds in Park Off Site Disposal of Excavated Material CY $18.00 $0.00 Turf Establishment (w/ Disc Anchored Mulch)AC $3,000.00 $0.00 Erosion Control Blanket SY $3.00 $0.00 Remove and Rebuild 3 baseball diamonds LS $300,000.00 $0.00 Excavation CY $4.00 $0.00 Off Site Disposal of Excavated Material CY $18.00 $0.00 Turf Establishment (w/ Disc Anchored Mulch)AC $3,000.00 $0.00 Erosion Control Blanket SY $3.00 $0.00 Remove and Rebuild ice hockey rink area LS $50,000.00 $0.00 Swale Excavation CY $4.00 $0.00 through Off Site Disposal of Excavated Material CY $18.00 $0.00 Park Upland Native Vegetation AC $5,000.00 $0.00 Erosion Control Blanket SY $3.00 $0.00 Walking Trail LS $7,000.00 $0.00 Avail Excavation CY $4.00 $0.00 Academy Off Site Disposal of Excavated Material CY $18.00 $0.00 Excavation Tree 2", B&B Each $500.00 $0.00 Clearing and Grubbing AC $8,500.00 $0.00 Upland Native Vegetation AC $5,000.00 $0.00 24" RC Pipe Sewer (Furnish and Install) (12 - 13' depth)LF $120.00 $0.00 Inglewood 36" RC Pipe Sewer (Furnish and Install) (8 - 13' depth)LF $180.00 $0.00 Construct Drainage Structure SD-60 LF $730.00 $0.00 Tie-In Storm Sewer Main to Manhole Each $1,000.00 $0.00 Susan Excavation CY $4.00 $0.00 Lindgren Off Site Disposal of Excavated Material CY $18.00 $0.00 School Turf Establishment (w/ Disc Anchored Mulch)AC $3,000.00 $0.00 Park Erosion Control Blanket SY $3.00 $0.00 10' W x 4' H Box Culvert (Furnish and Install)LF $650.00 $0.00 Open Space Excavation CY 29,000 $4.00 $116,000.00 Number 5 Off Site Disposal of Excavated Material CY 29,000 $18.00 $522,000.00 10' W x 4' H Box Culvert (Furnish and Install)LF 0 $650.00 $0.00 Dewatering LS 1 $50,000.00 $50,000.00 P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Cost Benefit methods\Engineers Opinion of Probable Cost_20201203.xlsx 5 PREPARED BY: BARR ENGINEERING COMPANY SHEET:1 OF 5 BY:CDA DATE:8/27/2020 FEASIBILITY STUDY CHECKED BY:KJN2 DATE:12/3/2020 ENGINEER'S OPINION OF PROBABLE PROJECT COST APPROVED BY:DATE: PROJECT:Morningside FRR Preliminary Engineering ISSUED:DATE: LOCATION:City of Edina ISSUED:DATE: PROJECT #:23/27-1798.00 ISSUED:DATE: OPINION OF COST - SUMMARY ISSUED:DATE: Engineer's Opinion of Probable Project Cost Morningside Flood Mitigation Feasibility Project REFINED COMBINATION OPTION at ~$5M Cat.ESTIMATED No.ITEM DESCRIPTION UNIT QUANTITY UNIT COST ITEM COST New / Remove and Dispose of Existing Storm Sewer LF 3,000 $20.00 $60,000.00 Additional Remove and Dispose of Existing Manhole/Catch Basin Each 22 $850.00 $18,700.00 Pipe Capacity 24" RC Pipe Sewer (Furnish and Install) (12 - 13' depth)LF 728 $120.00 $87,360.00 36" RC Pipe Sewer (Furnish and Install) (8 - 13' depth)LF 330 $180.00 $59,400.00 48" RC Pipe Sewer (Furnish and Install) (15' depth)LF 0 $300.00 $0.00 60" RC Pipe Sewer (Furnish and Install) (8 - 10' depth)LF 0 $320.00 $0.00 60" RC Pipe Sewer (Furnish and Install) (10 - 16' depth)LF 2,630 $400.00 $1,052,000.00 Construct Drainage Structure SD-48 LF 434 $450.00 $195,300.00 Construct Drainage Structure SD-60 LF 56 $730.00 $40,880.00 Construct Drainage Structure SD-72 LF 14 $970.00 $13,580.00 Construct Drainage Structure SD-84 LF 224 $1,360.00 $304,640.00 Casting Assembly Each 52 $800.00 $41,600.00 Tie-In Storm Sewer Main to Manhole Each 9 $1,000.00 $9,000.00 Connect CB Leads to Constructed Storm Sewer Each 68 $700.00 $47,600.00 Pump System Opti CMAC Predictive Pumping Control System (Furnish and Install)Each $85,000.00 $0.00 For Weber Pond 4,000 GPM Pumping Station (Includes Building Structure, Electric Supply, Control Panel)LS $700,000.00 $0.00 Pumping Station Outlet Piping (Furnish and Install)LF $40.00 $0.00 Pumping Station Inlet Suction Piping (Furnish and Install)LF $40.00 $0.00 CONSTRUCTION SUBTOTAL $3,796,000.00 CONSTRUCTION CONTINGENCY (30%)$1,139,000.00 ESTIMATED CONSTRUCTION COST $4,935,000.00 ENGINEERING, DESIGN, PERMITTING, AND CONSTRUCTION OBSERVATION (10%)$494,000.00 RESIDENTIAL/CONSTRUCTION PERMANENT EASEMENT $56,000.00 ESTIMATED TOTAL PROJECT COST $5,485,000.00 -30%$3,840,000.00 50%$8,228,000.00 Notes 6 Estimate costs are to design, construct, and permit each alternative. The estimated costs do not include maintenance, monitoring or additional tasks following construction. 7 Furnish and Install pipe cost per lineal foot includes all trenching, bedding, backfilling, compaction, and disposal of excess materials 8 Estimate costs are reported to nearest thousand dollars. ESTIMATED ACCURACY RANGE 1 Limited Design Work Completed 2 Quantities Based on Design Work Completed. 3 Unit Prices Based on Information Available at This Time. 4 Minimal Soil and Field Investigations Completed. Costs do not included remediation of contaminated soils (if found). 5 This feasibility-level (Class 4, 10-15% design completion per ASTM E 2516-06) cost estimate is based on feasibility-level designs, alignments, quantities and unit prices. Costs will change with further design. Time value-of-money escalation costs are not included. A construction schedule is not available at this time. Contingency is an allowance for the net sum of costs that will be in the Final Total Project Cost at the time of the completion of design, but are not included at this level of project definition. The estimated accuracy range for the Total Project Cost as the project is defined is -30% to +50%. The accuracy range is based on professional judgement considering the level of design completed, the complexity of the project and the uncertainties in the project as scoped. The contingency and the accuracy range are not intended to include costs for future scope changes that are not part of the project as currently scoped or costs for risk contingency. Operation and Maintenance costs are not included. P:\Mpls\23 MN\27\23271798 Morningside FRR Prelim Eng & E\WorkFiles\Cost Benefit methods\Engineers Opinion of Probable Cost_20201203.xlsx 6 PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA ii CONTENTS BACKGROUND ........................................................................................................................................................ 1 PUBLIC PARTICIPATION PLAN ................................................................................................................................. 2 PHASE 1: SHARE INFORMATION ............................................................................................................................. 4 Survey ................................................................................................................................................................ 5 “Walk the Line” Activity in Weber Park ............................................................................................................... 5 Virtual Public Meeting ........................................................................................................................................ 6 Communication with Key Stakeholders ............................................................................................................... 6 PHASE 2: PRESENT INITIAL CONCEPTS .................................................................................................................... 7 Videos ................................................................................................................................................................ 7 Virtual Public Meeting ........................................................................................................................................ 7 Communication with Key Stakeholders ............................................................................................................... 9 PHASE 3: PRESENT REFINED CONCEPTS .................................................................................................................. 9 “Halloween-Themed” Activity in Weber Park ...................................................................................................... 9 Virtual Public Meeting ...................................................................................................................................... 11 Communication with Key Stakeholders ............................................................................................................. 12 MAJOR THEMES ................................................................................................................................................... 12 APPENDIX A – MEETING NOTICES ......................................................................................................................... 15 APPENDIX B – “WALK THE LINE” ACTIVITY DISPLAYS ............................................................................................. 19 APPENDIX C – FLOOD INFRASTRUCTURE SCENARIOS ............................................................................................. 28 PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 1 PUBLIC PARTICIPATION SUMMARY PROJECT: MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT BACKGROUND The Morningside neighborhood has several low or landlocked areas that are prone to flooding, and many homeowners experience varying levels of flooding when there is a significant rainstorm. Flooding can occur due to water flowing over the land surface, through groundwater seepage, and as a result of sanitary backflow (Figure 1). Figure 1 – Causes of Flooding Source: Barr Engineering, Morningside Flood Infrastructure Technical Memo, September 2020 PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 2 The Edina City Council recently adopted a Flood Risk Reduction Strategy identifying four areas of work: • Infrastructure • Regulation • Outreach and Engagement • Emergency Services Anticipated roadway reconstruction in the Morningside neighborhood in 2022 and 2023 presents an opportunity to explore infrastructure-based solutions to managing flood risk in the Morningside neighborhood. This is the first project to engage a neighborhood and plan flood infrastructure under the new strategy. The result of this work will be a recommendation to the City Council on infrastructure scenarios to address some of the flooding issues in the Morningside neighborhood in conjunction with the future roadway reconstruction projects. The City of Edina contracted with Barr Engineering to conduct technical studies, model water flow, and develop and evaluate multiple options for reducing flooding risk through infrastructure in the Morningside neighborhood. The technical report can be reviewed at www.BetterTogetherEdina.org/morningside. PUBLIC PARTICIPATION PLAN The City of Edina developed a public participation plan (Figure 2) for both informing Morningside residents and property owners about flood risk and engaging them in the development and evaluation of infrastructure options for reducing flood risk. The plan acknowledged that any decisions would be made by the Edina City Council and identified the following key stakeholders: • Morningside Neighborhood residents • Morningside Neighborhood Association • Park and Recreation Commission • Energy and Environment Commission • Planning Commission • Avail Academy (formerly Calvin Christian School) • Minnehaha Creek Watershed District • City of St. Louis Park • City of Minneapolis PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 3 Figure 2 - Public Participation Approach Objective The City will share flood risk information and the City’s Flood Risk Reduction Strategy. Staff will inform people of actions they can take to reduce their own flood risk. Staff will inform people of the project and process. The City will present initial concepts and receive feedback. The City will gauge community values and the tradeoffs people are willing to consider. The City will refine concepts based on feedback and present them for more feedback. Staff will describe how feedback was used. Staff will make a recommendation to Council. Council decides. Staff will communicate the decision to the public. Staff will archive the project and process online. Anticipated Outcomes People are risk aware. People have access to information about how to reduce their exposure and vulnerability to flooding. People know how and when to provide feedback. People have access to information. People have the ability to provide their feedback. People have access to information. People know how initial feedback was used. People have the ability to provide their feedback. The recommended concept-level design is influenced by community values. People know what decision was made. People can view the information, process, and decision on the BetterTogetherEdina webpage. Timeline Summer 2020 Fall 2020 Winter 2020 Spring 2021 Spring 2021 Source: City of Edina, Public Participation Plan, Morningside Flood Infrastructure Project, approved April 21,2020 Close the loop Make a decision Present Refined Concepts Present Initial Concepts Share Information PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 4 The public participation plan included five key steps that are concurrent with steps in the technical analysis and design phases of the project. These steps and the public participation objectives of each phase are shown in Figure 2. The purpose of this report is to document the public participation activities and the resulting input for Phases 1-3. Due to the Covid-19 pandemic, the strategies used to engage people in the Morningside Flood Infrastructure Project during 2020 were modified to use primarily online tools (www.BetterTogetherEdina.org/morningside) and virtual meetings. In-field activities that were designed for social distancing were also used along with email, social media, and direct mail correspondence. Public Participation in Phase 1-3 activities is summarized in Figure 3. Figure 3 - Public Participation in Phases 1-3 Note: Data is from project start through January 18, 2021 PHASE 1: SHARE INFORMATION The purpose of Phase 1 public participation was to build an understanding of the complexities and history of flooding and flood risk in the Morningside neighborhood, as well as to gain an understanding of people’s concerns and to answer questions about flooding, flood risk and the process being used for the Morningside Flood Infrastructure Project. A web page – www.BetterTogetherEdina.org/morningside - was established to provide ongoing information about the project, provide access to project documentation, and provide an ongoing means for people to share their opinions through an ideas board, an interactive map, and a survey. In addition, a virtual meeting was held on June 3, 5-6:30 p.m., and a socially distanced “walk the line” event was held in Weber Park. PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 5 SURVEY An online survey was conducted on www.BetterTogetherEdina.org/morningside to gain a better understanding of people’s experiences with flooding and things they had done to reduce flooding on their properties. While only eight people responded to the survey, almost all of those people had experienced flooding in the Morningside neighborhood. • Yard flooding was the most common type of flooding, followed by street and basement flooding. • A quarter of respondents experience flooding more than once a year and a quarter experience flooding every year or every few years. • Almost half of the respondents said they have a plan for flooding, but they would not feel prepared. • The most common strategies that people installed on their properties to help with flooding were gutters and downspouts, landscaping, regrading, and sump pumps. “WALK THE LINE” ACTIVITY IN WEBER PARK An outdoor activity that people could do independently was set up in Weber Park for approximately three weeks in late June 2020. The purpose of this activity was to provide information about the causes of flooding, the types of flooding, the Morningside Flood Infrastructure Project, and what people can do on their own properties to reduce flooding. QR codes were provided so that people could provide real time comments or take the survey by linking directly to www.BetterTogetherEdina.org/morningside. The displays were spaced apart so that people could be socially distanced while viewing the displays and participating in the activities (Figure 4). This event was announced through social media and the project website. The field experience was also replicated in an online interactive story map. Details of the exercise are provided in Appendix B. Figure 4 - "Walk the Line" Field Activity PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 6 VIRTUAL PUBLIC MEETING A live virtual public meeting was held on June 3, 2020, 5-6:30 p.m. via WebEx/YouTube. The purpose of this meeting was to provide information to people about flooding in the Morningside neighborhood (causes, types, history, frequency, etc.) and to provide an opportunity for people to ask questions and provide comments about the Morningside Flood Infrastructure Project. Notices about the meeting were sent to almost 700 addresses in the Morningside neighborhood (see Appendix A), and the meeting was also publicized through social media and the Better Together Edina website. Key stakeholders were notified of the meeting and asked to share information about the meeting with their constituents. During the meeting, people were also directed to the project webpage if they wished to provide additional comments and were given the opportunity to meet individually with staff about concerns that they had about a particular property. Questions and comments received during the virtual public meeting are summarized here. The presentation can be viewed on the project webpage. • Concerns were expressed about the amount of recent redevelopment in the neighborhood and an associated increase in impervious surfaces and runoff. Staff commented that impervious cover is more of a historical driver of flood risk in the neighborhood and climate change and aging infrastructure are the biggest current drivers. Properly managing drainage with impervious cover is most valuable for smaller, more frequent storms. For larger storms, increases in impervious cover were less important. During heavy rain events, pervious areas such as lawns become saturated with water and then experience runoff that is similar to impervious areas. • There were questions about flooding experiences on specific properties. Staff talked one-on-one with these individuals following the meeting. • Information was provided about planned street construction projects in the neighborhood. • A question was asked about whether properties or yards would be acquired to provide the necessary flooding infrastructure. Staff responded that the city does not expect to acquire property or easements for flood infrastructure. The work will focus on existing streets, rights-of-way, easements, and parks. • One person commented that temporary flooding of streets and parks would be acceptable if it did not increase flooding risk for permanent structures. • Several clarifying questions were asked and responded to regarding climate change, frequency of flooding, terminology, and flood protection actions that homeowners can take. COMMUNICATION WITH KEY STAKEHOLDERS In addition to the activities described above, city staff met with individuals upon request. City staff met with both Susan Lindgren School and Avail Academy to review the flood risks for each property and gauge the willingness of each to be included in the planning for flood PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 7 risk reduction scenarios. Both schools are amenable to planning and interested in the project benefits of each scenario. City staff maintains frequent contact with the Morningside Neighborhood Association, in particular about upcoming events. The Association has been helpful in getting the word out about these events and places to get information about flooding and the project. The City also provided flood data that could be downloaded and viewed using Google Earth prior to the second live virtual public meeting. https://www.bettertogetheredina.org/morningside/news_feed/view-flood-data-on-google- earth During Phase 1, Barr Engineering and the City met with a panel of experts for an Estimate- Talk-Estimate (ETE) or mini “Delphi” meeting to vet developed scenarios and to propose new or refined concepts for the community to consider. This group included representatives from the cities of Minneapolis and St. Louis Park and from four local engineering consulting companies. The first meeting of this group was held on July 29, 2020. The discussions at this meeting resulted in technical refinements of flood reduction scenarios that were subsequently presented to a City Council workshop held on September 1, 2020, and at the virtual public meeting held on September 3, 2020. PHASE 2: PRESENT INITIAL CONCEPTS During Phase 2, efforts continued to build understanding of flooding in the Morningside neighborhood. In addition, several scenarios for managing flood risk were evaluated. Flood infrastructure elements were presented at a virtual public meeting on September 3, 2020, 5-6:30 p.m. VIDEOS Two videos were produced, published on YouTube, and linked on the project website. These videos included: • A video that explains how and why flooding occurs including the types of flooding, flooding frequency, terminology and contributing factors. • A series of videos from the stormwater model showing neighborhood flooding for varying design storms. VIRTUAL PUBLIC MEETING A live virtual public meeting was held on September 3, 2020, 5-6:30 p.m. via WebEx/YouTube. The purpose of this meeting was to provide information to people about the various flood infrastructure elements that were being considered to reduce flood risk in the Morningside neighborhood and to provide an opportunity for people to ask questions and provide comments. Notices about the meeting were sent to almost 700 addresses in the Morningside neighborhood (see Appendix A), and the meeting was also publicized PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 8 through social media and the project website. Key stakeholders were notified of the meeting and asked to share information about the meeting with their constituents. People were directed to the project webpage to provide additional comments/questions and were given the opportunity to meet individually with staff about concerns they had about a particular property. Questions and comments received during the virtual public meeting are summarized below. The presentation can be viewed at www.BetterTogetherEdina.com/morningside. • There were questions about flooding experiences on specific properties. Staff talked one-on-one with these individuals following the meeting. • Where does the Weber pond outflow to and can the capacity of that area be increased? Weber Pond has one outlet pipe that runs north, then east through Minneapolis to Bde Maka Ska. Although a bigger pipe is technically feasible, the cost as well as the transfer of risk to the City of Minneapolis, which has its own flooding problems, makes it unworkable. • 41st Street right-of-way does not continue between Kipling and Grimes – that was turned into private property some time ago. That is correct. • Does the City of Edina own the Susan Lindgren land area west of Monterey? This property is owned by the St. Louis Park School District. • Should the City prohibit new construction on lots that are high risk (red on map)? This is a regulatory issue that is not part of the infrastructure project. When properties redevelop, there is an opportunity to reduce vulnerability to flooding. • Will residents be able to discharge sump lines into the sewer system in all options? Sump pump drains should be connected to the stormwater system – it is illegal to connect them to the sanitary sewer system. There is a factsheet available about this topic at www.EdinaMN.gov/flooding. • Some of the options look very expensive. Will these expenses be borne by residents through assessments for street reconstruction or is this a budget item for the city? The sanitary sewer, municipal water, and stormwater utilities all have designated funds from quarterly utility bills. The special assessment is for the roadway reconstruction. Because the flood infrastructure will be paid from the stormwater utility fund, the City does not foresee the project impacting special assessments. • Are there ways to add fill to a property to reduce flooding without negatively impacting the flood areas? This depends on the property. Every grading permit (over 10 cubic yards) is reviewed for stormwater flow paths and flooding potential. • How does the city interact with builders to be more water removal conscious by providing down spouts directed to rain gardens or deep into the groundwater? The City interacts with builders through the plan review and permitting process. • How does the current economic situation affect the road reconstruction timeline? The street reconstruction project is continuing as planned. PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 9 COMMUNICATION WITH KEY STAKEHOLDERS During Phase 2, city staff continued to meet with individuals upon request. City staff continued to have discussions with both Susan Lindgren School and Avail Academy as well as adjoining cities to review the flood risk infrastructure scenarios. City staff kept the Morningside Neighborhood Association informed about upcoming events. The Association has been helpful in getting the word out about the project. During Phase 2, Barr Engineering and the City met again with the ETE panel of experts for an Estimate-Talk-Estimate (ETE) – only the representatives from the cities of Minneapolis and St. Louis Park were able to attend – on November 9, 2020. The purpose of this second meeting was to update the group on refinements to scenarios and seek comments on the refined concepts and concept-level cost estimates. This review led to additional refinements in the flood reduction scenarios, which were shared with the public during a live virtual public meeting held on December 9, 2020. PHASE 3: PRESENT REFINED CONCEPTS Following the completion of Phase 2, attention was turned to refining the various concepts into several flood risk management scenarios. These scenarios were documented in several one-pagers (see Appendix C) that were posted on the project website. A Halloween-themed field activity (with social distancing) was held in Weber Park on October 31st, and a live virtual public meeting was held on December 9, 2020, 5-6:30 p.m. “HALLOWEEN-THEMED” ACTIVITY IN WEBER PARK An outdoor activity that people could do physically distanced was set up in Weber Park on October 31, 2020. This included several display boards of the one-pager materials (see Appendix C) as well as tables with individual bags of candy, copies of the one-pagers, and contact information. Staff was available (with masks and social distancing) from 1-3 p.m. to explain the scenarios and answer questions. The purpose of this activity was to provide information about the scenarios that were tested and collect feedback. QR codes were provided so that people could make real time comments or leave comments online by linking directly to the project webpage. The displays were spaced apart so that people could be socially distanced while viewing the displays and participating in the activities (Figure 5). The displays remained available for public viewing in the park for approximately three weeks. This event was announced through social media and the www.BetterTogetherEdina.org/morningside website. PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 10 Figure 5 - Halloween-Themed Field Activity PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 11 VIRTUAL PUBLIC MEETING A third live virtual public meeting was held on December 9, 2020, 5-6:30 p.m. via WebEx/YouTube. Following the live virtual meeting in September, scenarios were tested and modified based on public feedback. The purpose of the meeting was to share the refined concept, describe how feedback was used, and provide an opportunity for people to ask questions and provide comments. Notices about the meeting were sent to almost 700 addresses in the Morningside neighborhood (see Appendix A), and the meeting was also publicized through social media and the project website. Key stakeholders were notified of the meeting and asked to share information about the meeting with their constituents. People were directed to project website to provide additional comments and were given the opportunity to meet individually with staff about concerns that they had about a particular property. Questions and comments received during the virtual public meeting are summarized here. The presentation can be viewed at www.BetterTogetherEdina.org/morningside. • Some participants indicated they like the idea of expanding Weber Pond and improving Weber Park and the trails. • Some people expressed a desire to protect wildlife and trees and had questions about the potential impacts of the proposed scenario. • Concerns were expressed that reducing flood risk on some properties would not increase flood risk on other properties. Staff responded that a key design goal of scenario development was to make sure that no homes would have increased risk. They were able to meet that design goal for each of the three levels of effort. • It was suggested that adding street inlets would better utilize existing pipe flow capacity and reduce water and ice build-up from sump pumps. Staff responded that additional outlets to optimize use of pipe capacity were included in the recommended scenario. • A question was raised about whether excavation would occur on private property. Staff responded that all excavation would occur on public lands. • There were some questions about why Crocker was selected as the preferred alignment. Staff responded that Crocker is preferred because 1) there is an existing pipe on Crocker that would need to repaired and there are some cost savings if an existing pipe can be upsized, 2) there would be better opportunity to provide more flood benefit in the future if more space were created downstream, and 3) because of the grade of the streets less earth would have to be dug through if Crocker were used. • A question was asked about landscape and property restoration. Staff responded that landscape and property restoration costs would be included in the project. • Concerns were raised about the cost of the scenario and how infrastructure improvements would be funded. Staff responded that cost/funding is related to the desired level of service. This project has helped the city to understand what is achievable, what the cost would be, and what the community would support. The level PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 12 of effort in this neighborhood and citywide has not yet been determined. Community feedback during this process and the Council’s decision in 2021 will guide the service level and associated funding. • There were several questions about specific properties. Staff offered to have individual conversations about specific properties. COMMUNICATION WITH KEY STAKEHOLDERS During Phase 3, city staff continued to meet with individuals upon request, and continued to have discussions as needed with key stakeholders. Many of these conversations were captured on the project website. City staff continued to update the Morningside Neighborhood Association about upcoming events. The Association has been helpful in getting the word out about these events and about where to get information about the project. The following meetings have been or will be held prior to presentation of the Morningside Flood Infrastructure Project to City Council: • Morningside Neighborhood Association Steering Committee Check-In – January 4 • Energy and Environment Commission - January 14 • Planning Commission – January 27 • Park and Recreation Commission – February 9 (tentative) • Minnehaha Creek Watershed District – February 16 (tentative) MAJOR THEMES The following are major themes heard from residents during Phases 1-3: • People seem to highly value open spaces and the wildlife they support. They seemed supportive of protecting and enhancing natural areas. Some people expressed support for expanding/deepening Weber Pond, improving/modifying Weber Park, and expanding the trail system. • People are concerned about the amount of recent redevelopment in the neighborhood and the permitting process and requirements for building in areas with flood risk. • People are interested in understanding the causes, frequency and other aspects of flooding and flood risks and are open to doing what they can as property owners to reduce their own flood risk. PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 13 • People seem to understand the potential impacts of climate change and expressed an appreciation that this was considered in developing the flood infrastructure scenarios. • People expressed concerns about the acquisition of properties or yards and excavation on private property. There was also interest in property restoration being included as part of project cost. • People do not support infrastructure options that increase risk for downstream properties. • People are concerned about the cost of flood infrastructure and the funding for infrastructure construction. • People seemed supportive of moving an infrastructure project forward. PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 14 PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 15 APPENDIX A – MEETING NOTICES PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 16 APPENDIX A – MEETING NOTICES PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 17 APPENDIX A – MEETING NOTICES PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 18 PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 19 APPENDIX B – “WALK THE LINE” ACTIVITY DISPLAYS PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 20 APPENDIX B – “WALK THE LINE” ACTIVITY DISPLAYS PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 21 APPENDIX B – “WALK THE LINE” ACTIVITY DISPLAYS PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 22 APPENDIX B – “WALK THE LINE” ACTIVITY DISPLAYS PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 23 APPENDIX B – “WALK THE LINE” ACTIVITY DISPLAYS PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 24 APPENDIX B – “WALK THE LINE” ACTIVITY DISPLAYS PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 25 APPENDIX B – “WALK THE LINE” ACTIVITY DISPLAYS PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 26 APPENDIX B – “WALK THE LINE” ACTIVITY DISPLAYS PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 27 PUBLIC PARTICIPATION SUMMARY I MORNINGSIDE FLOOD INFRASTRUCTURE PROJECT I CITY OF EDINA 28 APPENDIX C – FLOOD INFRASTRUCTURE SCENARIOS Morningside Flood Infrastructure ProjectCHANGE IN HOMES EFFECTED (Each symbol equals 10 homes):ESTIMATED COST REDUCTION FOR DAMAGES NEIGHBORHOOD-WIDE Scenario: Pipe Sizes and FloodwallsFrance Ave SW 44th St Grimes Ave W 42nd St Sunnyside Rd Ewing Ave SMorningside Rd W 40th St Alden Dr Scott Ter Lynn Ave Kipling Ave Wood Dal e A v e SBranson St Crocker Ave Monterey Ave Lynn Ave SJoppa Ave SKipling Ave SNatchez Ave SW 41st St Inglewood Ave SW 40th La Eaton Pl Dart Ave Ottawa Ave SW 45th St Oakdale Ave Curve A v e Inglewood Ave W 46th St W 42 1/2 St Meadow Rd Colgate Ave Townes R d Littel St Monterey Ave SGlendale Ter Natchez Ave Waveland Ter Sunnyside Ave Ewing Ave SOttawa Ave SLynn Ave W 41st St Ottawa Ave SW 40th St W 45th St Oakdale A v e France Ave SFrance Ave SFrance Ave SW 44th St W 44th St W 44th St Grimes Ave Grimes Ave Grimes Ave W 42nd St W 42nd St W 42nd St Sunnyside Rd Sunnyside Rd Sunnyside Rd Ewing Ave SEwing Ave SEwing Ave SMorningside Rd Morningside Rd Morningside Rd W 40th St W 40th St W 40th St Alden Dr Alden Dr Alden Dr Scott Ter Scott Ter Scott Ter Lynn Ave Lynn Ave Lynn Ave Kipling Ave Kipling Ave Kipling Ave Wood Dal e A v e S Wood Dal e A v e S Wood Dal e A v e SBranson St Branson St Branson St Crocker Ave Crocker Ave Crocker Ave Monterey Ave Monterey Ave Monterey Ave Lynn Ave SLynn Ave SLynn Ave SJoppa Ave SJoppa Ave SJoppa Ave SKipling Ave SKipling Ave SKipling Ave SNatchez Ave SNatchez Ave SNatchez Ave SW 41st St W 41st St W 41st St Inglewood Ave SInglewood Ave SInglewood Ave SW 40th La W 40th La W 40th La Eaton Pl Eaton Pl Eaton Pl Dart Ave Dart Ave Dart Ave Ottawa Ave SOttawa Ave SOttawa Ave SW 45th St W 45th St W 45th St Oakdale Ave Oakdale Ave Oakdale Ave Curve A v e Curve A v e Curve A v e Inglewood Ave Inglewood Ave Inglewood Ave W 46th St W 46th St W 46th St W 42 1/2 St W 42 1/2 St W 42 1/2 St Meadow Rd Meadow Rd Meadow Rd Colgate Ave Colgate Ave Colgate Ave Townes R d Townes R d Townes R d Littel St Littel St Littel St Monterey Ave SMonterey Ave SMonterey Ave SGlendale Ter Glendale Ter Glendale Ter Natchez Ave Natchez Ave Natchez Ave Waveland Ter Waveland Ter Waveland Ter Sunnyside Ave Sunnyside Ave Sunnyside Ave Ewing Ave SEwing Ave SEwing Ave SOttawa Ave SOttawa Ave SOttawa Ave SLynn Ave Lynn Ave Lynn Ave W 41st St W 41st St W 41st St Ottawa Ave SOttawa Ave SOttawa Ave SW 40th St W 40th St W 40th St W 45th St W 45th St W 45th St Oakdale A v e Oakdale A v e Oakdale A v e Imagery: Hennepin County 2018WeberParkWeberParkMinikahdaVistaParkMinikahdaVistaParkFloodwallIncreased Pipe Size and/or New Storm SewerExisting Park Existing Storm Sewer PipeParcelsLEGENDWith this scenario, the size of the main trunk sewer along West 42nd Street and Crocker Avenue would be increased up to 60 inches. The sizes of some of the lateral storm sewer (e.g., along Grimes Avenue) would also be increased (24 to 48 inches). More stormwater inlets (e.g., catch basins) would be added at intersections and a floodwall would be constructed on the east and south sides of Weber Pond to protect adjacent residential properties. The height of the floodwall would range from 1.5 feet to 7 feet, based on existing ground elevation. The advantage of this scenario is that pipe sizes could be increased during planned street reconstruction in 2022 and 2023 (see www.edinamn.gov/360/Design-and-Construction-Projects for more details) which covers this proposed project area with the exception of West 42nd Street east of Grimes Avenue, previously reconstructed in 2014. Increasing the pipe sizes upstream would help reduce flood risk for some upper portions of the drainage area, but increase risk for some areas farther downstream (transfer of risk). Thus, mitigation (e.g., floodwalls) would be required to help offset some of the flood risk. Floodwalls are expensive, per property protected, and may not be able to defend homes from the groundwater risk that could be associated with high water.Change in risk of damage to homes is based on predictive modeling parameters; however, no home is ever removed from all flood risk.The method for quantifying flood risk considers (1) the probability and magnitude of flood events, (2) the probability of damage, (3) the amount of damage expected if no changes are made, and (4) the damage expected with each scenario. Included in this assessment are damages to homes from surface flooding, indirect flooding (from groundwater), and sanitary sewer backups. (Reduced risk in 118 homes)(16 homes removed from risk)(Increased risk in 16 homes)32%The height of the floodwall at any given location is determined by the ground elevation. Under normal water level conditions, water will not reach the floodwall. Water levels shown are for illustration purposes only and reflect temporary conditions – the depth and duration of high water will depend on the size of the storm. WHAT IT IS:THE DISTANCE FROM THE GROUND TO THE TOP OF THE FLOODWALL WOULD VARY BASED ON LOCATIONWHAT IT DOES:WHAT WE LEARNED:Provide your feedback for these scenarios at: www.bettertogetheredina.org/morningsideColColCCCCCCCoCoCoCoColCoCoCollllWavelaWaWaWaWaWaWaWWWWWWWWavelaWWaWaWaWaaavavavavavavavavavavavavavavavWavvvvvvvveveveveveveveeelelandelandelelelelelelelaaaaaaaaaaaaaaaalanndananananananandd TedTdddddddddddddddddddddTer Ter TeTeTeTeTeTeTeeTeTeTTTTTTTererererererererererererererWavWavWavWavaveaveaveavevelavelvelvelelaelaelaelaelanlanlanlanandandandandnd Tnd Tnd Tnd TdTedTedTedTeTerTerTerTerererererColColCoCCCColColColColllllColColCoCCCColCoCoColllliiiiiiiiiiiiiiddorningside RdMMMorningside RMorningside RMorningside RMorningside RMorningside RMorningside RMorningside RMMMMMMMRRRRRRRMMMMoooorrrrnnnniiiinnnnggggssssiiiiddddeeeeRRRRdddd tawa Aveawa Avawa Avawa Avawa Avawa Avawa AvOttOttOttOttOttOttOttOttawa AveOttawa AveOttawa AveOttawa AveOttawa AveOttawa AveOttawa AveOtOOOOtttttttttttttaaaawwwwaaaaAvAvAvAvAvAvAvAve eeeLynn Ave Lynn AveynnLLLAAnALyAAAveLLLLLLLyyyyyyynnnnnnnLyLyLyLyLyLyLyLynnnnnnnnnnnAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAvvvvvvveeeeeeeeeeeeeeeeennnnAvAvAvAvAveAvAvAve eeedddddddningningningningningningningeorningside RdMMrningside Rdrningside Rdrningside Rdrningside Rdrningside Rdrningside Rdrningside RdMMMMoooorrrrnnnniiiinnnnggggssssiiiiddddeeeeRRRRddddSSSSSSorningside RdMMRMMMMoooorrrrnnnniiiinnnnggggssssiiiiddddeeeeRRRRddddSSSSSSEstimated cost of floodwall:$850,000Estimated cost of pipes:$4.1 Million!;N0 175 350FeetDo you know your home’s flood risk? If not, check it out on the City’s interactive map: www.edinamn.gov/floodingWe want to hear from you! Morningside Flood Infrastructure ProjectCHANGE IN HOMES EFFECTED (Each symbol equals 10 homes):ESTIMATED COST REDUCTION FOR DAMAGES NEIGHBORHOOD-WIDE (8 homes removed from risk)France Ave SW 44th St Grimes Ave W 42nd St Sunnyside Rd Ewing Ave SMorningside Rd W 40th St Alden Dr Scott Ter Lynn Ave Kipling Ave Wood Dale A v e SBranson St Crocker Ave Monterey Ave Lynn Ave SJoppa Ave SKipling Ave SNatchez Ave SW 41st St Inglewood Ave SW 40th La Eaton Pl Dart Ave Ottawa Ave SW 45th St Oakdale Ave Curve A v e Inglewood Ave W 46th St W 42 1/2 St Meadow Rd Colgate Ave Town es R d Monterey Ave SGlendale Ter Natchez Ave Waveland Ter Sunnyside Ave Ewing Ave SOttawa Ave SLynn Ave W 41st St Ottawa Ave SW 40th St W 45th St Oakdale A v e France Ave SFrance Ave SFrance Ave SW 44th St W 44th St W 44th St Grimes Ave Grimes Ave Grimes Ave W 42nd St W 42nd St W 42nd St Sunnyside Rd Sunnyside Rd Sunnyside Rd Ewing Ave SEwing Ave SEwing Ave SMorningside Rd Morningside Rd Morningside Rd W 40th St W 40th St W 40th St Alden Dr Alden Dr Alden Dr Scott Ter Scott Ter Scott Ter Lynn Ave Lynn Ave Lynn Ave Kipling Ave Kipling Ave Kipling Ave Wood Dale A v e S Wood Dale A v e S Wood Dale A v e SBranson St Branson St Branson St Crocker Ave Crocker Ave Crocker Ave Monterey Ave Monterey Ave Monterey Ave Lynn Ave SLynn Ave SLynn Ave SJoppa Ave SJoppa Ave SJoppa Ave SKipling Ave SKipling Ave SKipling Ave SNatchez Ave SNatchez Ave SNatchez Ave SW 41st St W 41st St W 41st St Inglewood Ave SInglewood Ave SInglewood Ave SW 40th La W 40th La W 40th La Eaton Pl Eaton Pl Eaton Pl Dart Ave Dart Ave Dart Ave Ottawa Ave SOttawa Ave SOttawa Ave SW 45th St W 45th St W 45th St Oakdale Ave Oakdale Ave Oakdale Ave Curve A v e Curve A v e Curve A v e Inglewood Ave Inglewood Ave Inglewood Ave W 46th St W 46th St W 46th St W 42 1/2 St W 42 1/2 St W 42 1/2 St Meadow Rd Meadow Rd Meadow Rd Colgate Ave Colgate Ave Colgate Ave Town es R d Town es R d Town es R d Monterey Ave SMonterey Ave SMonterey Ave SGlendale Ter Glendale Ter Glendale Ter Natchez Ave Natchez Ave Natchez Ave Waveland Ter Waveland Ter Waveland Ter Sunnyside Ave Sunnyside Ave Sunnyside Ave Ewing Ave SEwing Ave SEwing Ave SOttawa Ave SOttawa Ave SOttawa Ave SLynn Ave Lynn Ave Lynn Ave W 41st St W 41st St W 41st St Ottawa Ave SOttawa Ave SOttawa Ave SW 40th St W 40th St W 40th St W 45th St W 45th St W 45th St Oakdale A v e Oakdale A v e Oakdale A v e Littel St Imagery: Hennepin County 2018WeberParkWeberParkMinikahdaVistaParkMinikahdaVistaParkFloodwallLEGENDExcavationCulvertExisting Park Existing StormSewer PipeParcelsThis rendering is an estimated representation of the study scenario, not a final design concept. WHAT IT IS:Scenario: Flood StorageThis scenario would create additional flood storage by excavating (i.e., lowering) areas on several public properties and some private backyards (as allowed by homeowners). It would also include installation of a storm sewer pipe to connect Weber Pond to newly created stormwater storage and construction of a floodwall on the east and south sides of Weber Pond to protect adjacent residential properties.(Reduced risk in 105 homes)(Increased risk in 5 homes)33%WHAT IT DOES:WHAT IT DOES:Provide your feedback for these scenarios at: www.bettertogetheredina.org/morningsideThis scenario would be most advantageous for small storms. The excavation shown does not provide enough storage volume to completely solve the flood problem, but would benefit homes closest to the excavation areas. The floodwall shown would reduce vulnerability of the homes adjacent to Weber Pond during larger storms. This scenario affects the use and appearance of the park, and further evaluation is needed to understand how often the park would flood and what tradeoffs would be acceptable for the active use areas.WHAT WE LEARNED:Do you know your home’s flood risk? If not, check it out on the City’s interactive map: www.edinamn.gov/floodingCONCEPTUAL BRIDGE TRAIL FOR THE PROPOSED EXCAVATED OPEN WATER IN WEBER WOODSThe method for quantifying flood risk considers (1) the probability and magnitude of flood events, (2) the probability of damage, (3) the amount of damage expected if no changes are made, and (4) the damage expected with each scenario. Included in this assessment are damages to homes from surface flooding, indirect flooding (from groundwater), and sanitary sewer backups. !;N0 175 350FeetCCCCCCWaveland TeWavelandWavelandWavelandWavelandWavelandWavelandWWWWWWWWaveland Taveland Taveland Taveland Taveland Taveland Taveland TWWaWaWaWaWavWavWavWavaveaveaveavevelavelvelvelelaelaelaelaelanlanlanlanandandandandnd Tnd Tnd Tnd TTer Ter TeTeTeTeTeTeTeeTeTeTTTTTTTererererererererererererererdTedTedTedTeTerTerTerTerererererCCCCCCCCCCCCCCCCCSSSSSSSSSSSSSSSSSSSSOOOAveAveAveAveAveAveAveOakdale AdaledaledaledaledaledaleOakdale Avedale Avedale Avedale Avedale Avedale Avedale AvelOOOOOOOOOOOOOOOOOOOOOOOOaOOOOOOaaaaaaaOOOOaaaakkkkddddaaaalllleeeeAvAvAvAvAvAvAvAveeeeW 42 1/2StW421/2StW421/2StW421/2StW421/2StW421/2StW421/2StW421/W421W421W421W421W421W421 /2 St2St2St2St2St2St2St/W W W W 44442 2221111/////2 222SSSSt tttOOOOOOOOOOOOtOttawa AOOttawa AOOOOOOOtttttttttttttttttOtOOOOttOtOtOttttttttttttttttttttttaaaaaaaaaaawwwwwwwwwwwwwwwwwwwwwwwwawaaaaaaaaaaattttttttaaaawwwwaaaaAAAAAAAAAAAAAAAAAAAAASSSSSSSSSSSSSAAAAAAAAAAAAALLSSSSSSSSSSSSSSSSSSSSOOOAve Oakdale OOa daOOOOaaaakkkkddddaaaalllleeeeAvAvAvAvvvvveeeeAAAAAAAAAAAAAEstimated cost of floodwall:$850,000Estimated cost of excavation areas:$4.2 MillionChange in risk of damage to homes is based on predictive modeling parameters; however, no home is ever removed from all flood risk.We want to hear from you! Morningside Flood Infrastructure ProjectCHANGE IN HOMES EFFECTED (Each symbol equals 10 homes):ESTIMATED COST REDUCTION FOR DAMAGES NEIGHBORHOOD-WIDE (9 homes removed from risk) *This scenario assumes that homes along Lynn and Kipling would be redeveloped at a higher elevation.Change in risk of damage to homes is based on predictive modeling parameters; however, no home is ever removed from all flood risk.France Ave SW 44th St Grimes Ave W 42nd St Sunnyside Rd Ewing Ave SMorningside Rd W 40th St Alden Dr Scott Ter Lynn Ave Kipling Ave Wood Dal e A v e SBranson St Crocker Ave Monterey Ave Lynn Ave SJoppa Ave SKipling Ave SNatchez Ave SW 41st St Inglewood Ave SW 40th La Eaton Pl Dart Ave Ottawa Ave SW 45th St Oakdale Ave Curve A v e Inglewood Ave W 46th St W 42 1/2 St Meadow Rd Colgate Ave Town e s R d Little St Monterey Ave SGlendale Ter Natchez Ave Waveland Ter Sunnyside Ave Ewing Ave SOttawa Ave SLynn Ave W 41st St Ottawa Ave SW 40th St W 45th St Oakdale A v e France Ave SFrance Ave SFrance Ave SW 44th St W 44th St W 44th St Grimes Ave Grimes Ave Grimes Ave W 42nd St W 42nd St W 42nd St Sunnyside Rd Sunnyside Rd Sunnyside Rd Ewing Ave SEwing Ave SEwing Ave SMorningside Rd Morningside Rd Morningside Rd W 40th St W 40th St W 40th St Alden Dr Alden Dr Alden Dr Scott Ter Scott Ter Scott Ter Lynn Ave Lynn Ave Lynn Ave Kipling Ave Kipling Ave Kipling Ave Wood Dal e A v e S Wood Dal e A v e S Wood Dal e A v e SBranson St Branson St Branson St Crocker Ave Crocker Ave Crocker Ave Monterey Ave Monterey Ave Monterey Ave Lynn Ave SLynn Ave SLynn Ave SJoppa Ave SJoppa Ave SJoppa Ave SKipling Ave SKipling Ave SKipling Ave SNatchez Ave SNatchez Ave SNatchez Ave SW 41st St W 41st St W 41st St Inglewood Ave SInglewood Ave SInglewood Ave SW 40th La W 40th La W 40th La Eaton Pl Eaton Pl Eaton Pl Dart Ave Dart Ave Dart Ave Ottawa Ave SOttawa Ave SOttawa Ave SW 45th St W 45th St W 45th St Oakdale Ave Oakdale Ave Oakdale Ave Curve A v e Curve A v e Curve A v e Inglewood Ave Inglewood Ave Inglewood Ave W 46th St W 46th St W 46th St W 42 1/2 St W 42 1/2 St W 42 1/2 St Meadow Rd Meadow Rd Meadow Rd Colgate Ave Colgate Ave Colgate Ave Town e s R d Town e s R d Town e s R d Little St Little St Little St Monterey Ave SMonterey Ave SMonterey Ave SGlendale Ter Glendale Ter Glendale Ter Natchez Ave Natchez Ave Natchez Ave Waveland Ter Waveland Ter Waveland Ter Sunnyside Ave Sunnyside Ave Sunnyside Ave Ewing Ave SEwing Ave SEwing Ave SOttawa Ave SOttawa Ave SOttawa Ave SLynn Ave Lynn Ave Lynn Ave W 41st St W 41st St W 41st St Ottawa Ave SOttawa Ave SOttawa Ave SW 40th St W 40th St W 40th St W 45th St W 45th St W 45th St Oakdale A v e Oakdale A v e Oakdale A v e Imagery: Hennepin County, 2018WeberParkWeberParkPond ExcavationExisting Park Existing Stormsewer PipeParcelsSubwatershedLEGENDPredictive PumpingFloodwallIncreased StormSewer Pipe SizeLand ExcavationRaise HomesExisting Park Existing StormSewer PipeParcelsLEGENDEmergency OverflowExcavationSwaleLower StreetsWHAT IT IS:Scenario: Graded OverflowsWith this scenario, both West 42nd Street and West 40th Street would be lowered up to approximately 2 feet and regraded to route stormwater more directly to Weber Park and Weber Pond. This would limit flow south along Monterey, Lynn, and Kipling Avenues. The ball fields in Weber Park would also be lowered to create additional stormwater storage; these fields would not be playable during a 5-year (or greater) storm. A 5-year storm is defined as 3.6 inches of precipitation over a 24-hour period and has a 20% chance of occurring in any given year. Unlike the pipes scenario, this one would not use the floodwalls to mitigate the risk transfer, so its overall benefit was reduced. This scenario assumes that homes along the west side of Lynn and east side of Kipling would rebuilt at higher elevation through the normal turnover and/or rebuild process, the timeline of which is determined by property owners.(Reduced risk in 54 homes)(Increased risk in 41 homes)10%WHAT IT DOES:Provide your feedback for these scenarios at: www.bettertogetheredina.org/morningsideThe large number of connections and other utility conflicts add significant cost and complexity. By itself, this scenario conveys water downstream—which benefits upstream properties but transfers risk to homes downstream. In addition, the location of the graded overflow along West 42nd Street includes a portion of the street (east of Grimes Avenue) was reconstructed in 2014 and is not part of the street reconstruction planned for 2022/2023; therefore, the City would like to avoid additional reconstruction for that portion of 42nd Street. While the lowering and grading of streets does not appear to be a practical option, the overflow swale in the park does present a feasible opportunity for providing a flood-risk-reduction benefit, especially when combined with other flood-risk-reduction components shown in the other factsheets. WHAT WE LEARNED:Do you know your home’s flood risk? If not, check it out on the City’s interactive map: www.edinamn.gov/floodingThe method for quantifying flood risk considers (1) the probability and magnitude of flood events, (2) the probability of damage, (3) the amount of damage expected if no changes are made, and (4) the damage expected with each scenario. Included in this assessment are damages to homes from surface flooding, indirect flooding (from groundwater), and sanitary sewer backups. !;N0 175 350FeetThis rendering is an estimated representation of the study scenario, not a final design concept. CONCEPTUAL SWALE AND TRAIL NEAR BALLFIELDSSSSStTScottScott TSco TSSSSSSSSSSSSSSSSSSSSSSSSSooooooooottotttttttttttttttttttttttttttttttttTTTTTTTTerTerer TeTeTeTeTeTeTeTeeeeeeeeeeerrrrrrrccccotoooottttttt tttTeTeTeTeTeTeTeTer rrrColgate AveAveColgate AvevvvvvvvveveveveveveveAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeeeeeeeete Ate Ate Ate Ate Ate Ate AeteteteteteteteaaaaaaaatttttttggggggggagagagagagagaoCoCCCCCCCCCoCoCoCoColColColCololgolgolgolgolgalgalgalgagatgatgatgatateateateateteteteteAvAvAvAvAveAveAveAveveveveveWWWWWWWWWWWWWWWWWWWWWWWavelaWavelaWWWWWWWWWWaWaWaWaaavavavavavavavavavavavavavavavWavvvvvvvveveveveveveveeellandelandelelelelelelelaaaaaaaaaaaaaaaalanndananananananandd TedTdddddddddddddddddddddWavWavWavWavaveaveaveavevelavelvelvelelaelaelaelaelanlanlanlanandandandandnd Tnd Tnd Tnd TTer Ter TeTeTeTeTeTeTeeTeTeTTTTTTTererererererererererererererdTedTedTedTeTerTerTerTererererereveveeeeeeevvvvveveveveevevevvvvvveveveve*Further project definition and public input are needed before developing a cost estimateWe want to hear from you! CHANGE IN HOMES EFFECTED (Each symbol equals 10 homes):ESTIMATED COST REDUCTION FOR DAMAGES NEIGHBORHOOD-WIDE Morningside Flood Infrastructure ProjectFrance Ave SW 44th St Grimes Ave W 42nd St Sunnyside Rd Ewing Ave SMorningside Rd W 40th St Alden Dr Scott Ter Lynn Ave Kipling Ave Wood Dale A v e SBranson St Crocker Ave Monterey Ave Lynn Ave SJoppa Ave SKipling Ave SNatchez Ave SW 41st St Inglewood Ave SW 40th La Eaton Pl Dart Ave Ottawa Ave SW 45th St Oakdale Ave Curve A v e Inglewood Ave W 46th St W 42 1/2 St Meadow Rd Colgate Ave Town es R d Monterey Ave SGlendale Ter Natchez Ave Waveland Ter Sunnyside Ave Ewing Ave SOttawa Ave SLynn Ave W 41st St Ottawa Ave SW 40th St W 45th St Oakdale A v e France Ave SFrance Ave SFrance Ave SW 44th St W 44th St W 44th St Grimes Ave Grimes Ave Grimes Ave W 42nd St W 42nd St W 42nd St Sunnyside Rd Sunnyside Rd Sunnyside Rd Ewing Ave SEwing Ave SEwing Ave SMorningside Rd Morningside Rd Morningside Rd W 40th St W 40th St W 40th St Alden Dr Alden Dr Alden Dr Scott Ter Scott Ter Scott Ter Lynn Ave Lynn Ave Lynn Ave Kipling Ave Kipling Ave Kipling Ave Wood Dale A v e S Wood Dale A v e S Wood Dale A v e SBranson St Branson St Branson St Crocker Ave Crocker Ave Crocker Ave Monterey Ave Monterey Ave Monterey Ave Lynn Ave SLynn Ave SLynn Ave SJoppa Ave SJoppa Ave SJoppa Ave SKipling Ave SKipling Ave SKipling Ave SNatchez Ave SNatchez Ave SNatchez Ave SW 41st St W 41st St W 41st St Inglewood Ave SInglewood Ave SInglewood Ave SW 40th La W 40th La W 40th La Eaton Pl Eaton Pl Eaton Pl Dart Ave Dart Ave Dart Ave Ottawa Ave SOttawa Ave SOttawa Ave SW 45th St W 45th St W 45th St Oakdale Ave Oakdale Ave Oakdale Ave Curve A v e Curve A v e Curve A v e Inglewood Ave Inglewood Ave Inglewood Ave W 46th St W 46th St W 46th St W 42 1/2 St W 42 1/2 St W 42 1/2 St Meadow Rd Meadow Rd Meadow Rd Colgate Ave Colgate Ave Colgate Ave Town es R d Town es R d Town es R d Monterey Ave SMonterey Ave SMonterey Ave SGlendale Ter Glendale Ter Glendale Ter Natchez Ave Natchez Ave Natchez Ave Waveland Ter Waveland Ter Waveland Ter Sunnyside Ave Sunnyside Ave Sunnyside Ave Ewing Ave SEwing Ave SEwing Ave SOttawa Ave SOttawa Ave SOttawa Ave SLynn Ave Lynn Ave Lynn Ave W 41st St W 41st St W 41st St Ottawa Ave SOttawa Ave SOttawa Ave SW 40th St W 40th St W 40th St W 45th St W 45th St W 45th St Oakdale A v e Oakdale A v e Oakdale A v e Littel St Imagery: Hennepin County 2018WeberParkWeberParkMinikahdaVistaParkMinikahdaVistaParkPond ExcavationExisting Park Existing StormSewer PipeParcelsLEGENDPredictive PumpingThis rendering is an estimated representation of the study scenario, not a final design concept. WHAT IT IS:Scenario: Ponds and Predictive PumpingAdditional stormwater storage would be provided through excavation and regrading of the open park space area between Lynn Avenue and Kipling Avenue (north of West 42nd Street). Predictive pumping systems would be installed from that open park space area and Weber Pond to Minikahda Vista Park. Predictive pumping involves anticipating storms (through weather forecasting) and preemptively pumping water out of stormwater storage areas to create stormwater storage before the storm occurs. The accuracy of predicting localized storms is very uncertain.(Reduced risk in 93 homes)(Increased risk in 6 homes)16%WHAT IT DOES:Provide your feedback for these scenarios at: www.bettertogetheredina.org/morningsideOne challenge with this scenario is that predicting localized storms to facilitate pumping is very difficult and may not be effective. Without additional excavation, benefits are small and primarily limited to the downstream portion of the drainage area. WHAT WE LEARNED:CONCEPTUAL VIEW OF STORMWATER STORAGE AREA BETWEEN LYNN AND KIPPLING AVENUES (Looking south on Lynn Avenue)The method for quantifying flood risk considers (1) the probability and magnitude of flood events, (2) the probability of damage, (3) the amount of damage expected if no changes are made, and (4) the damage expected with each scenario. Included in this assessment are damages to homes from surface flooding, indirect flooding (from groundwater), and sanitary sewer backups. !;N0 175 350Feetrrrrrrrererer eeeer rrrelellandelandaaaaaaaaaaaaaaaaalanndananananananandd TedTddddddddddddddddddddddelelelelelaelaelaelaelanlanlanlanandandandandnd Tnd Tnd Tnd TTer Ter TeTeTeTeTeTeTeeTeTeTTTTTTTerererererererdTedTedTedTeTerTerTerTerererererererererererereeeeeelelaelelelelelaelaelaelaaeeeeeeeeeeeeeeleelalaelelelelelaelaelaelalaaaaEstimated total cost of this scenario:$3.4 MillionChange in risk of damage to homes is based on predictive modeling parameters; however, no home is ever removed from all flood risk.(0 homes removed from risk)Do you know your home’s flood risk? If not, check it out on the City’s interactive map: www.edinamn.gov/floodingWe want to hear from you! Morningside Flood Infrastructure Project(29 homes removed from risk)CHANGE IN HOMES EFFECTED (Each symbol equals 10 homes):ESTIMATED COST REDUCTION FOR DAMAGES NEIGHBORHOOD-WIDE France Ave SW 44th St Grimes Ave W 42nd St Sunnyside Rd Ewing Ave SMorningside Rd W 40th St Alden Dr Scott Ter Lynn Ave Kipling Ave Wood Dale A v e SBranson St Crocker Ave Monterey Ave Lynn Ave SJoppa Ave SKipling Ave SNatchez Ave SW 41st St Inglewood Ave SW 40th La Eaton Pl Dart Ave Ottawa Ave SW 45th St Oakdale Ave Curve A v e Inglewood Ave W 46th St W 42 1/2 St Meadow Rd Colgate Ave Town es R d Monterey Ave SGlendale Ter Natchez Ave Waveland Ter Sunnyside Ave Ewing Ave SOttawa Ave SLynn Ave W 41st St Ottawa Ave SW 40th St W 45th St Oakdale A v e France Ave SFrance Ave SFrance Ave SW 44th St W 44th St W 44th St Grimes Ave Grimes Ave Grimes Ave W 42nd St W 42nd St W 42nd St Sunnyside Rd Sunnyside Rd Sunnyside Rd Ewing Ave SEwing Ave SEwing Ave SMorningside Rd Morningside Rd Morningside Rd W 40th St W 40th St W 40th St Alden Dr Alden Dr Alden Dr Scott Ter Scott Ter Scott Ter Lynn Ave Lynn Ave Lynn Ave Kipling Ave Kipling Ave Kipling Ave Wood Dale A v e S Wood Dale A v e S Wood Dale A v e SBranson St Branson St Branson St Crocker Ave Crocker Ave Crocker Ave Monterey Ave Monterey Ave Monterey Ave Lynn Ave SLynn Ave SLynn Ave SJoppa Ave SJoppa Ave SJoppa Ave SKipling Ave SKipling Ave SKipling Ave SNatchez Ave SNatchez Ave SNatchez Ave SW 41st St W 41st St W 41st St Inglewood Ave SInglewood Ave SInglewood Ave SW 40th La W 40th La W 40th La Eaton Pl Eaton Pl Eaton Pl Dart Ave Dart Ave Dart Ave Ottawa Ave SOttawa Ave SOttawa Ave SW 45th St W 45th St W 45th St Oakdale Ave Oakdale Ave Oakdale Ave Curve A v e Curve A v e Curve A v e Inglewood Ave Inglewood Ave Inglewood Ave W 46th St W 46th St W 46th St W 42 1/2 St W 42 1/2 St W 42 1/2 St Meadow Rd Meadow Rd Meadow Rd Colgate Ave Colgate Ave Colgate Ave Town es R d Town es R d Town es R d Monterey Ave SMonterey Ave SMonterey Ave SGlendale Ter Glendale Ter Glendale Ter Natchez Ave Natchez Ave Natchez Ave Waveland Ter Waveland Ter Waveland Ter Sunnyside Ave Sunnyside Ave Sunnyside Ave Ewing Ave SEwing Ave SEwing Ave SOttawa Ave SOttawa Ave SOttawa Ave SLynn Ave Lynn Ave Lynn Ave W 41st St W 41st St W 41st St Ottawa Ave SOttawa Ave SOttawa Ave SW 40th St W 40th St W 40th St W 45th St W 45th St W 45th St Oakdale A v e Oakdale A v e Oakdale A v e Littel St Imagery: Hennepin County, 2018WeberParkWeberParkMinikahdaVistaParkMinikahdaVistaParkPond ExcavationExisting Park Existing StormSewer PipeParcelsLEGENDPredictive PumpingFloodwallExcavationIncreased Pipe Size and/or New Storm SewerWHAT IT IS:Scenario: CombinationThis scenario combines four approaches: (1) increasing the pipe sizes of storm sewer pipes along West 42nd Street/Crocker Avenue and Grimes Avenue, (2) constructing a floodwall on the east and south sides of Weber Pond to protect adjacent residential properties, (3) installing predictive pumping systems, and (4) excavation to provide additional stormwater storage. Excavation would be in the open park space area between Lynne Avenue and Kipling Avenue and the open area between Susan Lindgren Elementary School and Monterey Avenue. (Reduced risk in 125 homes)(Increased risk in 9 homes)56%WHAT IT DOES:Provide your feedback for these scenarios at: www.bettertogetheredina.org/morningsideCarefully choosing the best aspects of each of the previous scenarios maximizes benefits for all portions of the neighborhood, however, the total cost is high.WHAT WE LEARNED:The method for quantifying flood risk considers (1) the probability and magnitude of flood events, (2) the probability of damage, (3) the amount of damage expected if no changes are made, and (4) the damage expected with each scenario. Included in this assessment are damages to homes from surface flooding, indirect flooding (from groundwater), and sanitary sewer backups. CONCEPTUAL VIEW FROM RESIDENCE AFTER WEBER POND EXCAVATION AND FLOODWALL INSTALLATION!;N0 175 350FeetSSSSSSSSSSSSSSSSStTScottScott TSco TSSSSSSSoooooooottotttttttttttttttttttttttttttttttttTerTTTTTTTerer TeTeTeTeTeTeTeTeeerererererererSSSSccccotoooottttttt ttttttTeTeTeTeTeTeTeTer rrrColgate AveAve Colgate Ave eeeeeeeevvvvvvvveveveveveveveAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAeeeeeeeeteAteAteAteAteAteAteAteteteteteteteaaaaaaaatttttttggggggggagagagagagagaoCoCCCCCCCCCoCoCoCoColColColCololgolgolgolgolgalgalgalgagatgatgatgatateateateateteteteteAvAvAvAvAveAveAveAveveveveveWWWWWWWWWWWWWWWWWWWWWWWavelaWavelaWWWaWWWWWWavavavavavavavavWavavavavavavavvvvvvvvvelveveveveveveelandelandelelelelelelaaaaaaaaalanaaaaaanandanananananand TedTddddddddTdTdTdTdTdTdTWaWaWaWaWavWavWavWavaveaveaveavevelavelvelvelelaelaelaelaelanlanlanlanandandandandnd Tnd Tnd Tnd TTer Ter TeTeTeTeTeTeTeeTeTeTTTTTTTererererererererererererererdTedTedTedTeTerTerTerTerererererEstimated total cost of this scenario:$9 Million*See the other factsheets for costs related to each component This rendering is an estimated representation of the study scenario, not a final design concept. Change in risk of damage to homes is based on predictive modeling parameters; however, no home is ever removed from all flood risk.Do you know your home’s flood risk? If not, check it out on the City’s interactive map: www.edinamn.gov/floodingWe want to hear from you! Barr Engineering Co. 4300 MarketPointe Drive, Suite 200, Minneapolis, MN 55435 952.832.2600 www.barr.com April 13, 2021 Chad Millner, Ross Bintner, and Jessica Wilson Engineering Department City of Edina 7450 Metro Boulevard Edina, MN 55439 Re: Proposal for City of Edina Morningside Flood Infrastructure Project Dear Mr. Millner, Mr. Bintner and Ms. Wilson: This letter presents our proposed scope of services and associated cost estimate for providing services related to the city of Edina’s (City’s) Morningside Flood Infrastructure Design. The scope of work presented below is based on general work tasks discussed with the City’s engineering and parks and recreation staff (City staff) during several meetings held in February and March 2021 and informed by our previous studies including, but not limited to, the most recent studies titled Morningside Neighborhood Flood Risk Reduction Strategy Conceptual Study (November, 2018) and Infrastructure Options to Reduce Flood Risk in the Morningside Neighborhood (February, 2021). 1.0 Project Understanding Anticipated street reconstruction in the Morningside neighborhood in 2022 and 2023 presents an opportunity to explore infrastructure-based solutions to help manage flood risk; therefore, flood-related studies have been completed in the past few years in advance of the expected street reconstruction. These studies have continued to refine flood risk reduction options with consideration for the economics and benefits of a flood risk reduction projection and considering the values of the community through direct engagement with the Flood Risk Reduction Task Force (July 2019 through February 2020), and through a specific engagement plan as part of work completed in 2020 and early 2021. Given the space available in the neighborhood, the values of the community, and the funding available, refined options to reduce flood risk were summarized in Barr’s February 2021 technical memo (Infrastructure Options to Reduce Flood Risk in the Morningside Neighborhood). The design team, including City staff, created and reviewed three various size flood risk reduction project options - “Big”, “Bigger” and “Biggest” – by iteratively adding or removing individual flood risk reduction features of the design. Due to the interconnected relationship of flood storage to pipes, and the all-in cost of some of infrastructure features, some flood risk reduction features were upsized or downsized in one or more of the options. The options were then reviewed to determine which options were providing better value, and which were not. While the three refined options were not fully optimized for stormwater flood risk reduction (i.e., they are still considered preliminary or conceptual design), they represent a good range of the scale and value that can be achieved based on the costs and tradeoffs associated with each. The “Bigger” option is the minimum project required to extend the benefit neighborhood-wide. City staff are recommending Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 2 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx creating infrastructure consistent with the “Bigger” (~$10M) option, with the following features to include in design: Table 1 Summary of individual flood risk reduction features included in the “Bigger” refined option Feature Number from February 2021 Study (see Figure 1) Feature Description for “Bigger” Flood Risk Reduction Project (~$10M) 1 Expanded Weber Pond and Pump Station 2 Surface swale through Weber Park 3 Large box culvert from Kipling Avenue to Grimes Avenue 4 Open space area between Lynn Avenue and Kipling Avenue 8 A portion of Feature 8 - Grading along W 40th Street between Monterey Avenue and Kipling Avenue, to contain surface flows and direct them east to Grimes Avenue 9 Increased storm sewer capacity along W 42nd Street and north portion of Crocker Avenue 9a Increased storm sewer capacity extending south along Crocker Avenue and additional capacity around Branson Street and Morningside Road (not shown on figure) 10 Disconnecting storm sewer at Scott Terrace 1. An expanded and lowered Weber Pond including (Feature 1): a. Expansion into Weber Woods and the removal of approximately 6 acres of trees b. Natural resource restoration and improvement of the entire Weber Woods land area c. Creation of nature trails and a bridge or floating boardwalk connecting east to west across the pond 2. An expanded and lowered Lynn/Kipling inundation area including (Feature 4): a. Tree removal along most of the basin, with several tree stands saved b. A mixed wetland and pond, with aquatic and upland natural resource restoration 3. An expanded pipe and swale to provide overflow from the Lynn/Kipling inundation including (Features 2 and 3): a. A box culvert along the 41st right-of-way and easement corridor between homes b. A landscaped swale along the north side of the active play spaces in Weber Park to provide high flow and clean water benefits, including an east to west park trail. 4. Surface grading in streets and around intersections, and an expanded and reconfigured pipe network extending west on 42nd, south on Crocker, east on Morningside Road, south on Grimes Avenue, and west on Branson Street (part of Feature 8 and Features 9, 9a, and 10) including: a. Expanded surface inlets to fully utilize pipe capacity in extreme events b. Minor changes to grades in streets and curb lines to reduce potential surface flows or flood backflow into low or landlocked areas. Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 3 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx Figure 1 Flood risk reduction feature concept drawing of the refined “Bigger” option includes features 1, 2, 3, 4, a portion of 8, 9, 9a (not shown on figure), and 10. The “Bigger” flood risk reduction option will be optimized once more during final design. This effort will coincide with additional evaluation of predictive pumping feasibility and permitting, including coordination with the Minnesota Department of Natural Resources (MnDNR), Minnehaha Creek Watershed District (MCWD), and the City of Minneapolis. The final design will also consider detailed topographic survey data, landscape design, ecological restoration (related to Weber Park, Weber Woods, and the Lynn/Kipling inundation area), wetland permitting (if necessary), groundwater levels, and soils information from boreholes. The final design will also reconsider the tradeoffs and opportunities and be reassessed for geographical balance that addresses risk reduction and benefits. After optimizing the refined option, the project will be reassessed to finalize the estimate of flood damage reduction benefits. Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 4 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx 2.0 Background The Morningside neighborhood is in the far northeastern corner of Edina, bordering St. Louis Park to the north and Minneapolis to the east (Figure 2). The neighborhood is fully developed with primarily single- family homes built between 1910 and 1960, with some infill happening later and redevelopment currently replacing some structures. The area is characterized by numerous backyard depressions and several large low- lying areas, including Weber Park. There are two large stormwater detention basins in the area (Weber Pond and a temporary inundation area between Lynn Avenue and Kipling Avenue, north of West 42nd Street). The area is drained by a piped outlet that conveys stormwater to Bde Maka Ska in Minneapolis. The storm sewer and detention basins in this area were originally designed for the 50-year (i.e., 2%-annual-chance) storm event using now outdated rainfall estimates. Portions of this watershed have experienced flooding. Flood risk in the Morningside area has been studied in detail by Barr and others. Data and results from previous studies as well as feedback from the community on values and tradeoffs have been considered, referenced, and updated as needed to inform, evaluate, and design flood risk reduction options. The recommended conceptual design (the “Bigger” option) is based on combinations of flood risk reduction alternatives evaluated through previous engineering studies and cost/benefit analyses. 3.0 Project Scope of Work The following subsections provide Barr’s detailed scope of work, associated assumptions, and costs to design the “Bigger” option. Please note that, as requested by City staff, this scope of work ends at “bidding support” (i.e., does not include construction support and construction observation); however, these services can be negotiated at a later time. There are six major deliverables associated with this scope of work. A Basis of Design Report (BDR), drawings/plans, specifications, permit application(s), a cost estimate, and an Operation and Maintenance Manual for the proposed pump station. Each of the major project tasks described below, except for Task 3.1 “Project Initiation” and Task 3.12 “Project Management”, has a list of deliverables specific to the task Figure 2 Morningside neighborhood study area (storm sewer lines shown in dark gray) Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 5 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx that are tied to these main six deliverables. Deliverables will occur at three major milestones: 30% design, 60% design, and 100% design (issued for bid); however, not all of the deliverables will be produced at each milestone. Section 6.0 summarizes the deliverables associated with each of the major project milestones. 3.1 Project Initiation Barr will participate in a project kickoff meeting with Edina staff to review the project’s scope and schedule. Prior to the kickoff meeting, Barr will complete an existing data review and will be prepared to discuss potential data gaps with the City during the kickoff meeting. We will create a client service plan based on input from City staff during our project kickoff meeting to document City expectations and preferences. This plan will be a guide to all team members. Items covered in the client service plan will include (a) contact information for relevant team members given our current work-from-home situations for both City staff and Barr staff, (b) communications preferences (communicating via telephone vs. email and at regular intervals or on an as-needed basis), (c) status report preferences (frequency, items to include, etc.), and (d) invoicing requirements. Deliverable(s): • List of data gaps and/or information need from City staff and/or other stakeholders to proceed with the project • Meeting notes from project kickoff meeting. • Final client service plan. Assumptions: • The project kickoff meeting will be held virtually and will be one hour in duration. 3.2 Project Permitting 3.2.1 Agency Coordination We understand the City has already initiated permitting discussions with the MnDNR regarding potential regulatory triggers for the project. Additional permits and/or approvals may be required from the U.S. Army Corps of Engineers (USACE), Minnesota Pollution Control Agency (MPCA), City of Edina, City of Minneapolis, and the Minnehaha Creek Watershed District (MCWD). In addition, permit needs and applicability may change as more detailed design is achieved. Agency coordination meetings are an important element to keep regulators informed as the project progresses and also to develop common project understanding that can be translated to determining permit applicability. Barr staff will participate in four agency coordination meetings throughout the duration of the project to evaluate that permitting needs are properly identified and pursued. Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 6 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx Deliverable(s): • Meeting notes from each agency coordination meeting to document attendance, discussion topics, and decisions. Assumptions: • Up to three Barr staff will participate in each of four agency coordination meetings • Coordination meetings will be held virtually and will be one hour in duration. • Barr will assist the City in developing a meeting agenda and relevant graphics in advance of each agency coordination meeting; however, it is assumed that the City will take the lead on scheduling agency meetings and providing follow-up materials. 3.2.2 Field Wetland Delineation Barr staff will complete a field wetland delineation in areas of proposed project disturbance in accordance with the USACE Wetland Delineation Manual and associated regional supplement. The purpose of the wetland delineation is to identify if there are any wetlands or other waters that may be subject to jurisdiction by the USACE or under the Minnesota Wetland Conservation Act (WCA). The field wetland delineation will identify and map all areas of wetland and other waters using a handheld GPS unit with sub-meter accuracy. Data will be collected at paired sample points and evaluated for indicators of wetland vegetation, soils, and hydrology. Photographs of each delineated area will be noted, and findings will be recorded on USACE wetland delineation data sheets. Culverts and other forms of water conveyance will be noted in the field if observed. Barr will prepare a report of findings based on the field wetland and other waters evaluation. It is expected that the City will provide Barr with plans or other documentation related to constructed surface water features in the delineation study area as this information may be important in determining if a delineated feature is naturally occurring or man-made and, therefore, how it shall be regulated. Barr will submit the delineation report to the local government unit (LGU) responsible for administering WCA (Minnehaha Creek Watershed District) requesting a wetland type and boundary confirmation. In addition, Barr’s delineation staff will participate in one field review with the technical evaluation panel (TEP) to review the delineated wetlands and seek confirmation. The TEP is anticipated to consist of representatives from the LGU, MnDNR, USACE, and/or Minnesota Board of Soil and Water Resources (BWSR). A representative from the City may also attend the TEP review should the City choose to participate. Barr will inform the City of the TEP review findings and determine how it may influence the permitting path forward. Deliverable(s): • Field wetland delineation report completed to USACE reporting standards. This report will be attached to, and summarized in, the BDR. Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 7 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx • Wetland boundary type and confirmation form submittal to initiate TEP review (if LGU deems necessary) • GIS shapefile of delineated wetland/waterbody boundaries Assumptions: • Wetland delineation will be completed by two Barr staff in a single mobilization effort that captures all areas of project disturbance based on the extent of the project included for 30% design. • City will be responsible for notifying and/or acquiring permission from property owners to survey. • The wetland delineation will be completed during suitable growing season conditions, which typically begins in late May to early June and extends through late September/early October. • City will make available all construction plans and records of constructed stormwater ponds in the wetland delineation survey area. • City will authorize Barr to submit wetland boundary type and confirmation form and participate in TEP review on its behalf. A representative from the City may also attend the TEP review should the City choose to participate. 3.2.3 Weber Pond Sediment Sampling We will conduct sediment characterization for Weber Pond in accordance with the MPCA guidance document “Managing Stormwater Sediment Best Management Practices Guidance.” Per the guidance parameters, a total of four sediment coring locations will be established in Weber Pond. Two samples will be collected at each of these coring locations: a composite of accumulated pond sediment and a composite of native underlying soils to the approximately excavation depth. For removal of accumulated sediment, the MPCA guidance indicates a single composite sample for each sediment core. However, since the project would deepen Weber Pond into native soils below the originally constructed pond bottom, we recommend deeper samples to better inform design. The deeper samples would serve an additional purpose - if testing results indicate the sediment could not be reused as fill, separate testing of the underlying native soils could demonstrate that contamination is limited to accumulated sediment and therefore could be segregated from native soils for separate handling and disposal. We will collect one soil sample from the north portion of Weber pond where a previous soil boring (ST-2) indicated possible fill material from 0 to 7 feet below ground surface. A composite soil sample will be collected by hand auger to a depth of 7 feet or depth of refusal to evaluate potential fill depth. Finally, we will collect one duplicate sample to satisfy the MPCA guidance document’s requirement for one duplicate per 10 samples collected. The MPCA guidance advises analyses of arsenic, copper, and polycyclic aromatic hydrocarbons (PAHs) as minimum baseline parameters. Other analyses may be considered based on watershed use and known environmental concerns in the watershed. We propose testing samples for diesel range organics and gasoline range organics. In addition, we propose testing for all eight Resource Conservation and Recovery Act (RCRA) metals (arsenic, barium, cadmium, chromium, lead, mercury, selenium, and silver). While metals other than arsenic seldom exceed applicable soil criteria in stormwater pond sediment, testing can facilitate acceptance of excavated sediment either for reuse offsite or landfill disposal. Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 8 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx We will collect samples by boat and will deliver samples to Pace Analytical in Minneapolis for analysis. Upon receipt of analysis results, we will prepare a summary memo comparing testing results to applicable MPCA soil criteria and make a recommendation on whether sediment and native soils can be reused as fill or if landfill disposal of excavated materials is required. Deliverable(s): • Samples properly collected and delivered to Pace Analytical with appropriate chain of custody documentation. • Summary memo of results compared to MPCA soil criteria and recommendation on potential for reuse or landfill disposal. Assumptions: • A total of 8 samples will be collected at Weber Pond, with two samples collected at each of 4 coring locations. • One hand auger soil boring sample will be collected at previous soil boring location ST-2. • One duplicate sample will be collected to satisfy MPCA duplicate sampling requirements • Samples will be analyzed for PAHs, arsenic, copper, barium, cadmium, chromium, lead, mercury, selenium, silver, diesel range organics, and gasoline range organics. • Sediment samples will be collected through use of a small boat deployed by two Barr staff into Weber Pond. The City will facilitate site access. 3.2.4 Permit Application Submittals and Coordination At the current, concept-level design, it is difficult to determine exactly which permits and/or approvals for the project may be required. Agencies with potential permitting and approval authority over the project include: MnDNR (groundwater, FEMA floodplain), USACE (wetlands/other waters), WCA LGU (wetlands/other waters), MPCA (construction disturbance, and dredged materials management), Minnehaha Creek Watershed District (erosion control, floodplain alteration, wetland protection, stormwater management, shoreline stabilization, etc.), Hennepin County (construction access for hauling of materials), and City (utility, grading, and/or construction). Exact permitting needs will be determined as design progresses. As such, Barr has included a permitting allowance of $35,000 to be used for permit application preparation, application review meetings with the City (one meeting per application), submittal, and follow-up coordination. Deliverable(s): • Applicable permit application documents. Assumptions: • Permit applications will be developed based on 60% design. • A desktop threatened and endangered species evaluation memo will be completed to accompany permit applications and for use in determining if any relevant construction timing restrictions are applicable. • City will review all permit application materials prior to submittal. • City will authorize Barr to coordinate directly with regulatory entities in response to questions on submitted permit applications. Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 9 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx • Mitigation for unavoidable impacts to regulated wetlands and other waters will be coordinated as part of an amendment to this scope of work. • City will be responsible for submitting permit review fees directly. • Environmental review under the National Environmental Policy Act or Environmental Quality Board-administered Minnesota Environmental Policy Act will not be required as the project design will not meet or exceed any mandatory Environmental Assessment Worksheet or Environmental Impact Statement thresholds. 3.3 Landscape Design and Ecological Restoration 3.3.1 Tree Survey & Ecological Quality Assessment To best protect existing ecological conditions and to assess for restoration feasibility, a tree survey and ecological quality assessment will be conducted to clearly identify existing natural resources condition and value. Subtasks will include: a. Conducting a tree survey. a) Survey with a GPS unit to include all trees within project area above 8-inch diameter or 12-inch diameter at breast height (d.b.h.). Assess for: i) Species ii) Diameter; softwoods greater than 12-inches will be surveyed and hardwoods greater than 8- inches will be surveyed. iii) Structural quality and tree health b) Development of a tree survey map and spreadsheet of species attributes. b. Conducting an ecological quality assessment using the MnDNR’s Minnesota Land Cover Classification System (MLCCS) quality definitions. a) Develop GIS map of the project area and delineate polygons of habitat types as seen on aerial image. b) Conduct field assessment for qualify and identify land cover (plant community) using MLCCS definitions. c) Map ecological quality rankings and land cover type for the project area. d) Develop a brief graphical report of ecological conditions. Deliverable(s): • GIS figure with tree survey results, ultimately placed in the BDR. • GIS figure with ecological quality results, ultimately placed in the BDR. • Brief graphical report of ecological conditions in a section of the BDR. Assumptions: • Tree survey and ecological quality assessment will be completed by 2 Barr staff over 2 day(s) Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 10 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx 3.3.2 Park Design, Landscape Architecture & Ecological Restoration Two aspects of park design will be accomplished: first, improvement to the recreational facilities within Weber Park, and second, ecological restoration of natural areas within the Weber Park, Weber Woods, and the Lynn/Kipling inundation area. Recreational facilities improvement is anticipated to include shifting the arrangement of existing ice rinks and recreational fields (softball/baseball fields) to balance the needs of the flood mitigation plan with the needs of parks and recreation. Recreational facilities will be upgraded and arranged for best function. Stormwater facilities and natural areas will be designed to accommodate people for passive recreation, improve wildlife habitat, and improve overall ecological value. Subtasks will include: a. Assessing existing park conditions. a) Conduct a park walk-through with City staff (and others as the City sees fit) to discuss current issues and future aspirations for the park. b) Conduct a site investigation of the park’s physical features including facilities, natural vegetation and plantings, soils, drainage patterns, and wildlife habitat. c) Develop an assessment maps that identify existing conditions, issues, and areas of improvement. This will be sent to City staff for evaluation. Redline comments provided by the City will be used to develop a final map. b. Evaluating and refining the existing park programing. a) Meet with City staff (including Parks and Recreation staff) to discuss current conditions of the park, current and future plans for park programming, issues with recreational function, maintenance, and opportunities for improvement. b) From this discussion develop a written park program to be reviewed by City staff. The program will be refined and finalized with comments from City staff and will help guide design. c. Conceptual design (30% design). a) Develop a first conceptual design iteration of the Weber Park, Weber Woods, and the Lynn/Kipling inundation area in sync with the flood mitigation plan. This will be presented to City staff for review and comment. b) City staff comments will be used to refine the conceptual design in a second conceptual design iteration that will be provided to City staff for review. c) City staff’s second round of comments will be used to develop a revised conceptual design (third conceptual design iteration) for presentation at a public meeting and at a City Council work session. d) Develop graphics such as perspective renderings for the public presentation. e) An engineer’s opinion of probable construction cost (for 30% design phase) d. Public participation process. a) Develop temporary signage of the conceptual park plan to be posted at the park for public inspection. Provide draft signage to City staff for one round of review, and then incorporate suggested changes into the final signage. Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 11 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx b) Develop a presentation of the park conceptual plan (reflecting the third conceptual design iteration) and present at a public meeting at the park (or virtually, as needed). Notes will be taken at the public meeting and distributed to City staff after the meeting. c) Following the public meeting we will meet with City staff to discuss public comments collected at the public meeting and determine which comments should be addressed as part of a fourth conceptual design iteration. We will document public comments and City responses to those comments. d) Provide graphics and written material for Edina staff to use in public communications. e) The fourth conceptual design iteration will be used to present at a City Council work session. Any comments from the City Council work session will be discussed with City staff and incorporated into the design, as needed. e. 60% Design. a) The 60% design will provide additional detail including: i) Refinements to overall park layout. ii) Circulation and connectivity layout. (1) Bridge or boardwalk design for a water crossing in Weber Woods. (2) South parking lot reconfiguration, if possible (parking lot at 42nd Street and Alden Drive). iii) Grading and drainage. (1) Soils regeneration plan. (2) Recreational field soil profile plan. i) Detailed swale design (Weber Park) for integration with recreation. ii) Plantings; trees, shrubs, herbaceous perennials, and natural areas habitat plantings. iii) Recreational fields and high-quality turf design. (1) Fencing for the reconfigured recreational fields i) Ice rink lighting. ii) Irrigation plan to include zones to be irrigated and type of irrigation. iii) Lynn/Kipling inundation area habitat design. iv) A phasing plan for up to 2 phases of construction, if necessary b) 60% plans will be packaged and sent to City staff (to be included in the 60% design package that will also include plans from other project design elements). A meeting will be conducted to walk staff through the plan set and answer questions. City staff then can redline the plan set for changes to be incorporated into the final plan set. f. Final design (100%) including: a) Technical specifications and bid form. b) Construction plan sheets and landscape details (to be included in the 100% design package that will also include plans from other project design elements). c) One meeting to discuss final park details. d) Final engineer’s opinion of probable construction cost (100% design) Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 12 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx Deliverable(s): • Park assessment map that identifies existing conditions, issues, and areas of improvement (one draft and a final version). • Written park programing (one draft and a final version). “Programing” here is defined as a list of facilities to be designed for construction. • Graphics such as perspective renderings for the public presentation. • Graphics and written material for City staff to use in public communications. • Temporary signage of the conceptual park plan to be posted at the park prior to the public meeting. • Notes from public meeting. • A section of the BDR documenting the park assessment (including the map), public meetings, and the basis for the design of the park. • Three iterations of the park conceptual plan (30% design). • 60% plan set (to be included in the 60% design package that will also include plans for other project design elements). • 100% plan set with details and specifications (to be included in the 100% design package that will also include plans for other project design elements). • Three-year establishment maintenance plan for natural areas. • Phasing plan. • Preliminary and final engineer’s opinion of probable construction cost. • Bid Form. Assumptions: • No new recreational facilities or fields will be added to the park (note that some recreational fields will be relocated). • Three iterations of the conceptual design (30% design) are included. • Two meetings with City staff to discuss 30% design concepts. • Two iterations of the 60% design are included. • City staff will provide comments on the first two iterations of the concept design within one week. • City staff will manage the Better Together Edina website and social media (Next Door, Facebook, Twitter) in the public engagement process. • 40 hours of graphics development (e.g., perspective renderings) for the public presentation. • 24 hours for graphics and written material for public communications. • As identified in the City’s Public Participation Plan (attached) developed for this project, City staff will be responsible for these aspects of the process: introduce project, share concept design, decide, and close the loop. Barr will provide materials to communicate findings and plans. Barr will participate in one public meeting and one City Council work session to share the concept design. • Two posters showing the conceptual park plan to be temporarily posted at the park prior to the public meeting. • 29 sheets are assumed for the landscape architectural design and plant community restoration of the park. • Barr will develop an irrigation plan to include zones to be irrigated and type of irrigation. Detailed design and specification of the irrigation plan will be developed outside of this scope by an irrigation contractor selected through the bidding process. Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 13 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx • City staff will develop front end documents for the specifications. • The potential for irrigating parkland with water from Weber Pond (stormwater reuse) will be evaluated for feasibility (see next section) but the cost estimate does not reflect the inclusion of stormwater reuse as part of final design. 3.4 Civil Site Design 3.4.1 Site Survey The design of the Morningside Flood Risk Reduction Project will require detailed survey throughout the area. Necessary survey data will include: topography capable of producing 1-foot contours particularly in Weber Park and Weber Woods; delineations of Weber Park features such as ball fields, fences, walls, paving, buildings, and landscaped areas; locations of trees 8” and larger; all utilities overhead and underground; residential home low entries; easements; streets including curb and gutter; and storm sewer. The survey will also include placing up to four benchmarks throughout the neighborhood where existing benchmarks are not nearby. The survey will need to be completed early on in the project so that 30% drawings can be delivered on schedule. Some of the survey is expected to be completed by the City of Edina staff. In particular, topographic survey of the streets (including curb and gutter) and storm sewer within the streets. Coordination with the City will be required to prioritize areas for survey that are most critical or have the largest data gaps ahead of the 30% deliverable. Completing necessary survey data on time will be crucial to meeting the schedule outlined in this scope of work (Section 6.0). Deliverable(s): • AutoCAD and Civil3D files of all survey data Assumptions • All surveying work not performed by City staff will be subcontracted (Barr will coordinate with the subcontractor). • Horizontal coordinates system is Hennepin County, feet, and vertical datum is NGVD29. • City staff will be surveying the street topography. • City staff will be surveying all storm sewer within the street corridors, including inverts of pipes. • Barr will coordinate with City staff on prioritizing areas of survey. If the City has limited staff capacity for survey, Barr may need to subcontract additional survey which will require a change to this scope. • 162 homes have been identified as requiring low-entry survey. If this number increases significantly, a change order may be required. • We assume that the bathymetry data available in Weber Pond (obtained in May of 2017 according to City documentation) is suitable and additional bathymetry data is not needed. Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 14 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx 3.4.2 Expanding Weber Park Pond The “Bigger” flood risk reduction option includes expanding the size of Weber Pond to create additional flood storage in the downstream-most portion of the neighborhood. The pond bottom and outlet elevation will be lowered. The outlet will be changed to a pumped outlet with the addition of a predictive pumping system to draw the pond water surface down both in advance of large storm events and after storm events have passed. With the expansion and lowering of Weber Pond, groundwater flow into the pond may increase, and may require an increase in regular discharge downstream (or baseflow in the downstream storm sewer). This increased baseflow may be a regulatory or permitting challenge and may require additional mitigation efforts to reduce groundwater inflow into the pond. However, given the high groundwater levels and the substrate, simply lining the pond with a low permeability material such as clay or a geo-synthetic liner may be infeasible. Dewatering at the site may be a challenge due to soil stratigraphy, and groundwater uplift pressures on the liner may make placement exceedingly difficult and expensive, if not impossible. Therefore, we propose a detailed look at the feasibility of a liner, and additionally, an alternatives study and comparison to identify other ways to manage increased groundwater flow to Weber Pond. Subtasks will include: a. Grade proposed pond area to match modeled volumes as closely as possible to create expanded flood volume and to minimize quality tree removal to the extent feasible. b. Design pond outlet structure, coordinated with pump station design and forcemain c. Supporting the City to design emergency overflow swale from low point in 42nd St West, between 3912 and 4000 42nd St West (within the City’s easement), to Weber Park Pond. Barr will coordinate with City staff for modifications to street or curb elevations in this location. City staff will be developing construction plans for the reconstruction of 42nd St West. We expect that the City will expand the limits of their drawing set to include the portions along W 42nd Street, east of Grimes Avenue. Barr’s plans will start at the back of the curb. d. Study the feasibility of a liner system in the expanded and lowered Weber Pond. e. Alternatives assessment to managing groundwater inflows to Weber Pond so that the Project is permittable. Assumptions: • City staff will develop front end documents for the specifications. • City of Edina will expand the limits of their drawing set to include all of 42nd Street West, particularly east of Grimes Avenue. • 3 meetings with City staff to discuss grading at overflow location. • Groundwater levels are high enough relative to the proposed pond bottom and site soil stratigraphy is such that dewatering will be difficult and groundwater uplift pressures under a liner system would make placement exceedingly difficult. • Increases in the baseflow (which currently exists in the storm sewer outlet from Weber Pond) are acceptable, if small (not yet defined). Larger increases will not be permittable and create a need to manage increased groundwater flow to Weber Pond. Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 15 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx • 1 meeting with City staff and other stakeholders to discuss alternative means of managing increased groundwater flow • A technical memo will be prepared for 30% design discussing the liner and alternative management strategies so that a decision can be made in advance of the 60% deliverable. 3.4.3 Weber Park Alterations A surface swale will be constructed through Weber Park, between existing park features or park features that may be modified as part of the project. The swale will extend from Grimes Avenue to the expanded Weber Park Pond, conveying extreme event surface flow from the west in a controlled manner. Alteration to the park amenities will be required due to the swale and the expanded pond size. Subtasks will include: a. Grading of the surface swale from Grimes Avenue, through the park, and into Weber Park Pond b. Grading of the relocated park features including one ball field and one ice rink. Additional recreational facilities will be impacted (such as the open skate area, and two additional ball fields), however they are not expected to require grading work. Assumptions: • Tennis courts, parking lot, and warming house will remain in place. • No new recreational facilities or fields will be added to the park (note that some recreational fields will be relocated) • Reuse of stormwater for irrigation purposes will be evaluated at a concept level (see section 3.4) but the cost estimate does not reflect the inclusion of stormwater reuse as part of final design. • 3 meetings with City staff to discuss park grading and features. 3.4.4 Box Culvert from Kipling to Grimes A box culvert will be constructed starting at the outlet of the pond west of Kipling, between the homes at 4025 and 4101 Kipling Avenue (on existing City right-of-way), between the homes at 4024 and 4100 Grimes Avenue (easement on vacated City right-of-way). The box culvert will cross Grimes Avenue and outlet into the surface swale in Weber Park. Subtasks will include: a. Box culvert alignment, plan and profile. b. Existing utility conflict check. c. Alignment, plan, and profile for relocating any existing storm, sanitary or watermain utilities in conflict with the box culvert. Conflict with other utilities will be noted on the plan for relocation during construction. Assumptions: • Barr will coordinate with City staff for modifications to street or curb elevations in this location. City will be developing construction plans for the reconstruction of Kipling Avenue and Grimes Avenue. Barr’s plans will start behind back of curb at all areas along the culvert alignment. • 3 meetings with City staff for coordination. • No undisclosed (e.g., private) utilities. Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 16 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx 3.4.5 Expansion and Lowering of the Lynn/Kipling Inundation Area The open space between Lynn and Kipling Avenues is periodically inundated by stormwater. The current normal water level is controlled by the two storm sewer outlets available in the northwest and northeast corners. These outlets will be reconstructed so the outlet control level is lowered by approximately 3 feet. Additionally, the area will be dredged to create more storage capacity. Subtasks will include: a. Grade the area to be lowered to match the modeling volumes as close as possible while maintaining the outer perimeter of trees to the extent possible. b. Reconstruct both pond outlets c. Tie grading into the proposed box culvert near the northeast corner of the proposed pond Deliverable(s): Deliverables will be given at the following milestones. 30% Design Deliverables will include (to be included in the 30% design package that will also include plans from other project design elements): • 30% Plans – approximately 7 plan sheets o Weber Pond Park preliminary grading plan with structures and overflows identified o Weber Park swale preliminary grading plan with relocated fields and rink shown in plan view o Box culvert plan and alignment with invert elevations identified o Lynn/Kipling inundation area preliminary grading plan with structures and overflows identified o Preliminary grading extents shown in all construction areas • Technical memorandum documenting the findings of whether a liner system is feasible or not and documenting alternative means of managing increased groundwater flow to Weber Pond. This technical memorandum will be attached to, and summarized in, the BDR. • A section of the BDR to describe the design. • 30% concept level engineer’s opinion of probable construction cost 60% Design Deliverables will include (to be included in the 60% design package that will also include plans from the other project design elements): • 60% Plans – approximately 16 plan sheets o Weber Pond Park grading plan with section views o Weber Pond Park outlet preliminary details o Weber Pond Park overflow preliminary details o Weber Park swale grading plan o Weber Park relocated fields and rink grading plans o Box culvert plan and profile with utility or structure conflicts identified o Lynn/Kipling inundation area grading plan with section view o Lynn/Kipling inundation area structure preliminary details o Updated grading extents shown in all construction areas o Preliminary removals plan for all areas o Preliminary sediment and erosion control plan for all areas o Preliminary SWPPP Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 17 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx • The section of the BDR associated with Civil Design will not be updated for the 60% design submittal. 100% Design Deliverables will include (to be included in the 100% design package that will also include plans from the other project design elements): • 100% Construction Plans for Bidding – approximately 42 plan sheets o Removals plan for all areas o Erosion and Sediment Control Plan o SWPPP o Weber Park Pond grading plan and sections o Weber Pond Park structure and overflow details o Weber Park grading plans and details o Box culvert plan and profile, utility relocation plans and profiles o Box culvert details o Lynn/Kipling inundation area grading plan and sections o Lynn/Kipling inundation area structure and overflow details o Traffic Control Plan during construction • A section of the BDR to describe the design. • 100% Technical Specifications for Bidding • Bid Form • Engineer’s opinion of probable construction cost Assumptions: • Barr will meet with City staff once after 30% design deliverables are provided, and once after 60% design deliverables are provided to discuss feedback at each milestone. Comments and feedback will be incorporated in the final construction documents. • City staff will develop front end documents for the specifications. 3.4.6 W 40th Street and W 42nd Street Stormwater Surface Conveyance This task will be conducted by City staff with support from Barr staff. Surface flows along W 40th Street and along W 42nd Street will be redirected to flow east, towards Grimes Avenue and into the expanded Weber Park Pond. Several intersections will need to be modified to raise grade and prevent surface flow from flowing towards the inundation area between Lynn and Kipling along the surface of Monterey Avenue, Lynn Avenue, and Kipling Avenue. The City will include these areas in their drawing sets as part of their 2022 and 2023 street reconstruction work. Barr will support the City to determine necessary grades, flow depths, and other requirements to achieve this stormwater surface conveyance. Subtasks for Barr support work will include: a. Analyze intersections to determine grading modifications to each: W 40th Street and Monterey Avenue, W 40th Street and Lynn Avenue, W 40th Street and Kipling Avenue, W 42nd Street and Kipling Avenue. Provide information to the City and support City staff in creating drawings. b. Determine if additional catch basins are needed at Grimes Avenue. Provide approximate catch basin locations to City staff for inclusion in City street reconstruction plans. Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 18 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx Deliverable(s): • Coordination (and associated documentation) with City staff to confirm design goals and support the drawings/plans produced by the City. Assumptions: • All surveying work will be subcontracted. • Barr will not provide final construction documents for this task. All construction documents for this area will be prepared by City staff with Barr design and review. • 3 meetings with City staff to discuss grading and drainage. 3.5 Evaluation of Stormwater Reuse for Irrigation As final design proceeds for Weber Pond and its predictive pumping scheme during the course of this project, Barr will evaluate opportunities for Weber Pond water to be used for irrigating adjacent recreational fields. If the City chooses to install an irrigation system for these fields in the future (using potable water), supplemental irrigation water from Weber Pond could be a cost-effective way to decrease the City’s use of potable water for field irrigation, and the volume of stormwater traveling downstream to Bde Maka Ska and Minnehaha Creek. This analysis would leverage a Stormwater Reuse Credit Calculator that Barr has developed for clients to assess the efficacy of a combination of site-specific stormwater supply, storage and demand to achieve water quality and water conservation goals. We propose to do a high-level analysis using our Stormwater Reuse Credit Calculator to inform the feasibility of a stormwater reuse component to this project, and to further discussions with potential project partners. An important consideration in evaluating a potential stormwater reuse irrigation aspect to the pumping regime for this particular project is the complexity that it could add to the timing of pond drawdowns. Water that is pumped out in advance of a storm is not water that one needs for irrigation (i.e. it's not useful to water grass right before a storm event). The combination of pumping water for irrigation and pumping water for downstream release would be considered as a part of this task, in consultation with City staff, at a highly conceptual level in order to gauge the level of interest in pursuing the option any further. If the City decided to pursue this option, the changes to other project tasks such as the design of the pump station, predictive pumping scheme, and additional of other site infrastructure would be negotiated as a change to this scope of work. Deliverable(s): • Two-page summary of the water quality and water conservation impact of a stormwater reuse system incorporated into the Weber Pond design, used to supplement irrigation for adjacent recreational fields, including considerations for treatment options. This summary report will be attached to, and summarized in, the BDR. • A range of planning level opinion of cost based on precedent projects. • One meeting with City staff to discuss the summary and cost estimate. Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 19 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx Assumptions: • We will conduct this task as soon as we get notice to proceed and will have the evaluation completed in 3 weeks. • The next steps in evaluating a potential stormwater reuse system would be negotiated as a separate scope of work if the City chooses to further the design. 3.6 Pump Station Design The “Bigger” flood risk reduction option includes a pump station near Weber Pond. The main purpose of the pump station is to draw Weber Pond down to the proposed new, lower normal water level after storm events. The secondary purpose of the pump station is to draw Weber Pond down further prior to large storm events with the use of predictive pumping, discussed in more detail in the following task. The pump station may operate continuously depending on the groundwater inflow to Weber Pond (see the task on groundwater flow analysis) and depending on potential permitting constraints. Up to this point, the refined flood risk reduction option has assumed the pump station design flow is about 10 cfs. The station will draw directly from Weber Pond and will discharge to a manhole structure to the north, near the city boundary with St. Louis Park. This existing structure will be modified or replaced to accept the forcemain pipes from the new pump station. The pump station will also include all of the necessary check valves, gates, and water level sensors to ensure proper operation. The pump station design will include an at-grade slab for access to the pumps. The design will also include the electrical box and backup power source (likely a diesel generator). Electrical boxes can be wrapped and/or landscaped for aesthetic purposes similar to other electrical boxes throughout the city. The design will not include a building at the surface. If there are particular elements that must be housed in a building (such as those associated with predictive pumping), one option may be to locate those elements in the park shelter with fiber optic lines run to the pump station for control. Subtasks will include: a. Analysis of the system flow-versus-head curve to aid in pump selection. b. Layout of the pump station, whether it is custom (cast in place) or more standard. c. Identifying electrical power source and the requirements to run the pump station. d. Coordination with structural and geotechnical teams to design the structures (pump station and discharge structure) and construction methods for slope stability and loads on walls. e. Developing a design report, drawings, specifications, and a cost estimate in support of bidding. f. Coordination with Xcel Energy for power supply early in the process, ideally before the 30% deliverable. Deliverable(s): • Mechanical, structural, and electrical drawings at 30%, 60%, and 100% design levels of the pump station, forcemains, discharge structure, electrical system, and backup power (to be included in the 30%, 60%, and 100% design package that will also include plans for other project design elements). Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 20 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx • A section of the BDR at 30% and 100% design documenting the basis of the design, design points for the pumps, and calculations to support the design. • Specifications for the mechanical, structural, and electrical aspects of the overall pump station at 100% design. • Engineer’s opinion of probable cost at 60% and 100% design. • An Operation and Maintenance Manual for the pump station and predictive pumping elements Assumptions: • The design flow rate is 10 cfs (+/- 50%). Final design for a flow rate outside of this range will require a change order to this scope of work. • The pump station should be able to draw the pond down to elevation 859 feet normally, and 856 feet prior to a large storm if predictive pumping is used. • The pump station will have multiple pumps (2 to 4), depending on the total flow and the expected groundwater flow into the pond. If more pumps are needed/requested, a change order to this scope of work will be required. • Submersible stormwater pumps will be used, rather than vertical turbine or other. • We assume that the 30% drawings and design report will be used for any permitting meetings or approvals that are needed. • The necessary power (voltage, amps, etc.) is nearby and can be run to the pump station. • Structural design will be needed for the pump station sump, valve vault, and the discharge structure. • Standard methods from the USACE will be followed for structural analysis and factors of safety. • We assume the drawing set will require about 10 sheets (+/- 2) to cover mechanical, pump station structure, electrical, and a detail sheet. • We assume that design changes will not be needed between 60% and 100%; only improvements of drawings, specifications, design report and cost estimate. • We assume internal bi-weekly meetings throughout the process. • We assume that preparation of the Operation and Maintenance Manual will begin after the 100% design deliverable, and will be provided prior to completing construction and testing of the pump station. 3.6.1 Predictive Pumping Capabilities The refined “Bigger” flood risk reduction option design includes predictive pumping capabilities (“Smart Infrastructure”) with the proposed pump station near Weber Pond (described in the previous task). The main purpose of the predictive pumping capabilities is to anticipate large inflows of water based on weather forecast data and draw the pond down in anticipation of large storm events to create additional stormwater storage capacity. This feature has considerable uncertainty associated with its implementation because it is relatively new technology in stormwater management (see Section 3.1 of the October 2020 Morningside Neighborhood Flood Infrastructure Project memo, regarding predictive pumping uncertainties). The Smart Infrastructure is expected to connect remotely to weather forecasts (whether that be local news reports, the National Weather Service in Chanhassen, SNODAS reporting snowpack, or other), use the algorithms developed to consider the current condition and expected inflows, and trigger the pump Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 21 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx station to run in advance of a storm. We anticipate building in feedback loops while the predictive pumping is occurring so that the pumps can adaptively respond to both changing weather forecasts and monitored water levels (including water levels downstream in Minneapolis). Subtasks will include: a. Model runs to develop an algorithm to determine an appropriate amount of pumping depending on the expected storm or snowmelt and inflow. b. Identifying system constraints, working with the cities of Edina and Minneapolis, and the Minnehaha Creek Watershed District. c. Identifying and coordinating with a supplier of predictive pumping equipment, such as OptiRTC. d. Design of a web-based dashboard for the city to have control over the system and, if desired, for residents to be able to log on and see if and why the system may be operating. Development of the dashboard would come during project construction, under a different phase and scope of work. Deliverable(s): • A predicted pumping algorithm, based on input from the cities of Edina and Minneapolis, and the Minnehaha Creek Watershed District, to control pumping decisions. This will be delivered as part of the 60% design deliverable, and ultimately included in the BDR at 100% design • Drawings at 30%, 60%, and 100% design levels of the Smart Infrastructure system. • A product list included in the cost estimate, including any necessary online subscriptions, for complete function of the predictive pumping system. This will be initially delivered at 30% design, and ultimately updated for 100% design. • Specifications for the Smart Infrastructure system at 100% design, including any necessary PLCs (Programmable Logic Controller), wiring, power, and additional valves or mechanical features. • A proposed web-based dashboard for control by the City. • Engineer’s opinion of probable cost at 60% and 100% design. • An Operations and Maintenance manual developed for operators. This task will not begin until the drawings are complete for bid (100% design deliverable), and will be prepared before construction and testing of the pump station is complete. Assumptions: • The Smart Infrastructure system will only control the pumps, and whether they are on or off. • Monitoring data will include the Weber Pond water level, and a downstream location in Minneapolis. • The Smart Infrastructure will reference snowpack data available, precipitation forecasts, and the continuous water level monitoring to make decisions about pumping according to the develop algorithm. • The Smart Infrastructure will only draw the ponds down the necessary amount (according to the algorithm), plus any additional factors of safety, in advance of a runoff event, and is not intended to simply draw the pond down completely any time a storm is predicted. • We assume that the 30% drawings and design report will be used for any permitting meetings or approvals that are needed. • The Smart Infrastructure will be able to run off of the power supplied to the pump station. Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 22 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx • Structural design will not be needed for the physical components of this predictive pumping system; any necessary requirements will be supplied by the supplier as structurally sound. • We assume the drawing set will require about 5 sheets (+/- 1) to cover details and the decision logic. • We assume internal bi-weekly meetings throughout the process. • We assume 3 meetings with stakeholders, and 6 meetings with the supplier. 3.7 Geotechnical Support The refined “Bigger” flood risk reduction option design includes a significant amount of grading in the Weber Park vicinity, at Weber Pond and the inundation area between Lynn and Kipling Avenues. For each of these features, geotechnical analysis is required to confirm slope stability and groundwater elevations. Two shallow borings are proposed in the proposed pond area for collection of samples for laboratory testing purposes and confirming stratigraphy across the footprint of the pond. This process will help inform final grading and temporary grading for deep excavations. Downstream of the inundation area between Lynn and Kipling Avenues will be a large box culvert. Borings currently available in the vicinity, although not on the direct route, indicate layers of organic soil. Two additional geotechnical borings are proposed to further investigate the soils directly below the alignments of the box culvert. A pump station will be needed near Weber Pond. Groundwater elevations, stratigraphy, and foundation design (bearing capacity and settlement) will require a geotechnical boring to a depth of approximately 840 feet (which is assumed to be at least two times the width of the pump station and extends approximately 10 feet past the bottom anticipated elevation of 850 feet). A fourth boring is proposed at a discharge structure location for stratigraphy and potential foundation design analysis. The geotechnical borings will provide samples for laboratory testing that can provide grain size analysis (for determining hydraulic conductivity) and strength information. Subtasks will include: a. Review of the existing soil boring data recently collected by Braun, and from historical documents. b. Coordination with Barr’s groundwater staff for continuity in data and assumptions. c. Subsurface investigation at a minimum of 6 locations (2 for Weber Pond stability, 2 for the box culvert, 1 at the pump station, and 1 at the discharge structure location) and associated laboratory testing. d. Geotechnical seepage and stability modeling of slopes for multiple conditions such as: long-term drained conditions, short-term construction conditions, rapid drawdown (if applicable), and a worst- case scenario assumed when there is high groundwater conditions and low pond elevation. e. Support for structural analysis in determining settlement and allowable loads on the walls of the pump station and the discharge structure. f. Evaluating the potential for differential settlement along the box culvert and providing potential support solutions if organic/soft soils are encountered (which is anticipated). Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 23 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx Deliverable(s): • A geotechnical report summarizing the subsurface investigation, laboratory testing results, soil parameters, seepage and stability modeling results, and a summary of the information necessary for design of the project elements. The report will be delivered as draft at 30% design and as final at 60% design. The report will be attached to, and summarized in, the BDR. Assumptions: • There are no accuracy/quality issues with the borings and water level data recently collected by Braun. • Soil data available in the boring logs performed by Braun are suitable for evaluating subsurface stratigraphy changes around Weber Pond. Stability models will be developed based on data from Braun in addition to the minimum of two proposed borings in the Weber Pond area which will to used to develop soil parameters. • Based on available logs, it is assumed that the site is mostly organic soils and peat overlying native lacustrine clay and sand. • Based on existing vibrating wire piezometers installed by Braun at Weber Park, the groundwater elevation ranges from 2 to 7 feet below ground surface. • The current data loggers installed to the vibrating wire piezometers on site should continue to be read and are assumed to provide the adequate groundwater elevations for slope design. We assume that the City can provide this data as requested. • The proposed swale through Weber Park is assumed to have mild enough side slopes (for walking up and down the slopes, such as 8H:1V or flatter) that no geotechnical analysis will be required; if the slopes are steeper, then an analysis will be recommended and a change order to this scope of work will be required. 3.8 Structural Support Structural design may be required for the pump station depending on the size and complexity of the pump station. At this point, we assume the pump station will include a cast-in-place concrete subgrade vault that tops out at grade. This scope and budget include potential structural modifications to the existing storm system where the pump station outlets. A single drawing is assumed for this work. Deliverable(s): • Drawings at 30%, 60%, and 100% design levels will include: o Structural notes and isometrics o Pump station – foundation and top of slab plans o Pump station – sections and details o Outlet to existing storm sewer – plan, sections, and details • Specifications at 100% design • Basis of Design report section updates at 30%, and 100% design levels • Engineer’s opinion of probable cost at 60% and 100% design Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 24 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx Assumptions: • This is an unoccupied (Class U) structure and thus a code review and architect are not required • The structure foundation will be a bearing foundation system at the base of the vault and will not require piles • No construction support, record drawings, or any other scope following the 100% submittal is included 3.9 Groundwater Support The “Bigger” flood risk reduction option includes altering (lowering) the normal level of Weber Pond and lowering the water level of the inundation area between Lynn and Kipling Avenues. This change has the potential to draw in groundwater as either a new inflow to these water bodies or increasing the inflow rate. Improving our understanding of the potential for groundwater inflow is important for understanding the pond inflows to properly size the pump station and manage stormwater. Additionally, understanding the current groundwater inflows will help all project stakeholders understand the current baseflow in the storm sewer system to and through Minneapolis to Bde Maka Ska. This aspect will be important to understand how the baseflow may increase as a result of the project, and further, what impacts may exist as a result (see the H&H modeling scope in Section 3.10). Subtasks will include: a. Review of the recent borings and groundwater level monitoring data collected by Braun, and review of historic borings provided by City to understand soils and water levels. b. Installing three additional groundwater monitoring wells around the area for continuous monitoring through the 2021 summer season. These wells will be located in areas to best assess potential groundwater inflow into water bodies and potentially be incorporated into a long-term monitoring network and included as part of a predictive pumping system. c. In-situ hydraulic conductivity testing at the monitoring wells such as with a slug test. d. Groundwater modeling of the project to specifically understand and summarize inflows to Weber Pond and the inundation area between Lynn and Kipling Avenues. e. Estimate how groundwater levels around Weber Pond and Park may rise and fall as a result of the pumping operations. This subtask will be for the purpose of supporting both structural assessments of the new pump station and potentially basements near the pond, and the geotechnical stability support task. f. Advice and bid support for temporary construction dewatering for expanding and lowering Weber Pond, and to install subsurface features. Deliverable(s): • A technical memo describing the data collected, the modeling performed, and a summary of the potential inflows to the water bodies. The technical memo will be delivered as draft at 30% design and as final at 60% design. This technical memo will be attached to, and summarized in, the BDR. • Three new monitoring wells in the area for continual monitoring, potentially into the future beyond construction. The wells may aid in the predictive pumping capabilities. Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 25 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx Assumptions: • There are no issues with the borings and water level data recently collected by Braun. • Vibrating wire piezometers installed by Braun are still active and accessible for readings. • Soil data available is suitable for developing a model. • Other regional wells may be used to inform water levels. • We assume internal bi-weekly meetings throughout the process. • Well installation will be completed by a Minnesota licensed well driller. Costs are based on similar projects; a well driller has yet to be engaged for this work. • The City will assist with providing access to City property or right-of-way for well installation. • Water level monitoring equipment will be manually downloaded on a monthly basis by Barr staff. Groundwater seepage into water bodies will be managed through pumping. • Sealing of wells, if not incorporated into a future monitoring network, will be completed as part of a separate scope of work. 3.10 Hydrologic and Hydraulic Modeling Support The “Bigger” flood risk reduction option has been developed over multiple years through efforts to balance flood risk reduction and cost. We expect that during detailed design, changes to the design will arise due to utility conflicts, improved information related to slope stability and foundations and groundwater flow, and changes with new site survey data. Changes in the design will be vetted with the hydraulic model that has been used for this design process. A second significant task for hydrologic and hydraulic modeling is estimating and summarizing flood level and flow rate (discharge) impacts downstream. This is an important task needed for permitting and for discussions with stakeholders such as the public, the DNR, the Minnehaha Creek Watershed District, and the City of Minneapolis. This task will include modeling of the entire system, from upstream in St. Louis Park, through Edina, and down to Bde Maka Ska where Minneapolis has established a boundary condition (high water level of Bde Maka Ska). Water level impacts will be assessed throughout the model domain by performing a sensitivity analysis using a given a range of downstream water levels in Bde Maka Ska to understand how much the impacts and benefits are dependent on the downstream water levels. The water level and flow rate modeling results will be summarized in a memo. The current assumption based on modeling to-date is that this project will provide an overall benefit to Edina and Minneapolis (within Minnehaha Creek Watershed District) and is not causing undue impacts. Subtasks will include: a. Supporting City engineering staff as the City develops street reconstruction drawings related to the pipe capacity increases along and south of W 42nd Street, disconnection of pipes near W 42nd and Scott Terrace, and additional pipes from the inundation area between Lynn and Kipling Avenues. This will include modeling of various pipe sizes if utility conflicts arise, or there is difficulty achieving minimum pipe cover. b. Grading work in Civil 3D to represent the project elements so that the two-dimensional surface used in the modeling is accurate and not represented by simple geometric shapes as it has been up to this point. Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 26 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx c. Modeling of the design at 30%, 60%, and 100% to update project benefit estimates based on the updated design. d. Understanding and summarizing downstream impacts and benefits. Impacts may be associated with the predictive pumping or long-term pumping after a storm, and benefits are expected due to (and not limited to) the additional storage in Edina and prevention of flow over France Avenue. Deliverable(s): • Answering questions from City staff (assistant City engineer and team) as needed via emails or phone calls. • Estimates of the project benefits at 30%, 60%, and 100% design and delivered to the City via email to continue to update the understanding of the Project benefits. • Technical memo documenting the impacts and benefits downstream at 30% and 100% designs, with the 30% deliverable intended to be used for permitting discussions. This will cover the “no rise” memo that the City of Edina will keep in its files to document the impacts and benefits of the project. This technical memo will be attached to, and summarized in, the BDR. Assumptions: • There will be utility conflicts requiring different pipe sizes in some of portions of the project. Iterations for pipe sizes and associated benefits will be required to rebalance project tradeoffs and opportunities. • Related to the planned 2022 and 2023 street reconstruction, we assume that the assistant City engineer and their team will review potential utility conflicts in May 2021 so that modeling iterations can be performed and the design updated accordingly for inclusion in the 30% design. • We assume two meetings with City staff prior to 30% design to discuss utility conflicts and potential solutions. • We assume one meeting with City staff after 30% design to discuss additional conflicts that may arise and potential solutions. • We assume that the impacts downstream are minimal and are outweighed by the benefits such that conversations with the City of Minneapolis and the Minnehaha Creek Watershed District do not require design changes. • We assume that the City will pursue a Letter of Map Revision (LOMR) from the Federal Emergency Management Agency (FEMA) (to be submitted as a limited detail LOMR) after design is finalized. The LOMR effort will be performed under a separate scope of work. However, LOMR preparatory work including coordination meetings with the MnDNR and FEMA (as needed) and a review of LOMR submittal data requirements are included in this scope to help facilitate the preparation of the LOMR application. 3.11 Quality Control Plan Barr will establish review and checking procedures for deliverables by developing a Quality Control Plan for the project. The Quality Assurance/Quality Control (QA/QC) measures will generally include review of all technical work by internal independent QA/QC reviewers. Quality control includes quality control checks of data, computations, drawings, report text, design verification and validation, materials received, and deliverables. Project quality control will generally be accomplished via three levels of review: peer review (conducted by Barr’s technical staff), task lead review (typically conducted Barr’s task leads or Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 27 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx someone designated by them), and QA/QC review team review (conducted by Barr’s Senior Reviewer assigned to the relevant task - the purpose of this review will be primarily to offer "big picture" advice). 3.12 Project Management Project management and coordination with both internal staff, City staff, and other stakeholders (regulatory agencies, City of Minneapolis, etc.) will be critical to keep the project on schedule and within scope and budget. The following sections describe our project management approach and assumptions. We’ve also included grant funding identification within our project management scope. 3.12.1 Grant Funding Identification Barr maintains a grant opportunity database that is updated on a monthly basis. Barr will monitor this database to identify grant funding opportunities that may be applicable to the Project. Barr will review potentially applicable funding opportunities with the City and will assist the City in pursuing up to two grant opportunities for the project. Due to the uncertainty of which opportunities the City may choose to pursue and the level of effort that may be needed to support the application(s), Barr has included an allowance of $10,000 to assist with grant funding efforts. Deliverable(s): • Correspondence to City documenting potential grant funding opportunities. • Assistance preparing up to two grant application submittals. Assumptions: • City will lead all grant funding applications with Barr providing support at City’s direction. • City may choose to pursue up to two grant funding opportunities that are applicable to the project. • Barr assumes no responsibility in contributing towards cost sharing or matches as may be required by certain grant or funding opportunities. 3.12.2 Project Coordination Barr will participate in bi-weekly, 0.5-hour long project coordination meetings with City staff. The purpose of these meetings is to update the City on project status, ask questions, and receive feedback as design progresses. Up to five Barr staff will attend project coordination meetings (as needed), and staff attendance may vary by week depending on design elements. We will adjust the meeting frequency as needed as the project progresses. Bi-weekly coordination meetings will also be held with Barr’s internal project team to monitor progress, refine design elements, and to facilitate cross-discipline coordination. Barr anticipates design review meetings with the City prior to and following 30%, 60%, and 100% design submittals. The purpose of these meetings is to seek City’s feedback on the design at each interval and receive comments that will be incorporated into subsequent design iterations. Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 28 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx Deliverable(s): • Attendance at bi-weekly coordination meetings with City staff. • Email documenting bi-weekly coordination including meeting notes, action items, schedule, and budget status circulated to attendees following each meeting. • Attendance and facilitation of design review meetings with City staff. Assumptions: • Bi-weekly meetings will be held for the entirety of the project (assumed to be approximately 15 months which accounts for any potential project delays and/or project closeout) • All coordination meetings will be held virtually. • Coordination with subcontractors is accounted for in the costs for tasks described earlier in Section 3.0. 3.12.3 Project Administration Barr will implement project monitoring and control activities necessary to achieve desired quality, scope, schedule, and budget outcomes. Barr will maintain accurate and complete project records and will facilitate project invoicing in the City’s preferred format. Project administration tasks will be maintained for the duration of the project. Deliverable(s): • Invoices. Assumptions: • Duration of the project is approximately 15 months (accounts for any potential project delays and/or project closeout) Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 29 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx 4.0 Project Team The following is a list of key individuals who will be supported by additional staff, as needed, to complete each task. Sarah Stratton, CFM, Vice President, Senior Water Resources Scientist Sarah will serve as Barr’s principal-in-charge for the project and will provide senior level QAQC and project coordination. Sarah will also lead any necessary floodplain regulation work. Shanna Braun, Senior Environmental Scientist Shanna will serve as Barr’s project manager for the project and as the permitting lead. Cory Anderson, PE, Senior Water Resources Engineer Cory will serve as Barr’s overall technical lead and the pump station design lead. Kurt Leuthold, PE, LEED AP, Vice President, Senior Civil Engineer Kurt will serve as a technical advisor for the project and will provide senior level QAQC. Fred Rozumalski, PLA, Senior Landscape Architect and Ecologist Fred will serve as Barr’s landscape design and habitat restoration lead. Erin Anderson Wenz, ENV SP, PE, Vice President, Senior Water Resources Engineer Erin will serve as Barr’s stormwater reuse evaluation (for irrigation) lead. Michelle Kimble, PE, Senior Civil Engineer Michelle will serve as Barr’s Civil Design lead. BJ Siljenberg, PE, Senior Structural Engineer BJ will serve as Barr’s structural design lead. Kristin Alstadt, PE, Senior Geotechnical Engineer Kristin will serve as Barr’s geotechnical lead. Evan Christianson, PG, Senior Hydrogeologist Evan will serve as Barr’s groundwater lead. Mark Ziemer, Senior Electrical Engineer Mark will serve as Barr’s electrical design lead. Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 30 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx 5.0 Project Cost Estimate The total cost for the estimated scope of work described above is $1,204,000. The table below summarizes the cost and estimated completion date for each task. Our cost estimate assumes the project will be completed based on the assumptions listed in Section 3.0 above and within the schedule outlined in Section 6.0. Task Estimated Barr Labor Hours1 Estimated Expenses / Subcontractor Fees Estimated Total Cost1 Project Initiation (Section 3.1) 15 n/a $2,500 Permitting (Section 3.2) 630 $5,500 (wetland delineation field work; sediment sampling field work & lab fees) $83,400 Landscape Design and Ecological Restoration (Section 3.3) 1,760 $1,500 (tree survey field work; signage) $219,500 Civil Site Design (Section 3.4) 1,870 $65,000 (subcontracted site survey) $325,300 Evaluation of Stormwater Reuse for Irrigation (Section 3.5) 70 n/a $11,000 Pump Station Design, including Predictive Pumping Capabilities (Section 3.6) 1,510 n/a $231,000 Geotechnical Support (Section 3.7) 210 $15,000 (subsurface investigation & lab testing) $43,300 Structural Support (Section 3.8) 390 n/a $51,800 Groundwater Support (Section 3.9) 280 $15,000 (new wells & monitoring equipment) $54,100 Hydrologic and Hydraulic Modeling Support (Section 3.10) 340 n/a $49,900 Quality Control Plan (3.11) time and budget for quality control is included with each separate task listed above Project Management (Section 3.12) (including grant funding identification) 775 n/a $132,000 Project Total: 7,850 $102,000 $1,204,000 1Based on project assumptions detailed in Section 3.0, Project Scope of Work Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 31 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx 6.0 Project Schedule The following schedule assume the project will be completed based on the assumptions listed in Section 3.0 above and within 15 months (accounting for any potential project delays and/or project closeout). Estimated completion dates assume that we will have notice to proceed by April 23, 2021. Please note that the estimated completion dates listed below are tentative and will be reevaluated in coordination with City staff as the project progresses. Major Project Milestone Major Deliverables Estimated Completion Date1,2 Notice to Proceed Signed work order. April 23, 2021 Projection Initiation / Project Kickoff Meeting List of data gaps and information needs. Meeting notes and a Client Service Plan. Early May 2021 Evaluation of Stormwater Reuse for Irrigation Summary memo. Mid May 2021 Tree Survey and Ecological Assessment Figures and graphical summary in the BDR. Late May 2021 Site Survey Completed and Data Received by Barr AutoCAD and Civil3D files of all survey information. Late May 2021 Field Wetland Delineation and Report Report submitted to Technical Evaluation Panel. Late May / Early June 2021 Geotechnical Borings Complete Boring data. Late May / Early June 2021 30% Design Update Meeting with City Staff Meeting notes. July 2021 30% Design Package Basis of Design Report. Stormwater reuse evaluation included in the Basis of Design Report. Weber Pond liner evaluation. Geotechnical report. Park conceptual plan. Drawings/Plan Set. Cost estimate. Summary of Project benefits. July 2021 Coordination with City Engineering Staff Related to 2022 and 2023 Street Reconstruction Early coordination with City staff to review site survey data related to street reconstruction to identify any design concerns. July 2021 30% Design Review Meeting with City Staff Documented redlines / feedback from City staff. August 2021 Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 32 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx Major Project Milestone Major Deliverables Estimated Completion Date1,2 Public meeting related to Weber Park, Weber Woods, and Lynn/Kipling Inundation area conceptual design Graphics and temporary signage for display at the park. Notes from the public meeting with formal decisions memorialized. August 2021 City Council work session related to Weber Park, Weber Woods, and Lynn/Kipling Inundation area conceptual design Notes from the City Council work session with formal decisions memorialized. October 19, 2021 Coordination with City Engineering Staff Related to 2022 and 2023 Street Reconstruction Correspondence with City staff to coordinate project needs and City drawings. November 2021 60% Design Update Meeting with City Staff Meeting notes. November 2021 60% Design Drawings/Plan Set. Groundwater technical memo. Cost estimate. Landscape/Park phasing plan. Summary of Project benefits. November 2021 60% Design Review Meeting with City Staff Documented redlines / feedback from City staff. December 2021 Agency Update Meeting Related to Permitting Meeting notes. Mid December 2021 Permitting (Application Development, City Review, and Submittal) City review comments. Permit application package. Early January 2022 100% Design Update Meeting with City Staff Meeting notes. Mid February 2022 100% Design (plans and specifications) Basis of Design Report Drawings/Plan Set issued for bid. Specifications for bid and bid form. Cost estimate. Park maintenance plan. Summary of Project benefits. March 2022 100% Design Review Meeting with City Staff Documented redlines / feedback from City staff. Late March / Early April 2022 Bidding Support3 Advice and bid support for construction dewatering. March 2022 100% Design Complete Final design package. Early April 2022 Mr. Chad Millner, Mr. Ross Bintner, and Ms. Jessica Wilson Page 33 W:\Business Units\WR\Proposals\2021\P039.21 City of Edina Morningside Flood Infrastructu\Final Files\Morningside_Flood_Infrastructure_Scope_of_Work_04132021.docx Major Project Milestone Major Deliverables Estimated Completion Date1,2 Agency Update Meeting Related to Permitting (if needed) Meeting notes. April 2022 Permits Issued n/a Late May 2022 1 Based on project assumptions detailed in Section 3.0, Project Scope of Work 2 Our schedule is aggressive and assumes quick turn-around from City staff related to deliverable reviews. 3 The scope of work ends at “bid support” (i.e., does not include construction support and construction observation). We propose to complete this work on a time and expense basis and will begin work as soon as the City provides notice to proceed. Barr will complete the proposed scope of work in accordance with the Master Agreement for Professional Engineering Services. We appreciate the opportunity to continue providing engineering services to the City of Edina and look forward to working with you on this project. If the proposed scope of services is satisfactory, please sign a copy of this letter in the space provided and return it to us. If you have any questions about the scope of services, please contact Sarah Stratton (Principal-in-Charge) at 952-832-2860 (sstratton@barr.com) or Shanna Braun (Project Manager) at 952-842-3619 (sbraun@barr.com). Sincerely yours, BARR ENGINEERING CO. Sarah Stratton Its Vice President Accepted this ____________ day of ___________________, 2021 City of Edina By Morningside Flood Infrastructure Project City Council Meeting April 20, 2021 Ross Bintner –Engineering Services Manager 1.Context 2.Public Engagement 3.Infrastructure Strategy 4.Recommendation 5.Discussion and Next Steps EdinaMN.gov 2 Outline Staff & Consultants •Ross Bintner –Engineering Services Manager •Jessica Wilson –Water Resources Coordinator •Sarah Stratton –Senior Water Resources Scientist, Barr Engineering •Cory Anderson –Water Resources Engineer, Barr Engineering EdinaMN.gov 3 Context •2018: Comprehensive Water Resources Management Plan •Spring 2020: Flood Risk Reduction Strategy Approval •2020-21: Morningside Flood Infrastructure Preliminary Engineering and engagement •2021-22: Design, Bid •2022: Build •2022: Phase 1 construction Morningside (Areas D&E) 2023: Phase 2 Construction Morningside (Area C) Project engagement and preliminary design are well aligned with Flood Risk Reduction Strategy How we work with the community to comprehensively reduce flood risk: •INFRASTRUCTURE: We renew our infrastructure and operate it to reduce risk. We plan public streets and parks to hold and move flood waters to reduce the disruption of city services. •OUTREACH & ENGAGEMENT: We make flood information available to the public and give residents tools for flood resilience to help reduce their risk. EdinaMN.gov 4 Context - Flood Risk Reduction Strategy EdinaMN.gov 5 Project engagement was conducted in alignment with Council goals Better Together: Conduct clear and meaningful community engagement where: 1.The decision to be made and decision-making process is clearly defined, 2.Individuals understand how and when they can participate, 3.The City communicates what feedback is used and why, 4.Inclusive engagement methods provide a variety of ways for the public to participate in the decision-making process and ensure all voices are heard. EdinaMN.gov 6 Strategic Alignment - Council Engagement Strategy Include as design goals; •No increase in risk to any individual property •Balance flood risks and benefit of the project •No private property will be proposed for acquisition •Avoid floodwalls Include as design consideration; •Future climate change •Limit impact at Weber Park Take advantage of opportunity; •Enhance natural areas where impacts occur •Consider park improvements where impacts occur •Remove or reduce potential for flood overflow into private property through minor changes in grade •Add inlets in low areas to fully utilize pipe Detailed conversations also led the design team to; •Consider backflow and overflow on Grimes Avenue •Improve system map and model accuracy in 41st street right-of-way •Consider overflow on Crocker Avenue EdinaMN.gov 7 Engagement –How input was used Project preliminary design is well aligned with Council goals Strong Foundation: 1.Incorporate financial, societal, and environmental costs into decision-making processes. 2.Incorporate lifecycle and maintenance costs and climate adaptation design practices to allow more informed decision making. 3.Provide funding to maintain and replace City facilities, assets and equipment in a manner that avoids deferred maintenance, prevents emergency repair and replaces assets at the most cost effective time. 4.Design and build for resiliency in the infrastructure that reduces flooded structures, improves water quality EdinaMN.gov 8 Strategic Alignment - Council Infrastructure Strategy Section 5 in Staff Report •~$10M Capital Cost (middle or “bigger” option) Safely Store Water •Expanded and lowered Weber Pond (1) •Expanded and lower Lynn/Kipling inundation area (4) Safely Move Water •Expanded pipe and swale outlet (2,3) •Upstream pipe, grade changes (9,9a,10)9 Recommendation Impacts and Opportunities •Limit Impact in Weber Park •Pond area +240% •Flood storage +600% •Storage is foundational •Restore and enhance natural resources •Park trail connections so people can loop through natural areas on their walks EdinaMN.gov 10 Park EdinaMN.gov 11 Park Impacts and Opportunities •~9.5 Acre “Woods” property •~3.3 acre upland forest, no impact, improve natural resources •~6.2 acre flood forest, tree removal •~4 acre pond, •~2 acre natural restoration pond edge) •~3.76 Acre “pond” property •2.9 Acres pond •0.86 acres pond slopes, treed edge •0.1 Acres pond on “park” property EdinaMN.gov 12 Lynn/Kipling Impacts and Opportunities •~3.2 Acre “Temporary Inundation” property •Save 2 groves of trees •Grading and excavation to lower land and water elevation •Natural resource restoration EdinaMN.gov 13 Existing (North) EdinaMN.gov 14 $10M (North) EdinaMN.gov 15 Existing (Middle) EdinaMN.gov 16 $10M (Middle) EdinaMN.gov 17 Existing (South) EdinaMN.gov 18 $10M (South) EdinaMN.gov 19 Discussion & Next Steps Affirm strategy, design goals, considerations and opportunities •Infrastructure consistent with “bigger option” •Strategy; Risk transfer with pipe, and mitigation and additional flood reduction with storage •Design goals, consideration and opportunities detailed in memo. •Significant tree removal in both Weber Woods and Lynn/Kipling inundation area to lower water bodies •Natural resource restoration in both areas •Further lowering of weber pond elevation with predictive pumping EdinaMN.gov 20 Discussion & Next Steps •Provide project funding to include estimated design professional services costs in 2021 of $1.4M, construction professional services in 2022 of $0.5M, capital expenses of $9.5M in 2022, and $0.5M in 2023, totaling $10M in capital and $2M in professional services. •Authorize City Manager to sign professional service scope of service with Barr Engineering for Morningside Flood Infrastructure Project for a cost not to exceed $1.204M •Approve public participation plan to inform the public and project about park landscape aesthetics choices. EdinaMN.gov 21 Criteria / Staff Report Scale / Balance •Neighborhood scale –Adding to 100 acre-feet and 1000 cubic feet per second •Balance recipe 2 parts storage in ponds, 1 part moving water with pipes Date: April 20, 2021 Agenda Item #: VIII.F. To:Mayor and City Council Item Type: Other From:Cary Teague, Community Development Director Item Activity: Subject:Sketch Plan Review for 4630 France Avenue Discussion CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: No action requested. INTRODUCTION: Provide non-binding feedback on a potential future development application. ATTACHMENTS: Description Planning Commission Staff Memo - April 14, 2021 Proposed Plans Property location, aerial, street view and zoning City of Edina • 4801 W. 50th St. • Edina, MN 55424 City Hall • Phone 952-927-8861 Fax 952-826-0389 • www.CityofEdina.com Date: April 14, 2021 To: Planning Commission From: Cary Teague, Community Development Director Re: Sketch Plan Review – 4630 France Avenue The Planning Commission is asked to consider a sketch plan proposal to tear down the existing single-family home and build two villa type homes at 4630 France Avenue. The property to the north contains a 4-unit townhome development zoned PRD-2, Planned Residential Development - 2. The property to the south is a single-family home zoned R-1, Single Dwelling Unit District. Further south are duplexes zoned R-2, Double Dwelling Unit District. (See attached zoning map.) To accommodate the request the following is required: A Rezoning from R-1, Single-Dwelling Unit District to PRD-2 Planned Residential District 2 with setback variances. As with all sketch plan reviews; the Planning Commission is asked to provide non-binding comments and direction on a potential future development request. Areas of focus should be on the proposed land use, setbacks and how this proposal fits in to the surrounding area. City of Edina • 4801 W. 50th St. • Edina, MN 55424 The following table demonstrates compliance with PRD-2 Zoning: COMPLIANCE TABLE City Standard (PRD-2) Proposed Structure Setbacks Front – France Avenue Side – North Side – South Rear – West 30 feet 20 feet 20 feet 35 feet 40 feet 7 feet* 20 feet 25 feet* Height 2-1/2 stories and 30 feet 2-1/2 stories and 30 feet Density Lot area per unit - 7,300 s.f. 5,016 s.f.* Building Coverage 25% 19% *Variance Required Issues/considerations: Density. The residential density proposed (lot area of 5,016 square feet per lot) is similar to the PRD- 2 development to the north. The four lots to the north are 5,121 square feet per lot. Setbacks. Staff finds the setbacks to be reasonable. The side setback would be similar to the existing single-family home on the site. The two structures to the north are set 10 feet back from the lot line. Staff would recommend the development shift 10 feet to the east to meet the required rear yard setback to be further away from the single-family homes. The front yard setback to France Avenue would still be met. Zoning. The proposed rezoning to PRD-2 would accommodate the same use as the development to the north that is zoned PRD-2 and contains 4 units similar in size to the proposal. The proposal would fit the character of the area given the development to the north and the duplexes to the south. 1 4630 France Avenue .Edina, Minnesota Redevelopment Study March 23, 2021 By Simply Homes 2 4630 France Avenue .Edina, Minnesota Redevelopment Study March 23, 2021 By Simply Homes 4630 France Avenue Edina, Minnesota by Simply Homes The new development would propose the construction of two (2) villa type homes to be built on the 4630 France Avenue lot/parcel. The existing home on site is vacant, listed as a teardown and been on the market for many months. In this specific setting, we believe there is a market for smaller single family detached homes as a viable option to a town home setting or condominium. There are several townhome developments nearby this location (one directly north and adjacent this site). The specifics of the new homes include the following: •Approximately 2,400 SF of living space (each unit) •2 car garage •3 Bedroom, 4 Bath including Recreation Room (or 4th Bedroom) and Home Office •2 ½ story construction (slab on grade), ground level floor depressed (verify grading) to reduce overall height •Architectural style would be urban cottage •Exterior materials to include (several study options and combinations): Board and batten siding, vertical siding in combination with stained (or painted) wood siding and shingle or metal roofs. Planning variances and rezoning request would include the following: •Re-zoning to enable 2 units on this lot/parcel •Proposed Rear Yard Setback reduced to 20’ –0” versus 25’ –0” required •Assumes Side Yard Setbacks of 7’-0” (verify requirement) •Assume 35’ –0” Front Yard Setback (verify requirement) •Lot Coverage: Proposed building and hardscape at 33% of lot area, not including reduction for pervious paving (verify requirement) •All dimensions and areas to be verified with formal survey France AvenueDriveway 35’ Front Yard Setback20’ Rear Yard Setback 7’ Side Yard Setback7’ Side Yard SetbackLine of Floor Level Above Villa Home 1 Villa Home 2 4630 France Avenue Edina, Minnesota Lot Size = 10,032 SF (.23 acres) Ground Level Structure Footprint = 936 SF Driveway = 2,410 SF Developed Footprint = 3,346 SF (approximate) or 33% 2 ½ Story Homes (Approx. 2,400 SF each) 42’ Offset N G 1 2 10’ –0”10’ –0” G 1 2 10’ –0”10’ –0” G 1 2 10’ –0”10’ –0” G 1 2 10’ –0”10’ –0” 20’ –0”56’ –0”42’ –0”Rear Yard Setback LineProperty Line Line 20’ –0”56’ –0”42’ –0”Rear Yard Setback LineProperty Line Line 20’ –0”56’ –0”42’ –0”Rear Yard Setback LineProperty Line Line 20’ –0”56’ –0”42’ –0”Rear Yard Setback LineProperty Line Line 20’ –0”56’ –0”42’ –0”Rear Yard Setback LineProperty Line Line 20’ –0”56’ –0”42’ –0”Rear Yard Setback LineProperty Line Line Precedent Images (Home in Minnetonka) Precedent Images (Home in Linden Hills) Precedent Images (Home in Linden Hills) Edina, Hennepin, MetroGIS | © WSB & Associates 2013, Hennepin County,Edina, © WSB & Associates 2013 Site Location Legend Addresses April 9, 2021 1 in = 94 ft / 209 NE923.49119 OD Page 1 of 4 DataLin.kjEdina A 607 4608 Q C....2, . \ ...._------ 4611 44,7 /,,,,,e,„ , , , Aff, „ 37 31 or / .4:'ef 1117'e, 1 461 5 s 4613 14 '3 4615 0 30 644617 4 dr. 1 1 9 171,' 4617 39.4 CO 4634 *VW j... . Vir % `••••• ,,' VS", NV 0 * 4 to4 ** % % 4! . 0, :o. 4 0.4% 0 , . or, /4 4e, 410 4 . V .% AV* 01 M k *V r * P4111"WIVp,&NIV AAft,.• eNkovoA sa A4Xta . f ;: g..:t " # IP' * 1. # 4,04 ,:e * kso . 4 0 Vs. A 7* V 4.0tAtfipe41 ,4' A.# ieN *44 AN 414 LiP*. ** 1.40 401$ 44* k I Ott ..4.4. 10/6141% La AL a fp., _ A it Ng, ir- 0140 S "V• N. A,4"1" S • i 4** SotS :****•:, 41%2« *. .° 4 Nk4V440.114 o ON \ . :4 Oi §, , OA A. 51 i It. T.4.4 to. %444r..40144Y. . ..+1) 401' 3900 https://gis.edinamn.gov/DataLink/Defaultaspx 4/8/2021 DataLinklEdina Page 2 of 3 R-2 - Double Dwelling Unit • PRD-1 - Planned Residence PRD-2 - Planned Residence PRD-3 - Planned Residence PRD-4 - Planned Residence iii PRD-5 - Planned Residence PCD-1 - Planned Commercial 1 PCD-2 - Planned Commercial PCD-3 - Planned Commercial PCD-4 - Planned Commercial POD-1 - Planned Office POD-2 - Planned Office RMD - Regional Medical PID - Planned Industrial • PUD - Planned Unit Development APD - Automotive Parking • PSR-4 - Planned Residence MDD-4 - Mixed Development • MDD-5 - Mixed Development MDD-6 - Mixed Development https://gis.edinamn.gov/DataLinIdDefault.aspx 4/8/2021 4630 France Ave S - Google Maps Page 1 of 2 c2 Maps 4630 France Ave S Image capture: May 2019 © 2021 Google Minneapolis, Minnesota Google Street View https://www.google.com/maps/place/4630+France+Ave+S,+Minneapolis,+MN+55410/@44.9187334,-93.329088,3a,75y,269.24... 4/8/2021 4624 France Ave S - Google Maps Page 1 of 2 Go gle Maps 4624 France Ave S Image capture: May 2019 © 2021 Google Minneapolis, Minnesota Google Street View https://www.google.com/maps/place/4630+France+Ave+S,+Minneapolis,+MN+55410/@44.9188226,-93.3290898,3a,75y,269.2... 4/8/2021 Date: April 20, 2021 Agenda Item #: VIII.G. To:Mayor and City Council Item Type: Other From:Cary Teague, Community Development Director Item Activity: Subject:Sketch Plan Review for 5146 Eden Avenue (former Public Works Site) Discussion CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: No action requested. INTRODUCTION: Provide the applicant non-binding input on a potential future development proposal. Areas of focus on the discussion should be on the proposed land uses, proposed height, setbacks (especially along Eden Avenue) and the Grandview Development Framework. T he applicant has responded to the Grandview District’s 7 Guiding Principles within their narrative. (See attached plans and narrative.) ATTACHMENTS: Description Planning Commission Staff Memo - April 14, 2021 Applicant Narrative Proposed Plans Grandview Development Framework Grandview Transportation Plan City of Edina • 4801 W. 50th St. • Edina, MN 55424 City Hall • Phone 952-927-8861 Fax 952-826-0389 • www.CityofEdina.com Date: April 14, 2021 To: Planning Commission From: Cary Teague, Community Development Director Re: Sketch Plan Review – 5146 Eden Avenue (Former Public Works Site) The Planning Commission is asked to consider a sketch plan proposal to re-develop the 3.3-acre vacant site at 5146 Eden Avenue. This is the old Public Works site. As proposed, at full build out, the site would include: A 5-1/2-story, 90-unit senior cooperative project (owner occupied) with underground parking. (Applewood Pointe Cooperative) Ten percent (10%) of the units would be for affordable housing. A 3-story, 40,000 square foot medical office building with two levels of structured parking under and behind the building. Though needed for the development, the applicant has indicated the potential to provide some of the parking as available for district parking as recommended in the Grandview Development Framework. A pedestrian walkway and bridge to connect the Jerry’s parking ramp. This connection was recommended in the Grandview Development Framework. (See attached pages from the development framework.) A 10,500 square foot public plaza. To accommodate the request the following is required: A Rezoning from PID, Planned Industrial District to PUD, Planned Unit Development. Flexibility would be requested through the PUD Ordinance to vary from setback, building height, and floor area ratio (FAR) requirements. The PUD Zoning is also used to ensure the affordable housing on the site. As with all sketch plan reviews; the Planning Commission is asked to provide non-binding comments and direction on a potential future development request. City of Edina • 4801 W. 50th St. • Edina, MN 55424 Areas of focus for the Planning Commission discussion should be on the proposed land uses, proposed height, setbacks (especially along Eden Avenue), and the Grandview Development Framework. The applicant has responded to the Grandview District’s 7 Guiding Principles within their narrative. (See attached plans and narrative.) While the applicant is proposing to rezone the site to PUD, the following table demonstrates compliance with the underlying zoning: COMPLIANCE TABLE City Standard (PID) Proposed Building Setbacks -Residential Front – Eden Avenue Front - Arcadia Avenue Side – West Rear – North Building Setbacks -Office Front – Eden Avenue Front - Arcadia Avenue Side – West Rear – North 60 feet (based on height) 60 feet (based on height) 71 feet (based on height) 60-71 feet (based on height) 42 feet (based on height) 42 feet (based on height) 42 feet (based on height) 42 feet (based on height) 100+ feet 10 feet* (22’ to the curb) 10 feet* 72 and 100 feet 5 feet*(17’ to future curb) 5 feet*(20’ to future curb) 70 feet 100+ feet Building Height – Residential Building Height – Office Four Stories and 48 feet Four Stories and 48 feet Five-1/2 stories and 71 feet* Three stories and 42 feet Maximum Floor Area Ratio (FAR) .5% (Adjacent zoning PCD-2 Zoning allows 1.5 FAR) – Comp Plan Guides the site for PCD-2 Uses 1.5%* Parking Stalls – Residential (Senior Housing) Parking Stalls – Medical Office .75 units per unit = 68 spaces One space per 200 s.f. + one space per physician = 200+ spaces 153 spaces 166 spaces* Parking Stall Size 8.5’ x 18’ 8.5 x 18’ Drive Aisle Width 24 feet 24 feet *Not code compliant City of Edina • 4801 W. 50th St. • Edina, MN 55424 Issues/considerations: Density. The residential density proposed is on the low end of the density range within the Comprehensive Plan and therefore reasonable for the site. The density is 28 units per acre. The Comprehensive Plan would allow up to 100 units at this site. Grandview Development Framework. The proposed plans contain two key elements in the Framework: a bridge that would connect the Jerry’s parking ramp and public green space. Plans show the bridge and a 10,500 square foot public plaza in the middle of the site. There is no public building on the site which is shown in the Framework. The City has pursued public buildings on the site but has not worked out. (See attached Development Framework Document.) Grandview Transportation Plan. Sidewalks are proposed along the south and east lot line per the Plan. Also, there is a round-a-bout planned for the intersection of Eden Avenue and Arcadia. The applicant has revised their plans to accommodate the new configuration of this intersection. (Depicted by the red lines on page 1 of the proposed plans.) Setbacks. The setback proposed are relatively tight on Eden Avenue and Arcadia. Given the roadway realignment, and area within the right of way the setbacks seem reasonable. Buildings would be 17 to 22 feet from the curb. The proposed location of the buildings are consistent with the new apartment building to west which is also close to the street at 5 feet to the lot line and 19 feet to the curb on Eden Avenue. Traffic and parking. A traffic and parking study would be required. Affordable Housing. The applicant proposes to provide 10% of the units to meet the City’s Affordable Housing Policy. Proposed heights. The proposed height of 5-6 stories exceeds the code required 4-story maximum. The height would not exceed the height of the Jerry’s office tower. The Grandview Development Framework Study contemplated no buildings exceeding the height of the Jerry’s tower. The added height seems appropriate to obtain affordable housing units, the public plaza and construction of the public bridge across the railroad tracks to connect to the Jerry’s parking ramp and would not exceed the height of the Jerry’s tower. Sustainability. The applicant will be required to fill out the City’s Sustainability Questionnaire to address sustainability issues. The proposed plans would be subject to review and approval of the Nine Mile Creek Watershed District. 1 PROJECT NARRATIVE Sketch Plan Submittal March 31, 2021 Grandview Senior Cooperative & Medical Office Mixed-Use Development 5146 Eden Ave South Edina, Minnesota Project Team: Master Developer Co-Developer Frauenshuh, Inc. United Properties 7101 78th Street West, Suite 100 651 Nicollet Mall, Suite 450 Edina, MN 55439 Minneapolis, MN 55402 Contact: David Anderson, Senior Vice President Contact: Alex Hall, Senior Vice President Phone: 952.829.3480 Phone: 952.820.8725 Email: david.anderson@frauenshuh.com Email: alex.hall@uproperties.com Master Plan Design Team / Architecture Master Plan Design Team / Civil Pope Associates Loucks Associates 1295 Bandana Blvd. N, Suite 200 7200 Hemlock Ln N, Suite 300 St. Paul, MN 55108 Maple Grove, MN 55369 Contact: Paul Holmes, Principal Contact: Vicki VanDell, Engineer Phone: 651.642.9200 Phone: 763.424.5505 email: pholmes@popearch.com email: VVanDell@loucksinc.com Property Owner City of Edina HRA 4801 W 50th St Edina, MN 55424 Contact: Bill Neuendorf, Economic Development Manager Phone: 952.826.0407 Email: BNeuendorf@EdinaMN.gov The team of Frauenshuh, Inc. and United Properties is pleased to submit this package for sketch plan review with the City of Edina Planning Commission and City Council. The enclosed package provides information which describes and illustrates the elements of an exciting redevelopment vision being crafted for the property at 5146 Eden Avenue, commonly referred to as the “former public works site”. 2 At the foundation of this plan and vision are the Grandview District 7 Guiding Principles, which set an important framework for the City’s vision and opportunity to achieve even greater potential for the Grandview District, through sound planning, land uses, design and civic infrastructure reflected in this plan. We are excited to bring this project together, working in collaboration with the City of Edina HRA and community stakeholders to drive the success of this vision. Frauenshuh, Inc. and United Properties are excited to share our long-standing commitment as stakeholders, investors, residents and contributors to the growth and success of the Edina community. We look forward to the opportunity to discuss the overall vision with the Planning Commission and City Council at this early sketch plan/pre-design phase. 1. SITE OVERVIEW Parcel Basics The parcel is approximately 3.125 acres in size and is positioned at the northwest quadrant of Eden Avenue and Arcadia Avenue in the Grandview district of Edina. The site was formerly occupied by the City of Edina public works operations, which relocated its operation to 7450 Metro Blvd. in 2010. Subsequent to the move, the public works building was demolished, and the parcel has remained vacant and minimally maintained in the interim. Project Land Use Data The site is currently zoned Planned Industrial District (PID) and would seek to be rezoned as a Planned Unit Development (PUD) to accommodate the specific use components and attributes that the project will bring to the Grandview district. The proposed development will include a replat of the parcels, creating a new parcel on the north end of the site (the “Senior Cooperative Parcel”) and a parcel on the south end of the site (the “MOB Parcel”) as illustrated in the attached site plan. Integrated with the Senior Cooperative Parcel is an elevated public plaza/green connecting to Arcadia Avenue that would provide an open gathering space amenity and become a unique addition to the community and Arcadia Avenue experience. The north portion of the site would accommodate a future trunk water line extension to be installed, owned and maintained by the City in addition to providing right-of-way for a pedestrian walkway and bridge installation, spanning the rail line and extending to Arcadia Avenue to the east and to the Brookside Parking ramp and nearby developments west of the railroad right-of-way. This pedestrian connection is under evaluation to be developed in coordination with the HRA as part of the 2021 Grandview District improvement plans. In addition to the physical plan and use components of the site, the site plan incorporates and anticipates the future installation of a roundabout at Eden Ave. and Arcadia Ave., widening of Arcadia Ave. and pedestrian improvements to the rail bridge foundation at Eden Ave. These improvements, along with the elements of the development plan for the site, bring together an exciting vision for this important site and its overall integration into the Grandview District. 3 2. DEVELOPMENT DATA Senior Cooperative Overview The senior cooperative project will reside on the north portion of the site with two points of ingress/egress from Arcadia Avenue. The building will be five and one-half stories in height and contain two levels of underground parking (114 spaces), with guest parking on the main level, west portion of the site (39 spaces), for a total of approximately 153 parking spaces. Units will range in size from 1,230 to 1,779 sq. ft. and contain a mix of 2 and 3-bedroom units. Initial programming targets a total unit count of approximately 90 homes. Applewood Pointe Cooperatives provide a “for sale” housing option with high quality finishes in a low maintenance community-based setting. Members elect a resident board of directors responsible for managing their community. Financing is provided through a 40 -ear HUD insured master mortgage. Members choose from 4 equity tiers with the balance financed thru this mortgage eliminating the need to secure individual financing. It is anticipated that this cooperative would include a 10% affordable housing component. Medical Office Building Overview The medical office building project will reside on the south portion of the site with points of ingress/egress from Eden Avenue and Arcadia Avenue. The building will be three stories in height and contain two levels of structured parking (approximately 166 spaces), and a roundabout drop-off area at the southwest entry of the site. The total building area will consist of approximately 40,000 gross square feet and designed to accommodate a range of medical office, clinical and specialty healthcare uses. The materiality and design of the building will provide flexibility to allow the incorporation of brand components that reflect the specific healthcare providers. The overall vision for the building’s architecture will include the incorporation of glass, masonry and metal elements that create an energetic and identifiable ‘point of entry’ into the Grandview district from the southeast. Pedestrian Bridge Overview A key element of the overall vision for the site and response to the Grandview District 7 Guiding Principles is the incorporation of a pedestrian bridge spanning the rail line and connecting the district from east to west. This infrastructure is a key element of ‘unlocking the potential’ of the Brookside parking ramp and drawing pedestrians to destinations on both sides of the rail line through the heart of the Grandview district. Plans are underway for the design scope of this infrastructure and its inclusion with the 2021 Grandview area improvement project. Green Plaza Overview The Green Plaza along Arcadia Avenue is an exciting element of the overall vision of the site and opportunity to bring a dynamic new and functional open space to the Grandview District. The space would be similar in size and dimension to the Grandview Square park and provide 4 adequate space for passive use by pedestrians and also be used for certain types of public gatherings throughout the year. We view the Green Plaza as a key component of the site plan and an exciting opportunity create greater outdoor opportunities for Edina residents, guests and visitors throughout the year. Additionally, we see an opportunity to name or brand the Green Plaza in a way that honors the history of the Edina community and the Grandview District and look forward to exploring these opportunities with the City. Site and Building Program Summary Component Site Area Building Area (Total GSF) FAR Parking Area Total Parking Count Senior Cooperative (SC) 76,000 171,650 2.26 56,740 153 Medical Office Building (MOB) 55,580 40,500 0.73 36,500 166 Green Plaza (11,750 SF) Incl. in SC n/a n/a n/a n/a Total Development Area 131,580 212,150 1.61 93,240 319 Pedestrian Walkway & Bridge 4,540 n/a n/a n/a n/a 3. GRANDVIEW DISTRICT 7 GUIDING PRINCIPLES 1. Leverage publicly owned parcels and civic presence to create a vibrant and connected District that serves as a catalyst for high quality, integrated public and private development. The 5146 Parcel is the “strategic interior link” between the Grandview District Hwy 100 Frontage area and Vernon Avenue West Gateway area. The proposal activates this link with the pedestrian connections, green plaza on Arcadia and maintains access for transit. 2. Enhance the District’s economic viability as a neighborhood center with regional connections, recognizing that meeting the needs of both business and residents will make the District a good place to do business. Economic viability includes tax base, residential living, expanded service offerings and job creation. The proposal hits on all points with tax capacity generation of the entire site, new home ownership opportunities for Edina residents, and economic development to enhance neighborhood center improvements. 3. Turn perceived barriers into opportunities. Consider layering development over supporting infrastructure and taking advantage of the natural topography of the area. The development is layered over structured parking that uses the natural 35-foot topographic differential from north to south. Pedestrian connectivity – once a barrier, is now an opportunity. 4. Design for the present and for the future by pursuing logical increments of change using key parcels as stepping-stones to a more vibrant, walkable, functional, attractive and life-filled place. The site design captures all these themes – vibrant, walkable, functional, attractive and life filled. 5. Organize parking as an effective resource for the District by linking community parking to public and private destinations while also providing parking that is convenient for businesses and customers. The plan offers nearly 200 new parking spaces with the potential for shared district use and moreover activates the Brookside ramp (270+ spaces) into a renewed resource for parking supply in the district with the addition of the pedestrian bridge. 6. Improve movement within and access to the District for people of all ages by facilitating multiple modes of transportation and preserve future transit opportunities provided by the rail corridor. The development is multi-modal, pedestrian led, transit ready. The site plan covers the objective and opportunities for district wide access to and through the site. 7. Create an identity and unique sense of place that incorporates natural spaces into a high quality and sustainable development reflecting Edina’s innovative development heritage. A combination of common space, home ownership and community health and wellness care packaged within a design plan that is sustainable and augments the potential of existing district infrastructure. 5 4. SUMMARY The team of Frauenshuh, Inc. and United Properties is excited to bring this exciting development vision to life through a collaborative effort with the City of Edina HRA. We believe the elements that are incorporated into this vision provide the opportunity to create a truly forward looking, fitting and catalytic redevelopment of this important site in the Grandview District. FIRST LEVEL 114'-0" SECOND LEVEL - MOB 128'-0" THIRD LEVEL - MOB 142'-0" ROOF LEVEL - MOB 156'-0" SECOND LEVEL - HOUSING 161'-0"11'-0"11'-0"11'-0"11'-0"11'-0"16'-0"12'-0"THIRD LEVEL - HOUSING 172'-0" FOURTH LEVEL - HOUSING 183'-0" FIFTH LEVEL - HOUSING 194'-0" ROOF LEVEL - HOUSING 216'-0" FIRST LEVEL - HOUSING 145'-0"14'-0"14'-0"14'-0"LOWER LEVEL - PARKING HOUSING 133'-0" FIRST LEVEL COVERED PARKING SECOND LEVEL SURFACE PARKING MEDICAL OFFICE BUILDING PLAZA GREEN LOBBY & AMENITY SENIOR CO-OP HOUSING COURT AUTO COURT PEDESTRIAN LINK ROOF DECK -1 LEVEL PARKING SIXTH LEVEL - HOUSING 205'-0" LEVEL 2 LEVEL 3 LEVEL 4 LEVEL 5 COURT FIRST LEVEL SECOND LEVEL THIRD LEVEL ARCADIA AVE SECTION LINE SECOND LEVEL - HOUSING 161'-0" THIRD LEVEL - HOUSING 172'-0" FOURTH LEVEL - HOUSING 183'-0" FIFTH LEVEL - HOUSING 194'-0" ROOF LEVEL - HOUSING 216'-0" FIRST LEVEL - HOUSING 145'-0" LOWER LEVEL - PARKING HOUSING 133'-0" SIXTH LEVEL - HOUSING 205'-0" JERRY'S PARKING PEDESTRIAN LINK ROOF DECK -1 LEVEL PARKING FIRST LEVEL PARKING SENIOR CO-OP HOUSING LEVEL 2 LEVEL 3 LEVEL 4 LEVEL 5 LEVEL 6 LEVEL 2 LEVEL 3 LEVEL 4 LEVEL 5 LEVEL 1 GRANDVIEW EDINA, MN 03/31/21 | COMM#26175-21021 SITE SECTION -NORTH 1" = 50'-0" SITE SECTION -WEST 1" = 50'-0" DROP-OFF COVERED PARKING 103 STALLS MOB DROP-OF F184'-4"OFFICE & SERVICE2-STORY ENTRANCE/LOBBY 199'-8" STAIR 3990 GSF NEW PROPOSED ROUNDABOUT LAYOUT SURFACE PARKING 63 STALLS 2-STORY ENTRANCE/LOBBY OFFICE7'-0"123'-8"STAIR 7'-0" 17785 GSF OFFICE STAIR OUTDOOR DECK 18575 GSF GRANDVIEW EDINA, MN 03/31/21 | COMM#26175-21021 MOB -FIRST LEVEL FLOOR PLAN 1" = 50'-0" MOB -SECOND LEVEL FLOOR PLAN 1" = 50'-0" MOB -THIRD LEVEL FLOOR PLAN 1" = 50'-0" STORAGE WORKSHOP STAIR STAIR STAIRSTAIR HOUSING LOWER LEVEL PARKING 114 STALLS AUTO COURT COURT GREAT ROOM ENTRANCE & LOBBY MAILOFFICECRAFT STAIR STAIRSTAIR PARLOR GUEST PARKING 39 STALLS TRASH STAGING TRASH STAIR B10 B10 B4B6 B9 B4B2 RESIDENT OUTDOOR GATHERING D R O P -O FFGRANDVIEW EDINA, MN 03/31/21 | COMM#26175-21021 SENIOR CO-OP -LOWER LEVEL PARKING 1"= 40'-0" SENIOR CO-OP -FIRST LEVEL 1"= 40'-0" OPEN LOUNGE & LIBRARY B11 GUEST ROOM FITNESS STAIR STAIR STAIRSTAIRB7 B1 B1 B1 B5 B5B5 B4 B4 B4 B10 B10 B6 B9 B3 B2 B8 B4 B1 B1 B3 B5 B5 B5 B5 B10 B9 STAIRB7 B1 STAIR STAIR B10 B6 RES STORAGE B4 B4 B4 B2 B8 STAIR GRANDVIEW EDINA, MN 03/31/21 | COMM#26175-21021 SENIOR CO-OP -SECOND LEVEL 1"= 40'-0" SENIOR CO-OP -UPPER LEVELS (3-5) 1"= 40'-0" ROOFTOP PATIO STAIR STAIR CLUB ROOM B7 B4 B1 B1 B1 B4 B3 B8 GRANDVIEW EDINA, MN 03/31/21 | COMM#26175-21021 SENIOR CO-OP -SIXTH LEVEL 1"= 40'-0" GRANDVIEW EDINA, MN 03/31/21 | COMM#26175-21021 SOUTH-EAST PERSPECTIVE GRANDVIEW EDINA, MN 03/31/21 | COMM#26175-21021 NORTH-EAST PERSPECTIVE Date: April 20, 2021 Agenda Item #: IX.A. To:Mayor and City Council Item Type: Minutes From:Jeff Brown, Community Health Administrator Item Activity: Subject:Minutes: Community Health Commission: Nov. 9 and Dec. 14, 2020; and Jan. 11, 2021 Information CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: INTRODUCTION: Draft Community Health Commission Meeting Minutes: November 9, and December 14, 2020; and January 11, 2021. ATTACHMENTS: Description Minutes: Community Health Commission: November 9, 2020 Minutes: Community Health Commission: December 14, 2020 Minutes: Community Health Commission: January 11, 2021 DRAFT US Toll 1-415-655-0001 Access code: 177 792 1394 MINUTES Community Health Commission November 9, 2020 at 6:30 PM City Hall, Community Room I.Call To Order II.Roll Call Present: Andrew Hawkins, Julia Selleys, Philip King-Lowe, Greg Wright, Mike Wood, Rob Loesch, Tracy Nelson, Amanda Herr, Ellie Mullen, Eva DeSimone. Absent: Isadora Li III.Approval Of Meeting Agenda Motion by Amanda Herr to approve meeting agenda. Seconded by Philip King-Lowe. Motion Carried. IV.Approval Of Meeting Minutes A.October 12, 2020 Draft Minutes Motion by Andrew Hawkins to approve October 12, 2020 meeting minutes. Seconded by Greg Wright . Motion Carried. V.Community Comment VI.Reports/Recommendations A.2021 Work Plan Initiative Updates Discussion around work plan items and sub-committees assigned to each item. Sub-committees will report out at meetings as they make progress. Social Connectedness group has met once, Member King-Lowe has drafted questions/script for calling other cities about use of Vitals App. Opioid group has met, has found some links to projects related to curbing opioids, but results are mixed and sometimes not measured. VII.Chair And Member Comments VIII.Staff Comments IX.Adjournment Motion by Andrew Hawkins to to adjourn. Seconded by Greg Wright . Motion . US Toll +1-415-655-0001 Access code: 177 338 8960 MINUTES Community Health Commission December 14, 2020 at 6:30 PM City Hall, Community Room I.Call To Order II.Roll Call Present: Greg Wright, Isadora Li, Julia Selleys, Rob Loesch, Amanda Herr, Ellie Mullen, Michael Wood, Philip King-Lowe, Tracy Nelson, Andrew Hawkins, Eva DeSimone III.Approval Of Meeting Agenda Motion by Greg Wright to approve meeting agenda. Seconded by Amanda Herr. Motion Carried. IV.Approval Of Meeting Minutes A.Minutes: Community Health Commission, November 9, 2020 Motion by Tracy Nelson to approve meeting minutes. Seconded by Andrew Hawkins. Motion Carried. V.Community Comment VI.Reports/Recommendations A.Subcommitee Updates Subcommittee Reports: Initiative 1: Met in December and reviewed script for call to other municipalities on how Vitals App is working. Member King-Lowe planning to start phone calls after the holidays. Group continues to research other social connectedness initiatives. Initiative 3: Divide and conquer strategy, looking for successful approaches to opioid epidemic, including examples that show measurable outcomes. Difficult to find, most examples are State or National. Initiative 2: Scope discussion, developing plan of how to approach initiative. Discussion on possible regulations related to smoking in multi-unit buildings. VII.Chair And Member Comments Member King-Lowe: Submitted for a grant for podcast idea and has been approved, moving to implementation phase, hopes to be up and running in January. Plan to have twice/month podcasts with first 4 slots filled. VIII.Staff Comments IX.Adjournment US Toll 1-415-655-0001 Access code: 177 024 1212 MINUTES Community Health Commission January 11, 2021 at 6:30 PM City Hall, Community Room I.Call To Order II.Roll Call Present: Andrew Hawkins, Philip King-Lowe, Greg Wright, Rob Loesch, Tracy Nelson, Michael Wood, Amanda Herr, Julia Selleys, Isadora Li, Ellie Mullen. III.Approval Of Meeting Agenda Motion by Greg Wright to approve meeting agenda. Seconded by Tracy Nelson. Motion Carried. IV.Approval Of Meeting Minutes A.December 14, 2020 Minutes Motion by Andrew Hawkins to approve December 14, 2020 meeting minutes. Seconded by Greg Wright . Motion Carried. V.Community Comment VI.Reports/Recommendations A.Subcommittee Updates B.COVID-19 Update/Discussion VII.Chair And Member Comments Member King-Lowe: Podcast is active: 'Today's Autistic Moment' can be found with Google search. Student Member Li: Student newspaper response to a letter to the school board about COVID policies is available at zephyrus.com. VIII.Staff Comments IX.Adjournment Motion by Tracy Nelson to adjourn. Seconded by Philip King-Lowe. Motion Carried. Date: April 20, 2021 Agenda Item #: IX.B. To:Mayor and City Council Item Type: Minutes From:Susan M Tarnowski, General Manager-Edina Arts Center Item Activity: Subject:Minutes: Arts & Culture Commission Feb. 25, 2021 Information CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: Receive the minutes of the Arts & Culture Commission from Feb. 25, 2021 INTRODUCTION: See attached minutes. ATTACHMENTS: Description Minutes: Arts & Culture Feb. 25, 2021 Draft Minutes☐ Approved Minutes ☒ Approved Date 3/25/2021 Minutes City of Edina, Minnesota Edina Arts & Culture Commission VIRTUAL MEETING Feb. 25, 2021 4:30 p.m. I. Call to Order Chair Rubin called the meeting to order at 4:34 p.m. II. Roll Call Answering roll call were Commissioners Isaacs, Martin, Piela, Sorenson, Suckow, Rubin. Commissioner Chandler and DiLorenzo joined at 4:42 p.m. Student Commissioners Konkimalla and Shen joined the meeting. Staff present: Parks and Recreation Director Perry Vetter, Assistant Recreation and Facilities Director Tracy Petersen, Administrative Coordinator Janet Canton, Recreation and Jeanette Colby, Program Coordinator. III. Approval of Meeting Agenda Motion made by Sorensen to approve the meeting agenda. Motion seconded by Martin. Roll call vote. Motion carried. IV. Approval of Meeting Minutes Motion made by Martin to approve the Jan. 28, 2021 minutes. Motion seconded by Sorensen Roll call vote. Motion carried. V. Reports/Recommendations A. Public Art Installation: “I” in Edina Parks and Recreation Director Vetter informed the commission that staff has been working on a proposal to rebuild the “I” in Edina public art piece that had been created in 2018 as part of the student artist grant program through the Edina Education Fund ant the ACC. Staff proposes to rebuild the piece in more durable materials to ensure that it can withstand the wear and tear of public placement as well withstand the varying weather conditions. Staff proposes to fund the piece out of the Public Art Fund, which has an approximate balance of $46,000. The rebuild is estimated to cost around $9,000. Chair Rubin opened the item for commissioner questions and discussion. The commission supported the proposal and wanted to ensure that the piece was mobile so it could be brought to additional areas of the city to expose more people to public art, was accessible and be made of durable materials. The commission discussed future maintenance concerns of the existing collection. They also encouraged staff to search for additional partners in the community to provide additional support. The commission would like to revisit the location at a later date. Draft Minutes☐ Approved Minutes ☒ Approved Date Motion made by Commissioner Martin to support the of the Public Art Fund to rebuild the “I” in Edina sculpture. Motion seconded by DiLorenzo. Chair Rubin offered a friendly amendment to the motion to ensure the piece has a mobility component. Commissioner Chandler discussed support to use up to $11,500 from the Public Art Fund. Motions and amendments withdrawn. Motion by Rubin to use up to $11,500 from the Public Art Fund and that the piece has a mobility component for placement around the city or at schools at it is rebuilt as a permanent piece. Motion seconded by Chandler. Roll call vote. Motion carried. B. Use of Public Art Fund: Virtual Gallery Support Commissioners working on Work Plan Initiative #1, implementing the virtual art gallery – From Struggling to Healing: A Continuum, requested the use of the Public Art Fund to support additional promotions and marketing to increase exposure of the event. Chair Rubin opened the item for discussions and questions. Commissioners discussed the request. Motion made by DiLorenzo to use up to $3,000 in Public Art Fund to promote the virtual gallery for 2021 and to create a more detailed plan. Motion seconded by Sorensen. Roll call vote. Motion carried. C. 2021 Work Plan Updates Commissioners discussed updates to the 2021 Work Plan. Commissioners Piela and DiLorenzo discussed further engagement of MOSAIC to initiative #1 and how best to further the goals of the Virtual Art Gallery. Chair Rubin indicated that next meeting new members will have been appointed to the commission and at that time assignments can be revisited. Commissioner Sorensen discussed conversations that the property owners around 50th and France are interested in supporting on their properties related to broader interpretations of public art for performance. Director Vetter indicated that the City Council has requested a discussion on the Arts Center at their annual retreat. That will hopefully provide direction on how staff approaches connecting on Initiative #4 with the commission. D. Annual Election of Officers Director Vetter summarized the process to conduct the annual election of officers. Chair Rubin opened the floor for chair nominations. Rubin nominated Sorensen for Chair of the Arts and Culture Commission. No other nominations received. Motion by Rubin to elect Sorensen as the Chair of the Arts and Culture Commission. Motion seconded by Chandler. Roll call vote. Motion carried. Chair Rubin opened the floor for nominations for vice chair. Rubin nominated himself for Vice Chair. No other nominations received. Approved Date Draft Minutes☐ Approved Minutes ☒ Motion by Rubin to elect Rubin as Vice Chair of the Arts and Culture Commission. Motion seconded by Martin. Roll call vote. Motion carried. VI. Chair and Member Comments VII. Staff Comments A. City Council Updates Director Vetter announced that at the March 1, 2021 regular meeting the Edina City Council appointed 19 residents to various boards and commissions. Three new members have been appointed to the Arts and Culture Commission. Commissioners discussed the importance of welcoming and onboarding the new members and further clarifying the advisory role of the commission to the city council. VIII. Adjournment Motion made by Chandler to adjourn the Feb. 25, 2021 meeting at 6:07 p.m. Motion seconded by Isaacs. Roll call vote. Motion carried. Date: April 20, 2021 Agenda Item #: IX.C. To:Mayor and City Council Item Type: Minutes From:Perry Vetter, Parks & Recreation Director Item Activity: Subject:Minutes: Parks & Recreation Commission Mar. 9, 2021 Information CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: Receive the minutes of the Parks & Recreation Commission from March 9, 2021. INTRODUCTION: See attached minutes. ATTACHMENTS: Description Minutes: Parks & Recreation Commission March 9, 2021 Draft Minutes☐ Approved Minutes☒ Approved Date: 4/13/2021 Minutes City of Edina, Minnesota Edina Parks & Recreation Commission VIRTUAL MEETING March 9, 2021 7 p.m. I. Call to Order Chair Ites called the meeting to order at 7:02 p.m. II. Roll Call Answering roll call were Commissioners Doscotch, Good, Haas, Miller, Nelson, Strother, McAwley, Ites and Student Commissioners Nahlovsky, Sorem, Mork Absent: Commissioner Willette Staff present: Staff Liaison Perry Vetter, Assistant Director Parks & Natural Resources Tom Swenson, Assistant Director Recreation & Facilities Tracy Petersen, Administrative Coordinator Janet Canton, Recreation Supervisor Tiffany Bushland III. Approval of Meeting Agenda Motion made by McAwley to approve the meeting agenda. Motion seconded by Nelson. Roll call vote. Motion carried. IV. Approval of Meeting Minutes Motion made by Strother to approve the Feb. 9, 2021 minutes. Motion seconded by McAwley. Roll call vote. Motion carried. V. Special Recognitions and Presentations A. Welcome new Commissioner Brian Haas to the Parks & Recreation Commission Staff Liaison Vetter introduced Brian Haas the newly appointed member of the Parks & Recreation Commission. Commissioner Haas introduced himself to the commission and gave a brief background of himself. VI. Reports/Recommendations A. Recreation Programming Recap Recreation Supervisor Bushland gave an update on what has been happening with winter programming, the athletic associations and adult programs this past winter season. She also gave an overview of the outdoor rinks this past season. Recreation Supervisor Bushland informed the commission a lot of people have registered for Spring/Summer programs. They are currently going through a lot of waiting lists to try to accommodate as many people as they can in a safe environment. She also noted they are struggling to find applicants for seasonal staff. Draft Minutes☐ Approved Minutes☒ Approved Date: 4/13/2021 Commissioners asked questions and thanked Recreation Supervisor Bushland and the Park Maintenance Staff for the fantastic job they have been doing especially with the ice rinks. Staff Liaison Vetter informed the commission that Recreation Supervisor Bushland has also worked very hard with other staff on things like the Hunt for the Yeti, RECtivity boxes, Best in Snow Contest, in addition to her normal duties that have been impacted by the pandemic. There has been a great sense of teamwork amongst the recreation supervisors on executing other options for residents to participate in during the pandemic. B. 2021 Work Plan Discussion Chair Ites asked the commission to confirm they are listed on the initiatives they signed up for. He also went over the leads of each initiative and asked for any updates there may be on the initiatives. Initiative #1 - Review and comment on proposed plan to identify barriers for participation and reach communities of color through different modes and feedback. Staff Liaison Vetter informed the commission staff is currently working on the initiative for the working group to review and provide their comment. It was noted Commissioner Strother will take the lead on this initiative with Commissioners Miller and McAwley. Initiative #2 – Create presentation to share information about Parks & Recreation facilities, services and systems with up to six community groups. Commissioner Nelson informed the Commission the working group met last week and made some good progress. It was noted Commissioner Nelson will take the lead on this with Commissioners Good, Haas, Nahlovsky and Ites. Initiative #3 – Report and provide recommendations on alternative funding sources for park related improvements including parks, facilities and enterprise upgrades. It was noted Commissioner McAwley will take the lead on this with Commissioners Haas, Willette and Ites. Initiative #4 – Study and report on options to categorize underutilized park amenities/areas and identify park amenity needs. It was noted Commissioner Doscotch will take the lead on this with Commissioners Good, McAwley and Nelson. Initiative #5 – Study and report evaluating options for determining benchmarks (park amenities, operations, service areas) the commission started studying in 2020. It was noted Commissioner Good will take the lead on this with Commissioners Doscotch, Sorem and Mork. Staff Liaison Vetter asked the leads to send him any updates they have and he will put it together for the City Council’s first quarterly review. VII. Chair and Member Comments Commissioner McAwley informed the Commission that the new cell tower is currently being put in at Highlands Park so there has been a lot of activity going on there. Draft Minutes☐ Approved Minutes☒ Approved Date: 4/13/2021 VIII. Staff Comments A. Informational Items Staff Liaison Vetter gave the following updates: The Spring/Summer registration took place on Feb. 17; there is a lot of demand for the programs and they are very happy to see so many people are satisfied and interested in the programs. Along with the new cell phone tower at Highlands Park they are also going to replace the hockey lights that service that rink. Tom Shirley, General Manager of Centennial Lakes Park, has announced his retirement after 31 years of service and they wish him well. Staff has begun recruitment for his replacement. Seasonal hiring is underway and they need applicants. Edinborough Park opened Adventure Peak and the Great Hall with limited capacity. Mayor Hovland and City Manager Neal testified at the Minnesota State Legislature in support of the local options sales tax. This was the first hearing on the issue for the city. B. Upcoming Meetings and Events Staff Liaison Vetter informed the commission their May 11 meeting will need to be rescheduled because of a school district election that will be taking place. It was decided the Parks & Recreation Commission meeting will be held on Wednesday, May 12. He also noted that the Parks & Recreation Commission annual joint session with City Council will take place on May 18. The next Parks & Recreation Commission meeting will be virtual and will take place on April 13. IX. Adjournment Motion made by McAwley to adjourn the March. 9, 2021 meeting at 7:58 p.m. Motion seconded by Nelson. Roll call vote. Motion carried. Date: April 20, 2021 Agenda Item #: XII.A. To:Mayor and City Council Item Type: Other From:Scott Neal, City Manager Item Activity: Subject:Public Engagement Plan for American Rescue Plan Funds Discussion CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: None; discussion only. INTRODUCTION: Manager Neal to discuss the public engagement plan for the American Rescue Plan Funds. ATTACHMENTS: Description Proposed Public Engagement Plan: American Rescue Fund ENGAGEMENT PLAN I AMERICAN RESCUE PLAN ALLOCATION I CITY OF EDINA 1 ENGAGEMENT PLAN AMERICAN RESCUE PLAN PLAN DECISION TO BE MADE - Determine how the American Rescue Plan money will be allocated in two waves. TIMELINE - First disbursement by May 2021 - Council decision June 2021 - Second disbursement by May 2022 - Council decision June 2022 *all the money must be spent by December 2023. PARTICIPATON LEVEL CONSULT - Goal: We will work directly with the public to ensure that public concerns and aspirations are consistently understood and considered. - Promise: We will work to ensure concerns and aspirations are directly reflected in the alternatives developed and provide feedback on how public input influenced the decision. STAKEHOLDERS - Residents - City Council - Human Service Organizations - All City employees - Local businesses - Chamber PUBLIC PARTICIPATION Gathering a multitude of ideas from community members that are from different age ranges, backgrounds and other characteristic demographics to get a pulse of what the needs are from their perspectives. The City wants to receive ideas from the community by designing a space for creativity. QUESTION TO BE ANSWERED Of the eligible uses, what ideas do you have on utilizing the funding? IN SCOPE USES OF FUNDING (WHAT WE KNOW) - Nonprofit organizations ENGAGEMENT PLAN I AMERICAN RESCUE PLAN ALLOCATION I CITY OF EDINA 2 - Water, sewer, broadband infrastructure - Small Businesses / economic recovery - Essential workers pay - COVID-19 expenditures TECHNIQUES City staff will develop techniques and points of participation to collect input. Techniques will leverage the engagement platform, Better Together Edina and offer engaging tools to share information about the American Rescue Fund while inviting the public to share their ideas. The engagement will have an open structure to allow for creativity in ideas. Ultimately the information collected will be utilized to influence the decision on where to allocate the funding. BACKGROUND & EVALUATION The City has already received funding from the CARES Act and did budget amendments in response to COVID -19. DISBURSEMENT TO DATE • In response to the COVID-19 pandemic, a General Fund budget amendment was approved by the City Council in May 2020 decreasing revenues by $1.4M and expenses by $2.05M for a net positive impact of about $600k. This is reflected in the revised budget. • Contractual Services – COVID-19 related expenses. • Contributions & Transfers – Budget stabilization transfer of $3M from the Construction Fund. Budget stabilization is $4.3M total in General Fund assigned fund balance. • Intergovernmental – Total CARES Act funding of $3.9M comprised of $2.3M offsets non-incremental expenses (e.g., reallocation of staff) and $1.6M incremental expenses. Below illustrates breakout of total expenses: • General Fund favorability to budget is comprised of (1) estimated general fund surplus of approximately $5M (includes $2.3M CARES Act, $500k favorable investment income and favorable building permit revenue $1.4M) and (2) budget stabilization transfer-in of $3M. ENGAGEMENT PLAN I AMERICAN RESCUE PLAN ALLOCATION I CITY OF EDINA 3 COMMUNITY IMPACT SURVEY The City conducted a Community Impact Survey in April/May of 2020. The city surveyed residents to assess how the community is doing and to learn if there are any gaps or needs. To assist in identifying the gaps, the following question was asked: What information would help your household the most in preparing for COVID-19? (700 responses, open-ended question, results were themed and quantified) Rank Theme 1 COVID-19 Education - Accurate Data - Information - Protocol on wearing masks - Best practices - COVID cases in Edina 2 City Plans - Closures/Cancellations - Programming - Timeline for reopening - Long-term plan 3 Testing - COVID & antibodies - Where - When - Local options 4 Local Businesses - Open/closed - Shopping tips - Business resources 5 Access to resources - Food - Hand sanitizer / Masks - Financial assistance - Local options 6 Social Distancing - Rules, suggestions - Enforcement - Reporting mechanisms 7 Emotional - Helping kids understand - Isolation - Mental health The survey responses helped the City identify areas for community support. While the City touched on all the themes, themes 1, 2 and 3 have been a priority. This is reflected by the disbursement summary of the CARES Act funding source. Additional funding can enhance the support for remaining gaps (themes 3-7) in addition to unintended impacts of COVID-19 not anticipate. FINAL OUTCOME Following the engagement plan, the City Manager will prepare and submit a recommendation to City Council on how to allocate the money. This report will include the findings from the public input, prepared for Council’s review and approval. Date: April 20, 2021 Agenda Item #: XII.B. To:Mayor and City Council Item Type: Report / Recommendation From:Jessica V. Wilson, Water Resources Coordinator Item Activity: Subject:Project Introduction: Bristol & Mavelle Park/Lynmar Basin Stormwater Improvements Information CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: None. INTRODUCTION: The City is partnering with the Nine Mile Creek Watershed District to study options for providing stormwater improvements at Bristol & Mavelle Park, also referred to as Lynmar Basin. The study will include community engagement and outreach to better understand existing conditions, issues, and needs, and to help develop concept plans for consideration. Project goals are to: Improve the water quality of Lake Edina, and downstream water resources Reduce flood risk in the South Cornelia neighborhood Enhance natural resources, including improving pollinator habitat Keep a portion of the space open for passive recreation Consult residents in the process A memo describing how we intend to work together, consistent with the Memorandum of Understanding established in 2019, is attached. The project webpage can be found at www.BetterTogetherEdina.org/bristol-mavelle-park. ATTACHMENTS: Description Public Engagement Partnership Memo 2019 Memorandum of Understanding Nine Mile Creek Discovery Point 12800 Gerard Drive Eden Prairie, MN 55346 (952) 835-2078 ninemilecreek.org Understanding Our Urban Watershed BOARD OF MANAGERS: Bob Cutshall • Erin Hunker • Larry Olson • Peggy Kvam • Grace Butler To: Nine Mile Creek Watershed District (NMCWD) Board of Managers and City of Edina City Council Date: April 6, 2021 RE: Lynmar Basin/Bristol & Mavelle Park water-quality and flood risk-mitigation project public engagement Introduction Nine Mile Creek Watershed District (NMCWD) and the City of Edina entered into a Memorandum of Understanding in the fall of 2019, agreeing to work together to develop water quality improvement projects within the City. Lake Cornelia and Lake Edina have poor water quality due to excess nutrients, namely phosphorus, which causes nuisance algae and aquatic plant growth. NMCWD completed a study of Lake Cornelia and Lake Edina in 2019, identifying nutrient-loading sources and evaluating potential projects to reduce nutrient loading to the lakes and improve their water quality. As a result, the NMCWD Board of Managers directed NMCWD staff to complete a feasibility study/engineering report, assessing the efficacy and viability of several projects in and around Lake Cornelia and Lake Edina. The study, which was completed in June 2020, is attached. To date, as informed by the report, NMCWD has partnered with the City for: • The implementation of an in-lake alum treatment for Lake Cornelia in the spring of 2020 • The design of a stormwater filtration treatment system in Rosland Park to be constructed in the fall of 2021 • Analysis of goldfish-management options for the lake Lynmar Basin/Bristol & Mavelle Park Opportunity and Public Engagement Partnership The feasibility study/engineering report also identified a potential stormwater retrofit project on City-owned land in Lynmar Basin/Bristol & Mavelle Park within the Lake Edina watershed that would provide stormwater management and flood risk reduction through the construction of stormwater control measures in the park. NMCWD and City staff are partnering on a public engagement process to obtain public feedback on current uses of the park and inform the public on the clean water, flood risk reduction and natural resource benefits that could be achieved by the project. The City and NMCWD intend to develop and refine design concepts based on public feedback. Staff will solicit feedback on design concepts as they evolve and refine the design options accordingly, then develop cost estimates and summary of anticipated project benefits. Nine Mile Creek Discovery Point 12800 Gerard Drive Eden Prairie, MN 55346 (952) 835-2078 ninemilecreek.org Understanding Our Urban Watershed BOARD OF MANAGERS: Bob Cutshall • Erin Hunker • Larry Olson • Peggy Kvam • Grace Butler NMCWD and City staff will inform the Board and City Council throughout the process and provide a final recommendation on whether to proceed with the retrofit project, and (if yes) the preferred design concept and public input that influenced the staff recommendation. If the city and NMCWD decide to proceed with the retrofit project, the NMCWD Board of Managers will order the project, and NMCWD and City staff will develop a cooperative agreement addressing land use, construction and maintenance that will be brought to the Edina City Council and NMCWD Board of Managers for authorization. Sincerely, Randy Anhorn NMCWD Administrator Ross Bintner, PE Edina Engineering Service Manager Date: April 20, 2021 Agenda Item #: XIII. To:Mayor and City Council Item Type: Other From:Sharon Allison, City Clerk Item Activity: Subject:Calendar of City Council Meetings and Events Information CITY OF EDINA 4801 West 50th Street Edina, MN 55424 www.edinamn.gov ACTION REQUESTED: None; information only. INTRODUCTION: Date Time Meeting/Event Location Tues, Apr. 20 5:30 p.m.Public Safety (Closed Meeting) Virtual 7:00 p.m.City Council Regular Meeting Thurs, Apr 22 7:30 a.m.Housing and Redevelopment Authority Virtual Tues, May 4 5:30 p.m.Commissions: Human Rights & Relations / Community Health Virtual 7:00 p.m.City Council Regular Meeting Thurs, May 14 7:30 a.m.Housing and Redevelopment Authority Virtual Tues, May 18 5:30 p.m.Commissions: Parks & Recreation / Arts & Culture 7:00 p.m.City Council Regular Meeting Thurs, May 27 7:30 a.m.Housing and Redevelopment Authority Virtual Mon, May 31 MEMORIAL DAY – CITY HALL CLOSED